CN110016472B

CN110016472B - DTE immobilized nano-microsphere, preparation method thereof and method for producing D-psicose based on DTE immobilized nano-microsphere

Info

Publication number: CN110016472B
Application number: CN201811534238.7A
Authority: CN
Inventors: 卢晓云; 冉淦侨; 谭丹
Original assignee: Bio-Agriculture Institute Of Shaanxi; Xian Jiaotong University
Current assignee: Bio-Agriculture Institute Of Shaanxi; Xian Jiaotong University
Priority date: 2018-12-14
Filing date: 2018-12-14
Publication date: 2021-01-19
Anticipated expiration: 2038-12-14
Also published as: CN110016472A

Abstract

The invention discloses a DTE immobilized nano-microsphere, a preparation method thereof and a method for producing D-psicose based on the DTE immobilized nano-microsphere. Firstly, fusing a D-tagatose-3-epimerase gene (DTE) to the 5' end of a PHA synthase gene (phaC) by a linker by adopting a gene fusion method to obtain a DTE-linker-phaC recombinant gene fragment, respectively transforming the gene fragment into a food-grade expression host L.lactis NZ9000 and ClearColi without endotoxin pollution for induction expression, and synthesizing PHA nano microspheres with DTE on the surfaces in recombinant L.lactis or recombinant ClearColi cells, so that the DTE is effectively combined to the surfaces of the nano microspheres to form immobilized DTE, and the production and immobilization of the DTE are realized in one step.

Description

DTE immobilized nano-microsphere, preparation method thereof and method for producing D-psicose based on DTE immobilized nano-microsphere

Technical Field

The invention belongs to the technical field of food, and relates to DTE immobilized nano-microspheres, a preparation method thereof and a method for producing D-psicose based on the DTE immobilized nano-microspheres.

Background

D-psicose is a rare sugar existing in nature in a very small amount, belongs to hexose and ketose in classification, and is an epimer corresponding to C3 position of D-fructose. The sweetness of D-psicose is equivalent to 70% of sucrose, and the energy is only 0.3% of sucrose, which is low-calorie sugar. Meanwhile, the D-psicose has clean and sweet taste, almost equal to the taste of other high-calorie sugars, and has functional attributes (volume function, gelling property, Maillard reaction characteristic and the like) similar to sucrose, so that the D-psicose can be completely added into food or beverage instead of the sucrose. In addition, researches show that the D-psicose also has physiological functions of regulating and controlling blood sugar, reducing blood fat, reducing abdominal fat accumulation, reducing weight and the like, and the unique functions and potential medical value attract the attention of a plurality of researchers. In 2011D-psicose was recognized by the us FDA as a Generally Recognized As Safe (GRAS) food, allowing it to be added to food. Since the D-psicose is rapidly developed, various products containing D-psicose are appeared on the market, and are widely popular in the market as functional foods for special people (such as diabetic patients and obese people).

Because the content of the D-psicose in the nature is very small, the D-psicose is not easy to extract from the nature; the chemical synthesis method has the problems of complicated purification steps, serious chemical pollution, numerous byproducts and the like, and has not made substantial progress so far. The enzymatic synthesis has the advantages of single reaction, simple purification step and the like, and is the main direction of industrial research of D-psicose. D-tagatose-3-epimerase (DTE for short) can epimerize D-fructose into D-psicose, and is an important catalyst for biotransformation of D-psicose.

However, free D-tagatose-3-epimerase is extremely sensitive to both ambient temperature and acid-base conditions and is easily inactivated; meanwhile, the purification steps of the free enzyme are complex, and the cost is high; and after the catalytic reaction is finished, the enzyme is not easy to separate from the substrate and the product, the repeated reutilization rate is low, and the like. These problems greatly limit the progress of industrialization of D-psicose. Therefore, it is urgently needed to fix free enzyme on a certain carrier by an immobilized enzyme technology to improve the stability of the enzyme, promote the continuous production of the enzyme and reduce the production cost.

Polyhydroxyalkanoates (PHAs) are intracellular polyester granules synthesized by microorganisms, and are spherical, wherein the inside of the granules is provided with a hydrophobic core consisting of polyester chains, and the outside is provided with a hydrophilic boundary layer coated by various PHA granule binding proteins. PHA synthase PhaC is a key enzyme for PHA granule synthesis, linked to PHA polyester chains by covalent bonds, and thus localized on the surface of PHA microspheres. The enzyme protein and PhaC are subjected to fusion expression, and the PHA nanoparticles with the enzyme protein fixed on the surfaces can be directly synthesized in one step in a recombinant microorganism. Since the nanoparticles exist in the form of individual inclusion bodies in the microbial cells, the nanoparticles can be easily and effectively separated from the cells and purified by cell disruption and centrifugation. At present, the technology becomes a new technology of high-efficiency and cheap immobilized enzyme.

Disclosure of Invention

In order to overcome the disadvantages of the prior art, the invention aims to provide DTE immobilized nano microspheres, a preparation method thereof and a method for producing D-psicose based on the DTE immobilized nano microspheres.

In order to achieve the purpose, the invention adopts the following technical scheme to realize the purpose:

the invention discloses a DTE immobilized nano microsphere, wherein a hydrophobic polymer material PHA is arranged inside the DTE immobilized nano microsphere; d-tagatose-3-epimerase is loaded on the surface of the DTE immobilized nano microsphere;

wherein, the protein molecule of the D-tagatose-3-epimerase is fixed on the surface of the microsphere through PHA synthase PhaC, and the PHA synthase PhaC is connected with the hydrophobic polymer material PHA in the microsphere through covalent bonds.

Preferably, the hydrophobic polymer material PHA is polymerized by one or more of polyhydroxybutyrate, polyhydroxycaprylate, polyhydroxycaprate, hydroxybutyrate-hydroxyvalerate, hydroxybutyrate-hydroxyhexanoate copolyester, hydroxybutyrate-hydroxyoctanoate copolyester and hydroxybutyrate-hydroxyvalerate-hydroxyhexanoate copolyester.

Preferably, protein molecules of the D-tagatose-3-epimerase and PHA synthase PhaC on the surface of the microsphere form DTE-PhaC fusion protein, and the amino acid sequence of the DTE-PhaC fusion protein is shown in SEQ ID NO. 1; the connecting peptide sequence between the D-tagatose-3-epimerase molecule and the PHA synthase phaC is G3SG3SG3SG 3S.

The invention also discloses a preparation method of the DTE immobilized nano-microsphere, which comprises the following steps:

1) culturing engineering bacteria for producing DTE immobilized nano-microspheres: recombinant Escherichia coli ClearColi BL21(DE3) pABC-DTE or Lactobacillus lactis pNZ-ABC-DTE;

2) and (3) separating and extracting the DTE immobilized nano-microspheres from the cultured engineering bacteria.

Preferably, the recombinant Escherichia coli ClearColi BL21(DE3) pABC-DTE is preserved in China center for type culture Collection, and the strain preservation number is CCTCC No: m2018788; the preservation time is 11 months and 12 days in 2018.

The Lactobacillus lactis pNZ-ABC-DTE is preserved in China center for type culture Collection, and the preservation number of the Lactobacillus lactis is CCTCC No: m2018810; the preservation time is 11 months and 21 days in 2018.

Preferably, in the step 2), the operation of separating and extracting the DTE immobilized nanospheres from the cultured recombinant Escherichia coli ClearColi BL21(DE3) pABC-DTE comprises:

culturing recombinant Escherichia coli ClearColi BL21(DE3) pABC-DTE to obtain a seed solution, inoculating the seed solution into a fermentation culture medium according to the inoculation amount of 2%, adding NaCl with the final concentration of 10g/L, glucose with the final concentration of 20g/L and Streptomycin with the final concentration of 75mg/L, culturing at 30 ℃ and 200rpm for 4 hours, adding IPTG with the final concentration of 1mM to induce the expression of the nano microspheres, and continuously culturing for 72 hours by shaking and collecting a fermentation liquid;

and (3) after the fermentation liquor is homogenized under high pressure, cell fragments and impurities are removed to obtain DTE immobilized nano microspheres, and then washing and freeze drying are carried out to obtain DTE immobilized nano microsphere powder.

Preferably, in the step 2), the operation of separating and extracting the DTE immobilized nanospheres from the cultured Lactobacillus lactis pNZ-ABC-DTE comprises the following steps:

culturing Lactobacillus lactis pNZ-ABC-DTE to obtain a seed solution, inoculating the seed solution into a culture medium according to the inoculation amount of 5%, adding glucose with the final concentration of 10g/L, L-arginine with the final concentration of 3g/L and chloramphenicol with the final concentration of 10mg/L, and adding nisin with the final concentration of 10ng/mL when standing culture is carried out at 30 ℃ until OD is 0.8 to induce the expression of the nanospheres;

and continuously standing and culturing for 48 hours, collecting fermentation liquor, carrying out high-pressure homogenization treatment on the fermentation liquor, removing cell fragments and impurities to obtain DTE immobilized nano microspheres, and washing, freezing and drying to obtain DTE immobilized nano microsphere powder.

The invention also discloses application of the DTE immobilized nano-microsphere as a D-psicose synthesis catalyst.

The invention also discloses a method for producing D-psicose, which is used for converting D-fructose into D-psicose by using the DTE immobilized nano-microspheres of any one of claims 1 to 3.

Preferably, the specific operations are: according to the weight ratio of (5-10) g: 1L of D-fructose solution with the concentration of 500g/L-750g/L is added into the DTE immobilized nano microsphere powder, and the mixture is stirred and reacted at the temperature of 50-70 ℃ until the reaction is balanced;

the D-fructose solution contains metal ions such as Co with a final concentration of 0.2-1mM²⁺Or Mn²⁺Or Ni²⁺Or Mg²⁺Ions.

Compared with the prior art, the invention has the following beneficial effects:

according to the invention, by means of genetic engineering, D-tagatose-3-epimerase (DTE) is successfully fused to the N end of PHA surface protein PhaC through a section of Linker and is transformed into ClearColi without endotoxin pollution for induction expression, so that PHA nanoparticles with D-tagatose-3-epimerase loaded on the surface are synthesized in recombinant ClearColi thalli in one step, and the production and immobilization of the enzyme are realized in one step. The concrete advantages are as follows:

1. the engineering bacteria for producing the DTE immobilized nano-microsphere are food-grade lactic acid bacteria L.lactis and ClearColi which does not generate endotoxin, so that the safety and the non-toxicity of the synthesized D-psicose are ensured from the source;

2. the invention takes the D-fructose solution with high concentration (50-75%) as the reaction solution, which not only can effectively inhibit the problem of microbial pollution in the reaction process, but also can greatly improve the yield in unit time;

3. the reaction is carried out under the condition that the pH value is 7-8 (neutral or alkalescent), which is beneficial to reducing the sugar solution browning caused by the Maillard reaction;

4. the reaction temperature is 60-70 ℃, so that the problem of microbial pollution in the reaction process can be effectively inhibited, the viscosity of sugar liquor can be effectively reduced, and the enzyme catalysis reaction is accelerated;

5. the immobilized enzyme can be obtained by only one step of microbial fermentation, so that the production process of the immobilized enzyme is greatly simplified, and the production cost of the immobilized enzyme is greatly reduced;

6. the D-psicose-3-epimerase is connected with the nano microspheres through covalent bonds, is firmly combined and not easy to fall off, and the reaction liquid cannot be polluted by protein;

7. the D-psicose-3-epimerase is displayed outside the nano microsphere, the active site of the enzyme can be fully exposed, the combination of the enzyme and a substrate is not limited, the enzyme activity of the immobilized enzyme is high, about 1227.2U/g dry weight of the microsphere, and is obviously higher than that of other immobilized enzymes (see table 1).

8. The thermal stability and the reusability of the DTE immobilized nano-microsphere are obviously superior to those of other immobilized enzymes (see table 1), which shows that the DTE immobilized nano-microsphere can better adapt to continuous industrial production;

9. the carrier material is polyhydroxyalkanoate, is a biodegradable material, can be completely degraded by soil microorganisms in the environment, and is beneficial to environmental protection.

Drawings

FIG. 1 is a plasmid map; wherein (a) is pABC-DTE; (b) is pNZ-ABC-DTE;

FIG. 2 is a graph showing the expression of DTE immobilized nanoparticles in engineering bacteria observed under TEM; wherein, (a) ClearColi BL21(DE3) pABC-DTE; (b) l.lactis pNZ-ABC-DTE;

FIG. 3 is the result of SDS-PAGE analysis of purified DTE immobilized nanospheres;

FIG. 4 is a process of measuring enzyme activity of DTE immobilized nano-microspheres by HPLC;

FIG. 5 shows the result of repeated use of DTE immobilized nanospheres;

FIG. 6 shows that the DTE immobilized nano-microspheres catalyze the conversion of D-fructose into D-psicose.

Strain preservation

The recombinant Escherichia coli ClearColi BL21(DE3) pABC-DTE is preserved in China center for type culture Collection, the address is Wuhan Wuchang Lojia mountain, China, and the preservation name is: escherichia coli Clearcoli pABC-DTE, the preservation number of the strain is CCTCC No: m2018788; the preservation time is 11 months and 12 days in 2018.

Lactobacillus lactis pNZ-ABC-DTE, which is preserved in China center for type culture Collection, addresses Wuhan Wuchang Lojia mountain, China, with the preservation name: the Lactobacillus lactis pNZ-ABC-DTE has the strain preservation number of CCTCC No: m2018810, preservation time 11/21/2018.

Detailed Description

In order to make the technical solutions of the present invention better understood, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The invention is described in further detail below with reference to the accompanying drawings:

1. construction of engineering bacterium ClearColi BL21(DE3) pABC-DTE

1.1 PCR amplification of the phaAB and phaC genes

Primers were designed based on the DNA sequences of phaAB gene and phaC gene in pBHR68 plasmid (containing PHA microspheres derived from r. eutropha strain, gifted by professor cheng chu, qinghua university) as follows:

phaAB EcoRI:TTGGAATTCTTGATGACTGACGTTGTCATCGTATCCG

phaAB HindⅢ：ACTAAGCTTTCAGCCCATATGCAGGCCGC

phaC no start XhoI：AAACTCGAGGCGACCGGCAAAGGCG

phaC stop AvrⅡ：TTTCCTAGGTCATGCCTTGGCTTTGACGTATCG

the primer pair phaAB EcoRI/phaAB Hind III is used for amplifying phaAB genes, and the primer pair phaC no start XhoI/phaC stop Avr II is used for amplifying phaC genes.

PCR reaction (50. mu.l): 5 XSF Buffer(with 10mM MgSO₄): 10 μ l, dNTP Mix (10mM each):1 μ l, upstream and downstream primers: 1. mu.l each, Phanta Super Fidelity DNA Polymerase: 0.5. mu.l, template (pBHR68): 0.3. mu.l, DMSO: 1.5. mu.l, ddH₂O:up to 50μl。

The PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 2min, and 32 cycles; extension at 72 ℃ for 5 min.

1.2 the gene synthesizes D-tagatose-3-epimerase gene dte-linker.

The DTE gene sequence is derived from a D-tagatose-3-epimerase IDF10-3 mutant gene (GenBank: AB000361.1, 928bp, 33kD) of Pseudomonas cichorii with high stability and high catalytic activity, the stop codon sequence of the 3 'end is removed, and a linker gene (encoding polypeptide fragment: G3SG3SG3SG3S) is added at the tail end of the 3' end, and the polypeptide fragment connects DTE at the N end with PhaC at the C end.

1.3 construction of expression plasmid pABC-DTE

The phaAB gene fragment obtained by amplification is separated and purified by gel, and then is subjected to double enzyme digestion by EcoRI and HindIII, and meanwhile, the expression vector pCDFDuet-1 is subjected to double enzyme digestion by EcoRI and HindIII. The PCR product and the vector after double digestion are recovered by a PCR product purification kit (generay, GK 2051). Connecting the recovered PCR product with an expression vector at 22 ℃ for 3h to construct an expression vector pCDFD-AB, then transforming escherichia coli DH5 alpha competent cells, selecting positive transformants, and carrying out colony PCR and enzyme digestion identification on the positive transformants.

And continuing to perform double enzyme digestion on the synthesized dte-linker gene and the expression vector pCDFD-AB obtained in the last step by Bgl II and XhoI respectively. And (3) recovering the DTE-linker gene fragment and the vector after double enzyme digestion by cutting glue, and connecting the recovered DTE-linker fragment and the expression vector pCDFD-AB at 22 ℃ for 3h to construct the expression vector pCDFD-AB-DTE. Then, Escherichia coli DH5 alpha competent cells are transformed, positive transformants are picked, and the positive transformants are subjected to enzyme digestion identification.

And finally, carrying out gel separation and purification on the phaC gene fragment obtained by PCR amplification, and carrying out double enzyme digestion by XhoI and avrli. And the expression vector pCDFD-AB-DTE is digested by XhoI and Avr II. And recovering the PCR product after double enzyme digestion by using a PCR product purification kit, and recovering the vector by using cutting gel. Connecting the recovered PCR product with an expression vector for 3h at 22 ℃, constructing an expression vector pABC-DTE, then transforming ClearColi BL21(DE3) competent cells, selecting positive transformants, and carrying out colony PCR and enzyme digestion identification on the positive transformants. And verifying the correct clone and sending to Shanghai workers for further sequencing identification.

The map of the plasmid pABC-DTE is shown in FIG. 1 (a), T7: the T7 promoter; phaA, a β -keto thiolase gene derived from an r.eutropha strain; phaB is an acetoacetyl-coa reductase gene derived from an r.eutropha strain; dte-linker-phaC: a fusion gene of D-tagatose-3-epimerase and PHA synthase; sm^r: a streptomycin resistance gene. Wherein the phaA and phaB (Re) genes are inserted downstream of the first T7 promoter; the dte-linker-phaC gene was inserted downstream of the second T7 promoter.

2. Induced expression and separation and purification of DTE immobilized nano-microspheres in engineering bacteria ClearColi BL21(DE3) pABC-DTE

2.1 inducible expression of Nano microspheres in engineering bacterium ClearColi BL21(DE3) pABC-DTE

The expression host bacterium ClearColi BL21(DE3) containing pABC-DTE plasmid is cultured in LB culture medium overnight as a seed solution, the seed solution is inoculated into 100ml of fermentation medium (MM culture medium) according to the inoculation amount of 2%, NaCl solution (the final concentration is 10g/L), glucose solution (the final concentration is 20g/L) and Streptomycin (the final concentration is 100mg/L) are added, and IPTG (the final concentration is 0.2g/L) is added after culturing for 4 hours at 30 ℃ and 200rpm to induce the expression of the nanospheres. And continuously culturing for 70 hours by using a shaking table, and collecting fermentation liquor.

2.2 identification, separation and purification of DTE immobilized nanospheres

Collecting engineering bacteria ClearColi BL21(DE3) pABC-DTE bacterial mud for induction expression, adding paraformaldehyde for fixation, preparing an ultrathin section, and observing the expression condition of nanoparticles in the bacteria under a Transmission Electron Microscope (TEM). The result is shown in FIG. 2, the engineering bacterium ClearColi BL21(DE3) pABC-DTE is induced by IPTG to synthesize a large amount of DTE immobilized nano microspheres in cells.

2.3 SDS-PAGE detection and identification of DTE-PhaC protein

Adding 1mL of PBS into 10mg of the purified nano microspheres for resuspension, carrying out protein quantification by a Bradford method, mixing a proper amount of microsphere solution with 5 xSDS gel sample-adding buffer solution, boiling for 10min, and carrying out 10% SDS-PAGE protein electrophoresis.

Polyacrylamide gel electrophoresis: a Bio-Rad electrophoresis device is installed, and 5% of lamination gel and 10% of separation gel at the lower layer are poured and need to be solidified for about 1 hour respectively. And sequentially adding the prepared samples. The initial voltage of electrophoresis is 90V, when the leading edge of the dye reaches the separation gel, the voltage is adjusted to 110V, and the electrophoresis is continued until the leading edge of the bromophenol blue dye reaches the bottom of the separation gel, and the electrophoresis is stopped. The gel is taken down and placed in Coomassie brilliant blue dye solution for dyeing for 1 to 3 hours at room temperature, the gel is placed in destaining solution for destaining until the gel band is clear and the background is transparent, and the observed electrophoresis result is shown in figure 3.

2.4 determination of enzyme Activity of DTE immobilized Nanopalls

And (3) enzyme activity determination: the reaction system was 10g/L D-fructose (prepared in 50mM Tris-HCl buffer (pH 8.0), appropriate amount of enzyme solution and 1.0mM Co²⁺Reacting in 55 deg.C water bath for 15min, boiling in boiling water for 10min to terminate the reaction, centrifuging, collecting supernatant, diluting for 2 times, and measuring the amounts of D-fructose and D-psicose by HPLC.

The HPLC measurement conditions were as follows: an Agilent 1260 high performance liquid chromatography system; a calcium cation exchange column of Sugar pak-1; RI-101 refractive index detector from Shodex corporation; column temperature: 85 ℃, flow rate: 0.4 mL/min; pure water was used as a mobile phase, which was filtered through a 0.22 μm pore size cellulose acetate membrane and degassed by ultrasound. The results are shown in FIG. 4, and it can be seen from FIG. 4 that the DTE nano-microsphere has D-tagatose-3-epimerase activity and can be used for the production of D-psicose.

3 catalyzing and synthesizing D-psicose by using DTE immobilized nano-microspheres

Placing purified nanometer microsphere powder (about 5-10g) in enzyme reactor, adding 1L D-fructose solution with concentration of 500-750 g/L and metal ion (Co) with final concentration of 0.2-1mM²⁺Or Mn²⁺Or Ni²⁺Or Mg²⁺) The reaction was stirred at 60-70 ℃ until equilibrium. At the time of balanceThe conversion of D-psicose was about 35%, and the results are shown in FIG. 6.

As shown in fig. 5, the nano-microspheres in the reaction solution are recovered by microfiltration or centrifugation, so that the nano-microspheres can be reused, and after the nano-microspheres are reused for 8 times, the enzyme activity of the DTE immobilized nano-microspheres is still more than 80% of the initial enzyme activity, and the reusability is good.

4. Construction of engineering bacterium L.lactis pNZ-ABC-DTE

4.1 Gene Synthesis of phaAB Gene

The phaAB gene sequence is from an R.eutropha strain, two ends of the phaAB gene sequence are provided with SphI and SpeI restriction enzyme sites, and the gene fragment is synthesized by Qinglan biological technology limited after being optimized by lactobacillus preference codons.

4.2 Synthesis of dte-linker-phaC Gene fragment.

The DTE gene sequence is derived from a D-tagatose-3-epimerase IDF10-3 mutant gene (GenBank: AB000361.1, 928bp, 33kD) of Pseudomonas cichorii with high stability and high catalytic activity, the stop codon sequence of the 3 'end is removed, and a linker gene (encoding polypeptide fragment: G3SG3SG3SG3S) is added at the tail end of the 3' end, and the polypeptide fragment connects DTE at the N end with PhaC at the C end. The phaC gene sequence is derived from an R.eutropha strain, and is fused with the 3 'end of a dte-linker sequence after an initiation codon sequence at the 5' end is removed, so that a dte-linker-phaC gene fragment is finally formed. Both ends of the gene fragment are provided with SpeI and HindIII restriction endonuclease sites, and the gene fragment is synthesized by Qinglan biological technology limited company after being optimized by lactobacillus preference codons.

4.3 construction of plasmid pNZ-ABC-DTE

The synthesized dte-linker-phaC gene fragment was digested simultaneously with SpeI and HindIII, and expression vector pNZ-8148 was digested simultaneously with SpeI and HindIII. And (4) carrying out gel recovery on the target fragment after enzyme digestion. Connecting the recovered target fragment with an expression vector by using T4 ligase to construct an expression vector pNZ-DTE-C, then transforming escherichia coli DH5 competent cells, selecting positive transformants, and carrying out colony PCR and enzyme digestion identification on the positive transformants.

And continuing to perform double enzyme digestion on the phaAB gene obtained by synthesis and the expression vector pCDFD-DTE-C obtained by the last step by SphI and SpeI respectively. And (3) recovering the phaAB gene fragment subjected to double enzyme digestion and the vector by cutting glue, and connecting the recovered phaAB fragment and the vector pNZ-DTE-C by using T4 ligase to construct an expression vector pNZ-ABC-DTE. And then transforming the L.lactisNZ9000 competent cells, selecting positive transformants, and carrying out colony PCR and enzyme digestion identification on the positive transformants. The correct clone is verified and sent to the qianquke organism for further sequencing identification.

The flow chart for constructing the expression plasmid is shown in FIG. 1 (b). Pnis: the PnisA promoter; terminator: a terminator; repA and repC replicons; phaA, a β -keto thiolase gene derived from an r.eutropha strain; phaB is an acetoacetyl-coa reductase gene derived from an r.eutropha strain; dte-linker-phaC: a fusion gene of D-tagatose-3-epimerase and PHA synthase; cm: a chloramphenicol resistance gene.

5. Induced expression and separation purification of L.lactis pNZ-ABC-DTE in engineering bacteria by nano-microspheres

L.lactis of an expression host bacterium containing pNZ-ABC-DTE plasmid is subjected to static culture in an M17 culture medium until the bacterium is turbid (about 24h) to serve as a seed solution, the seed solution is inoculated into 100mL of M17 culture medium according to the inoculation amount of 5%, a glucose solution (the final concentration is 10g/L), L-arginine (the final concentration is 3g/L) and chloramphenicol (the final concentration is 25mg/L) are added, and nisin (the final concentration is 10ng/mL) is added when the static culture is carried out at the temperature of 30 ℃ until the OD is about 0.8 to continue the culture for 48 h so as to induce the expression of the nanospheres.

Collecting bacterial sludge, and observing the expression condition of the nano particles in the bacteria under a Transmission Electron Microscope (TEM). The result is shown in figure 2, the engineering bacteria L.lactis pNZ-ABC-DTE successfully synthesizes the DTE immobilized nano-microsphere in cells under the induction of nisin.

Collecting fermentation liquor, directly carrying out high-pressure homogenization (15kpsi) on the fermentation liquor for wall breaking, and then respectively removing cell fragments and impurities by adopting a centrifugation (8000 Xg, 15min) or two-stage microfiltration method to obtain the nano microspheres. And fully washing the microspheres obtained by filtering with 50mM phosphate buffer solution, and finally freeze-drying to obtain microsphere powder.

The results of the enzyme property analysis show that:

the D-psicose-3-epimerase is displayed outside the nano microsphere, the active site of the enzyme can be fully exposed, the combination of the enzyme and a substrate is not limited, the enzyme activity of the immobilized enzyme is high, about 1227.2U/g dry weight of the microsphere, and is obviously higher than that of other immobilized enzymes (see table 1).

The thermal stability and the reusability of the DTE immobilized nano-microsphere are obviously superior to those of other immobilized enzymes (see table 1), which shows that the nano-microsphere can better adapt to continuous industrial production.

TABLE 1

In conclusion, the invention constructs two engineering bacteria for synthesizing the DTE immobilized nano-microspheres by a one-step method. Firstly, fusing a D-tagatose-3-epimerase gene (DTE) to the 5' end of a PHA synthase gene (phaC) by a linker by adopting a gene fusion method to obtain a DTE-linker-phaC recombinant gene fragment, respectively transforming the gene fragment into a food-grade expression host L.lactis NZ9000 and ClearColi without endotoxin pollution for induction expression, and synthesizing PHA nano microspheres with DTE on the surfaces in recombinant L.lactis or recombinant ClearColi cells, so that the DTE is effectively combined to the surfaces of the nano microspheres to form immobilized DTE, and the production and immobilization of the DTE are realized in one step.

The above-mentioned contents are only for illustrating the technical idea of the present invention, and the protection scope of the present invention is not limited thereby, and any modification made on the basis of the technical idea of the present invention falls within the protection scope of the claims of the present invention.

Sequence listing

<110> university of west ampere transportation; biological agriculture institute of Shaanxi province

<120> DTE immobilized nano-microsphere, preparation method thereof and method for producing D-psicose based on DTE immobilized nano-microsphere

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2700

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggcagatc taaacaaggt gggcatgttt tatacctatt ggagcaccga atggatggtg 60

gattttccgg cgaccgcgaa acgtattgcg ggcctgggct ttgatctgat ggaaattaac 120

ctggaggagt ttcataacct ggcggatgcg aaaaaacgcg aactgaaagc ggtggcggat 180

gatttaggct taaccgtgat gtgctgcatt ggcctgaaaa gcgaatatga ttttgcgagc 240

ccggataaaa gcgttcgtga tgcgggcacc gaatatgtga aacgcctgct ggatgattgc 300

catttactgg gtgcgccggt ttttgcgggc ctgaactttt gtgcgtggcc gcagcatcct 360

cctctggata tggtggataa acgcccgtat gtggatcgcg cgattgaatc agttcgccgc 420

gtgattaaag tggcggaaga ctatggcatt atttatgcgc tggaagtggt gaaccgctat 480

gaacagtggc tgtgcaacga tgcgaaagaa gcgattgcgt ttgcggatgc ggttgatagc 540

ccggcgtgca aagttcagct ggataccttt catatgaaca tcgaggaaaa cagctttcgc 600

gatgcgattc tggcgtgcaa aggcaaagtg ggccattttc atattggcga acagaaccgc 660

ttacctcctg gtgaaggccg tttaccgtgg gatgaaattt ttggcgcgct gaaagaaatt 720

ggctatgatg gcaccattgc gatggaaccg tttatgcgca ccggtggttc agttggccgc 780

gatgtttgtg tttggcgcga tctgtcaaat ggcgcgaccg atgaagaaat ggatgaacgc 840

gcgcgtcgta gcttacagtt tgtgcgcgat aaattagcgg gtggtggcag cggtggtggt 900

tcaggtggtg gttcaggtgg tggtagcctc gaggcgaccg gcaaaggcgc ggcagcttcc 960

acgcaggaag gcaagtccca accattcaag gtcacgccgg ggccattcga tccagccaca 1020

tggctggaat ggtcccgcca gtggcagggc actgaaggca acggccacgc ggccgcgtcc 1080

ggcattccgg gcctggatgc gctggcaggc gtcaagatcg cgccggcgca gctgggtgat 1140

atccagcagc gctacatgaa ggacttctca gcgctgtggc aggccatggc cgagggcaag 1200

gccgaggcca ccggtccgct gcacgaccgg cgcttcgccg gcgacgcatg gcgcaccaac 1260

ctcccatatc gcttcgctgc cgcgttctac ctgctcaatg cgcgcgcctt gaccgagctg 1320

gccgatgccg tcgaggccga tgccaagacc cgccagcgca tccgcttcgc gatctcgcaa 1380

tgggtcgatg cgatgtcgcc cgccaacttc cttgccacca atcccgaggc gcagcgcctg 1440

ctgatcgagt cgggcggcga atcgctgcgt gccggcgtgc gcaacatgat ggaagacctg 1500

acacgcggca agatctcgca gaccgacgag agcgcgtttg aggtcggccg caatgtcgcg 1560

gtgaccgaag gcgccgtggt cttcgagaac gagtacttcc agctgttgca gtacaagccg 1620

ctgaccgaca aggtgcacgc gcgcccgctg ctgatggtgc cgccgtgcat caacaagtac 1680

tacatcctgg acctgcagcc ggagagctcg ctggtgcgcc atgtggtgga gcagggacat 1740

acggtgtttc tggtgtcgtg gcgcaatccg gacgccagca tggccggcag cacctgggac 1800

gactacatcg agcacgcggc catccgcgcc atcgaagtcg cgcgcgacat cagcggccag 1860

gacaagatca acgtgctcgg cttctgcgtg ggcggcacca ttgtctcgac cgcgctggcg 1920

gtgctggccg cgcgcggcga gcacccggcc gccagcgtca cgctgctgac cacgctgctg 1980

gactttgccg acacgggcat cctcgacgtc tttgtcgacg agggccatgt gcagttgcgc 2040

gaggccacgc tgggcggcgg cgccggcgcg ccgtgcgcgc tgctgcgcgg ccttgagctg 2100

gccaatacct tctcgttctt gcgcccgaac gacctggtgt ggaactacgt ggtcgacaac 2160

tacctgaagg gcaacacgcc ggtgccgttc gacctgctgt tctggaacgg cgacgccacc 2220

aacctgccgg ggccgtggta ctgctggtac ctgcgccaca cctacctgca gaacgagctc 2280

aaggtaccgg gcaagctgac cgtgtgcggc gtgccggtgg acctggccag catcgacgtg 2340

ccgacctata tctacggctc gcgcgaagac catatcgtgc cgtggaccgc ggcctatgcc 2400

tcgaccgcgc tgctggcgaa caagctgcgc ttcgtgctgg gtgcgtcggg ccatatcgcc 2460

ggtgtgatca acccgccggc caagaacaag cgcagccact ggactaacga tgcgctgccg 2520

gagtcgccgc agcaatggct ggccggcgcc atcgagcatc acggcagctg gtggccggac 2580

tggaccgcat ggctggccgg gcaggccggc gcgaaacgcg ccgcgcccgc caactatggc 2640

aatgcgcgct atcgcgcaat cgaacccgcg cctgggcgat acgtcaaagc caaggcatga 2700

<210> 2

<211> 2691

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgaacaagg ttggcatgtt ctacacatac tggtcaacag aatggatggt tgattttcca 60

gctacagcta aacgtattgc tggtcttggt ttcgatctta tggagattaa ccttgaggag 120

ttccacaatc ttgctgacgc taagaaacgt gaacttaaag ctgttgctga cgacttaggt 180

ttaacagtta tgtgctgcat tggtcttaag tcagaatacg acttcgcttc accagacaaa 240

tcagttcgtg atgctggtac agaatacgtt aaacgtcttc ttgacgactg ccatttactt 300

ggtgctccag tttttgctgg tcttaacttt tgtgcttggc cacaacatcc accattagac 360

atggttgaca agcgtccata tgttgaccgt gctattgaat cagttcgtcg tgttattaaa 420

gttgctgagg actacggtat tatttacgct ctcgaggtcg ttaatcgtta cgaacagtgg 480

ttatgcaacg atgctaagga ggctattgct tttgctgatg ctgttgattc accagcttgt 540

aaagttcagc ttgacacctt ccacatgaat attgaggaga actcattccg tgacgctatt 600

cttgcttgca aaggtaaagt tggtcacttc cacattggtg agcagaatcg tttaccacca 660

ggtgaaggtc gtttaccatg ggatgaaatt ttcggtgctc tcaaggaaat tggttacgac 720

ggtacaattg ctatggaacc gtttatgcgt acaggtggtt cagttggtcg tgatgtttgt 780

gtttggcgtg acttatcaaa tggtgctacc gatgaggaaa tggatgaacg tgctcgtcgt 840

tcattacaat tcgtccgtga caaattagct ggtggtggtt caggtggtgg ttcaggtggt 900

ggttcaggtg gtggttcatt agaagctaca ggtaaaggtg ctgctgcttc aacacaagaa 960

ggtaaaagcc agccattcaa agttacacca ggtccatttg atccagctac atggttagaa 1020

tggtcacgtc aatggcaagg tacagaaggt aatggtcatg ctgctgcttc aggtattcca 1080

ggtttagatg ctttagctgg cgttaaaatt gctccagctc agttaggtga tattcagcag 1140

cgttacatga aggatttttc agctctttgg caagctatgg ctgaaggtaa agctgaagct 1200

acaggtccat tacatgatcg tcgttttgct ggtgatgctt ggcgtacaaa tcttccatat 1260

cgttttgctg ctgccttcta tcttcttaac gctcgtgcct taacagaatt agctgacgct 1320

gttgaagctg atgctaaaac acgtcaacgt attcgtttcg ctatttcaca atgggttgat 1380

gctatgtcac cagctaattt ccttgctaca aacccagaag ctcagcgttt attaattgag 1440

tcaggtggcg aatcattacg tgctggtgtt cgtaatatga tggaggactt aacacgtggt 1500

aagatttcac aaacagacga gtcagctttt gaagttggtc gtaacgttgc tgttacagaa 1560

ggtgctgttg ttttcgagaa cgagtacttc cagttacttc agtacaagcc gcttacagac 1620

aaagttcatg cccgtccgtt attaatggtt ccgccgtgca ttaacaagta ttacatcctc 1680

gaccttcagc cggaatcatc attagttcgt cacgttgttg aacaaggtca cacagttttc 1740

ttagtctcat ggcgtaatcc agatgcttca atggctggtt caacatggga tgactacatt 1800

gaacatgctg ctatccgtgc tattgaagtc gctcgtgata tttcaggtca ggacaagatt 1860

aatgtccttg gcttctgtgt tggtggtacc attgtttcaa cagcccttgc tgttttagct 1920

gctcgtggtg aacatccagc tgcttcagtt acacttctta caaccctcct tgatttcgct 1980

gacacaggta ttcttgacgt ttttgttgac gaaggccacg ttcaattacg tgaggctaca 2040

ttaggtggtg gtgctggtgc tccatgtgct ttattacgtg gtcttgagct tgctaatacc 2100

ttctcattcc ttcgtccgaa cgatttagtt tggaactacg tcgttgacaa ctaccttaag 2160

ggtaacacac cagttccatt cgacttatta ttctggaacg gcgacgctac aaatttacca 2220

ggtccatggt attgttggta tcttcgtcac acataccttc agaacgaact taaggttccg 2280

ggtaaactta cagtttgcgg tgttccagtt gatcttgctt caattgacgt tccgacatac 2340

atttacggtt cacgtgagga tcatattgtt ccatggacag ctgcttatgc ttcaacagct 2400

cttcttgcta ataagttgcg tttcgtctta ggtgcttcag gtcatattgc tggcgttatt 2460

aatccaccag ccaagaacaa acgttcacac tggaccaatg atgctttacc agagtcacca 2520

caacaatggt tagctggtgc tattgaacat catggttcat ggtggccaga ttggacagct 2580

tggttagctg gtcaagctgg tgctaaacgt gctgctccag ctaattatgg taatgctcgt 2640

taccgtgcta ttgaaccagc tccaggtcgt tatgttaagg ctaaggcctg a 2691

<210> 3

<211> 896

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Asn Lys Val Gly Met Phe Tyr Thr Tyr Trp Ser Thr Glu Trp Met

1 5 10 15

Val Asp Phe Pro Ala Thr Ala Lys Arg Ile Ala Gly Leu Gly Phe Asp

20 25 30

Leu Met Glu Ile Asn Leu Glu Glu Phe His Asn Leu Ala Asp Ala Lys

35 40 45

Lys Arg Glu Leu Lys Ala Val Ala Asp Asp Leu Gly Leu Thr Val Met

50 55 60

Cys Cys Ile Gly Leu Lys Ser Glu Tyr Asp Phe Ala Ser Pro Asp Lys

65 70 75 80

Ser Val Arg Asp Ala Gly Thr Glu Tyr Val Lys Arg Leu Leu Asp Asp

85 90 95

Cys His Leu Leu Gly Ala Pro Val Phe Ala Gly Leu Asn Phe Cys Ala

100 105 110

Trp Pro Gln His Pro Pro Leu Asp Met Val Asp Lys Arg Pro Tyr Val

115 120 125

Asp Arg Ala Ile Glu Ser Val Arg Arg Val Ile Lys Val Ala Glu Asp

130 135 140

Tyr Gly Ile Ile Tyr Ala Leu Glu Val Val Asn Arg Tyr Glu Gln Trp

145 150 155 160

Leu Cys Asn Asp Ala Lys Glu Ala Ile Ala Phe Ala Asp Ala Val Asp

165 170 175

Ser Pro Ala Cys Lys Val Gln Leu Asp Thr Phe His Met Asn Ile Glu

180 185 190

Glu Asn Ser Phe Arg Asp Ala Ile Leu Ala Cys Lys Gly Lys Val Gly

195 200 205

His Phe His Ile Gly Glu Gln Asn Arg Leu Pro Pro Gly Glu Gly Arg

210 215 220

Leu Pro Trp Asp Glu Ile Phe Gly Ala Leu Lys Glu Ile Gly Tyr Asp

225 230 235 240

Gly Thr Ile Ala Met Glu Pro Phe Met Arg Thr Gly Gly Ser Val Gly

245 250 255

Arg Asp Val Cys Val Trp Arg Asp Leu Ser Asn Gly Ala Thr Asp Glu

260 265 270

Glu Met Asp Glu Arg Ala Arg Arg Ser Leu Gln Phe Val Arg Asp Lys

275 280 285

Leu Ala Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly

290 295 300

Gly Ser Leu Glu Ala Thr Gly Lys Gly Ala Ala Ala Ser Thr Gln Glu

305 310 315 320

Gly Lys Ser Gln Pro Phe Lys Val Thr Pro Gly Pro Phe Asp Pro Ala

325 330 335

Thr Trp Leu Glu Trp Ser Arg Gln Trp Gln Gly Thr Glu Gly Asn Gly

340 345 350

His Ala Ala Ala Ser Gly Ile Pro Gly Leu Asp Ala Leu Ala Gly Val

355 360 365

Lys Ile Ala Pro Ala Gln Leu Gly Asp Ile Gln Gln Arg Tyr Met Lys

370 375 380

Asp Phe Ser Ala Leu Trp Gln Ala Met Ala Glu Gly Lys Ala Glu Ala

385 390 395 400

Thr Gly Pro Leu His Asp Arg Arg Phe Ala Gly Asp Ala Trp Arg Thr

405 410 415

Asn Leu Pro Tyr Arg Phe Ala Ala Ala Phe Tyr Leu Leu Asn Ala Arg

420 425 430

Ala Leu Thr Glu Leu Ala Asp Ala Val Glu Ala Asp Ala Lys Thr Arg

435 440 445

Gln Arg Ile Arg Phe Ala Ile Ser Gln Trp Val Asp Ala Met Ser Pro

450 455 460

Ala Asn Phe Leu Ala Thr Asn Pro Glu Ala Gln Arg Leu Leu Ile Glu

465 470 475 480

Ser Gly Gly Glu Ser Leu Arg Ala Gly Val Arg Asn Met Met Glu Asp

485 490 495

Leu Thr Arg Gly Lys Ile Ser Gln Thr Asp Glu Ser Ala Phe Glu Val

500 505 510

Gly Arg Asn Val Ala Val Thr Glu Gly Ala Val Val Phe Glu Asn Glu

515 520 525

Tyr Phe Gln Leu Leu Gln Tyr Lys Pro Leu Thr Asp Lys Val His Ala

530 535 540

Arg Pro Leu Leu Met Val Pro Pro Cys Ile Asn Lys Tyr Tyr Ile Leu

545 550 555 560

Asp Leu Gln Pro Glu Ser Ser Leu Val Arg His Val Val Glu Gln Gly

565 570 575

His Thr Val Phe Leu Val Ser Trp Arg Asn Pro Asp Ala Ser Met Ala

580 585 590

Gly Ser Thr Trp Asp Asp Tyr Ile Glu His Ala Ala Ile Arg Ala Ile

595 600 605

Glu Val Ala Arg Asp Ile Ser Gly Gln Asp Lys Ile Asn Val Leu Gly

610 615 620

Phe Cys Val Gly Gly Thr Ile Val Ser Thr Ala Leu Ala Val Leu Ala

625 630 635 640

Ala Arg Gly Glu His Pro Ala Ala Ser Val Thr Leu Leu Thr Thr Leu

645 650 655

Leu Asp Phe Ala Asp Thr Gly Ile Leu Asp Val Phe Val Asp Glu Gly

660 665 670

His Val Gln Leu Arg Glu Ala Thr Leu Gly Gly Gly Ala Gly Ala Pro

675 680 685

Cys Ala Leu Leu Arg Gly Leu Glu Leu Ala Asn Thr Phe Ser Phe Leu

690 695 700

Arg Pro Asn Asp Leu Val Trp Asn Tyr Val Val Asp Asn Tyr Leu Lys

705 710 715 720

Gly Asn Thr Pro Val Pro Phe Asp Leu Leu Phe Trp Asn Gly Asp Ala

725 730 735

Thr Asn Leu Pro Gly Pro Trp Tyr Cys Trp Tyr Leu Arg His Thr Tyr

740 745 750

Leu Gln Asn Glu Leu Lys Val Pro Gly Lys Leu Thr Val Cys Gly Val

755 760 765

Pro Val Asp Leu Ala Ser Ile Asp Val Pro Thr Tyr Ile Tyr Gly Ser

770 775 780

Arg Glu Asp His Ile Val Pro Trp Thr Ala Ala Tyr Ala Ser Thr Ala

785 790 795 800

Leu Leu Ala Asn Lys Leu Arg Phe Val Leu Gly Ala Ser Gly His Ile

805 810 815

Ala Gly Val Ile Asn Pro Pro Ala Lys Asn Lys Arg Ser His Trp Thr

820 825 830

Asn Asp Ala Leu Pro Glu Ser Pro Gln Gln Trp Leu Ala Gly Ala Ile

835 840 845

Glu His His Gly Ser Trp Trp Pro Asp Trp Thr Ala Trp Leu Ala Gly

850 855 860

Gln Ala Gly Ala Lys Arg Ala Ala Pro Ala Asn Tyr Gly Asn Ala Arg

865 870 875 880

Tyr Arg Ala Ile Glu Pro Ala Pro Gly Arg Tyr Val Lys Ala Lys Ala

885 890 895

Claims

1. The DTE immobilized nano-microsphere is characterized in that a hydrophobic high polymer material PHA is arranged inside the DTE immobilized nano-microsphere; d-tagatose-3-epimerase is loaded on the surface of the DTE immobilized nano microsphere;

wherein, protein molecules of the D-tagatose-3-epimerase are fixed on the surface of the microsphere through PHA synthase PhaC, and the PHA synthase PhaC is connected with the hydrophobic polymer material PHA in the microsphere through covalent bonds;

the protein molecule of the D-tagatose-3-epimerase and PHA synthetase PhaC on the surface of the microsphere form DTE-PhaC fusion protein, and the amino acid sequence of the DTE-PhaC fusion protein is shown in SEQ ID NO. 1; the connecting peptide sequence between the D-tagatose-3-epimerase molecule and the PHA synthase phaC is G3SG3SG3SG 3S;

the preparation method of the DTE immobilized nano-microsphere comprises the following steps:

1) culturing engineering bacteria for producing DTE immobilized nano-microspheres: recombinant Escherichia coli ClearColi BL21(DE3) pABC-DTE or Lactobacillus lactispNZ-ABC-DTE;

2) separating and extracting DTE immobilized nano-microspheres from the cultured engineering bacteria;

wherein, the recombinant Escherichia coli ClearColi BL21(DE3) pABC-DTE is preserved in China center for type culture Collection, and the strain preservation number is CCTCC No: m2018788;

the Lactobacillus lactispNZ-ABC-DTE is preserved in China center for type culture Collection, and the preservation number of the Lactobacillus lactispNZ-ABC-DTE is CCTCC No: m2018810.

2. The DTE-immobilized nanosphere of claim 1, wherein the hydrophobic polymeric material PHA is polymerized from one or more of polyhydroxybutyrate, polyhydroxyoctanoate, polyhydroxydecanoate, hydroxybutyrate-hydroxyvalerate, hydroxybutyrate-hydroxyhexanoate, hydroxybutyrate-hydroxyoctanoate and hydroxybutyrate-hydroxyvalerate-hydroxyhexanoate.

3. The preparation method of the DTE immobilized nanosphere as described in any one of claims 1-2, which comprises the following steps:

the recombinant Escherichia coli ClearColi BL21(DE3) pABC-DTE is preserved in China center for type culture Collection, and the strain preservation number is CCTCC No: m2018788;

the Lactobacillus lactispNZ-ABC-DTE is preserved in China center for type culture Collection, and the preservation number of the Lactobacillus lactispNZ-ABC-DTE is CCTCC No: m2018810;

wherein, the inside of the DTE immobilized nano-microsphere is hydrophobic polymer material PHA; d-tagatose-3-epimerase is loaded on the surface of the DTE immobilized nano microsphere; protein molecules of the D-tagatose-3-epimerase are fixed on the surface of the microsphere through PHA synthase PhaC, and the PHA synthase PhaC is connected with the hydrophobic polymer material PHA in the microsphere through covalent bonds; the protein molecule of the D-tagatose-3-epimerase and PHA synthetase PhaC on the surface of the microsphere form DTE-PhaC fusion protein, and the amino acid sequence of the DTE-PhaC fusion protein is shown in SEQ ID NO. 1; the connecting peptide sequence between the D-tagatose-3-epimerase molecule and the PHA synthase phaC is G3SG3SG3SG 3S.

4. The method of claim 3, wherein the step 2) of separating and extracting DTE immobilized nanospheres from the cultured recombinant Escherichia coli ClearColi BL21(DE3) pABC-DTE comprises:

5. The method for preparing DTE immobilized nanospheres according to claim 3, wherein the step 2) of separating and extracting DTE immobilized nanospheres from cultured Lactobacillus lactis pNZ-ABC-DTE comprises the following steps:

culturing Lactobacillus lactispNZ-ABC-DTE to obtain a seed solution, inoculating the seed solution into a culture medium according to the inoculation amount of 5%, adding glucose with the final concentration of 10g/L, L-arginine with the final concentration of 3g/L and chloramphenicol with the final concentration of 10mg/L, and adding nisin with the final concentration of 10ng/mL to induce the expression of the nanospheres when standing culture is carried out at 30 ℃ until OD is 0.8;

6. The application of the DTE immobilized nanosphere as defined in any one of claims 1-2 as a catalyst for D-psicose synthesis.

7. A method for producing D-psicose, characterized in that D-fructose is converted into D-psicose by using the DTE-immobilized nanospheres of any one of claims 1 to 2.

8. The method for producing D-psicose according to claim 7, characterized by specifically operating as: according to the weight ratio of 5-10 g: 1L of D-fructose solution with the concentration of 500g/L-750g/L is added into the DTE immobilized nano microsphere powder, and the mixture is stirred and reacted at the temperature of 50-70 ℃ until the reaction is balanced;

the D-fructose solution contains metal ions with the final concentration of 0.2-1 mM.