CN104450594B - Produce genetic engineering bacterium and its construction method and the application of poly butyric-valerate - Google Patents
Produce genetic engineering bacterium and its construction method and the application of poly butyric-valerate Download PDFInfo
- Publication number
- CN104450594B CN104450594B CN201410758183.3A CN201410758183A CN104450594B CN 104450594 B CN104450594 B CN 104450594B CN 201410758183 A CN201410758183 A CN 201410758183A CN 104450594 B CN104450594 B CN 104450594B
- Authority
- CN
- China
- Prior art keywords
- bacterium
- rem
- sequence
- gene
- roche
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/90—Isomerases (5.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/62—Carboxylic acid esters
- C12P7/625—Polyesters of hydroxy carboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y504/00—Intramolecular transferases (5.4)
- C12Y504/99—Intramolecular transferases (5.4) transferring other groups (5.4.99)
- C12Y504/99002—Methylmalonyl-CoA mutase (5.4.99.2)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses the genetic engineering bacterium of production poly butyric-valerate and its construction method and application.The genetic engineering bacterium of the present invention is the gene-deleted strain of true oxygen Roche bacterium or will obtained in the gene-deleted strain of the encoding gene ygfG true oxygen Roche bacterium of importing of the encoding gene argK of encoding gene yliK, GTP kinases of methylmalonyl-CoA mutase and methylmalonyl-CoA decarboxylase or true oxygen Roche bacterium；The gene-deleted strain of the true oxygen Roche bacterium is to obtain at least one missing in the encoding gene of the encoding gene of the 2 Methylcitric acid synthase 1 of true oxygen Roche bacterium and 2 Methylcitric acid synthase 2.Poly butyric-valerate is produced using the recombinant bacterium constructed by the present invention, with advantages below：Bacterial strain safety, raw material relative moderate, fermentation process is easily controlled, it is easy to large-scale production.
Description
Technical field
The invention belongs to biological technical field, and in particular to production poly butyric-valerate genetic engineering bacterium and its
Construction method and application.
Background technology
Because plastics industry is to the seriousness of the dependence and plastic refuse of oil to the pollution of environment, people are forced
Look for substituting the material of the environmentally friendly sustainable development of chemical plastic.Poly- 3-hydroxybutyrate ester (hereinafter referred to as poly- hydroxyl fourth
Acid esters, PHB) it is the high polymer material for being produced and being biodegradable based on bio-based, its performance similar plastics.But PHB
Property it is crisp, post processing be machined with certain difficulty, if in PHB mix 3- hydroxypentanoic acids (3HV) component, obtained poly- 3- hydroxyls
Butyric acid copolymerization 3- hydroxyl valerates (hereinafter referred to as poly butyric-valerate, PHBV) can be changed the performance of material
Kind, hardness, intensity, fusing point decline, but decomposition temperature does not drop, and this is more conducive to the application for widening product.PHBV can be used for
The rack platform that tissue and organ are repaired, the outer packing of slow releasing pharmaceutical, osteanagenesis guiding film builds heart biology valve, medical
Textile, degradable package material and sorbing material etc..
The unique production used during current large-scale production PHBV is very foster Roche bacterium mutant strain with bacterial strain, but is needed in training
Addition propionic acid (salt) or valeric acid (salt) when supporting.Propionic acid (salt) synthesizing propionyl coacetylase, propionyl coenzyme A is condensed with acetyl coenzyme A and generated
Valeryl coacetylase, is the direct precursor thing for synthesizing 3- hydroxypentanoic acids (3HV), and valeric acid (salt) can directly synthesize valeryl coacetylase.And
Propionic acid (salt) or valeric acid (salt) have cytotoxicity, and expensive.Therefore, strict control third is needed during prior art production PHBV
The stream of sour (salt) or valeric acid (salt) adds process, has both reached certain cell concentration, the need for propionyl coenzyme A synthesis is disclosure satisfy that again.
Prior art production PHBV control process is complicated and adds production cost, makes using limited.In the last few years, researcher's profit
Use genetic engineering techniques bacterial strain, but the performance of bacterial strain does not reach the requirement realized and commercially produced far, and Host Strains or be
Pathogenic bacteria.
The content of the invention
It is an object of the present invention to provide a kind of recombinant bacterium.
The recombinant bacterium that the present invention is provided is by encoding gene yliK, GTP kinases of methylmalonyl-CoA mutase
Encoding gene argK and methylmalonyl-CoA decarboxylase encoding gene ygfG import the true oxygen Roche bacterium of host
Ralstonia eutropha are obtained.
In above-mentioned recombinant bacterium, the true oxygen Roche bacterium of host is true oxygen Roche bacterium Rem-1 or true oxygen Roche bacterium Rem-3 or true
Oxygen Roche bacterium Rem-5 or true oxygen Roche bacterium Rem-7.
In above-mentioned recombinant bacterium, the Rem-3 is the true oxygen Roche bacterium Rem-1 missings gene of 2-Methylcitrate synthase -1
The bacterium obtained after prpC1；The true oxygen Roche bacterium Rem-1 can knock out prpC1 genes by homologous recombination, or pass through insertion
PrpC1 genes are inactivated, can also be by the bacterial strains of mutagenic obtained prpC1 gene delections；The specific preparation method of the Rem-3
It is：
(1) DNA fragmentation as shown in sequence 3 in sequence table is inserted to the multiple cloning sites of pJQ200mp18Tc carriers, obtained
To recombinant vector be denoted as pJQ200mp18Tc：：ΔprpC1；
(2) by the pJQ200mp18Tc：：Δ prpC1 carrier Transformed E .coli S17-1, obtained recombinant bacterium is denoted as Δ
PrpC1pJQ200/S17-1, is used as donor bacterium；
(3) using Rem-1 as recipient bacterium, the donor bacterium Δ prpC1pJQ200/S17-1 and recipient bacterium Rem-1 is connect
Transfer is closed, makes the prpC1 gene delections in Rem-1, obtained recombinant bacterium is the Rem-3.
In above-mentioned recombinant bacterium, the Rem-5 is the true oxygen Roche bacterium Rem-1 missings gene of 2-Methylcitrate synthase -2
The bacterium obtained after prpC2；The true oxygen Roche bacterium Rem-1 can knock out prpC2 genes by homologous recombination, or pass through insertion
PrpC2 genes are inactivated, can also be by the bacterial strains of mutagenic obtained prpC2 gene delections；The specific preparation method of the Rem-5
It is：
(1) DNA fragmentation as shown in sequence 6 in sequence table is inserted to the multiple cloning sites of pJQ200mp18Tc carriers, obtained
To recombinant vector be denoted as pJQ200mp18Tc：：ΔprpC2；
(2) by the pJQ200mp18Tc：：Δ prpC2 carrier Transformed E .coli S17-1, obtained recombinant bacterium is denoted as Δ
PrpC2pJQ200/S17-1, is used as donor bacterium；
(3) using Rem-1 as recipient bacterium, the donor bacterium Δ prpC2pJQ200/S17-1 and recipient bacterium Rem-1 is connect
Transfer is closed, the Rem-1 for obtaining prpC2 gene delections is denoted as Δ prpC2/Rem-1, i.e., described Rem-5.
In above-mentioned recombinant bacterium, the Rem-7 is that true oxygen Roche bacterium Rem-1 lacks the gene of 2-Methylcitrate synthase -1
The bacterium obtained after the prpC1 and gene of 2-Methylcitrate synthase -2 prpC2；The true oxygen Roche bacterium Rem-1 can pass through
Homologous recombination knocks out prpC1 and prpC2 genes, or by inserting inactivation prpC1 and prpC2 genes, can also pass through mutagenesis
Obtain the bacterial strain of prpC1 and prpC2 gene delections；The specific preparation method of the Rem-7 is：
(1) DNA fragmentation as shown in sequence 6 in sequence table is inserted to the multiple cloning sites of pJQ200mp18Tc carriers, obtained
To recombinant vector be denoted as pJQ200mp18Tc：：ΔprpC2；
(2) by the pJQ200mp18Tc：：Δ prpC2 carrier Transformed E .coli S17-1, obtained recombinant bacterium is denoted as Δ
PrpC2pJQ200/S17-1, is used as donor bacterium；
(3) using the Rem-3 as recipient bacterium, the donor bacterium Δ prpC2pJQ200/S17-1 and recipient bacterium Rem-3 is entered
Row engagement transfer, the Rem-3 for obtaining prpC2 gene delections is denoted as Δ prpC2/Rem-3, i.e., described Rem-7.
In above-mentioned recombinant bacterium, the amino acid sequence of the 2-Methylcitrate synthase -1 is as shown in sequence 2 in sequence table；Institute
State in the coding gene sequence such as sequence 1 of 2-Methylcitrate synthase -1 from the 5 ' 878-2035 nucleic acid molecules in end
It is shown；The amino acid sequence of the 2-Methylcitrate synthase -2 is as shown in sequence 5 in sequence table；The 2- Methylcitric acids are closed
The coding gene sequence of enzyme -2 in sequence 4 in sequence table from 5 ' as held shown in 1032-2229 nucleic acid molecules.
In above-mentioned recombinant bacterium, the encoding gene yliK of the methylmalonyl-CoA mutase, the GTP kinases
Encoding gene argK and the encoding gene ygfG of the methylmalonyl-CoA decarboxylase pass through recombinant expression carrier
PZMwf imports the true oxygen Roche bacterium of host.
In above-mentioned recombinant bacterium, the construction method of the recombinant expression carrier pZMwf comprises the following steps：Will be as in sequence table
In the multiple cloning sites of yliK-argK-ygfG gene cluster fragment inserting expressioning carriers pLXM1 shown in sequence 7, obtained restructuring
Carrier is denoted as pZMwf.
In above-mentioned recombinant bacterium, sequence 8 in the amino acid sequence of the methylmalonyl-CoA mutase such as sequence table
It is shown；The amino acid sequence of the GTP kinases is as shown in sequence 9 in sequence table；The methylmalonyl-CoA decarboxylase
Amino acid sequence as shown in sequence 10 in sequence table.
It is a further object to provide a kind of encoding gene containing methylmalonyl-CoA mutase
The encoding gene argK of yliK, GTP kinases and the encoding gene ygfG of methylmalonyl-CoA decarboxylase recombination expression
Carrier.
The coding for encoding gene yliK, GTP kinases containing methylmalonyl-CoA mutase that the present invention is provided
The encoding gene ygfG of gene argK and methylmalonyl-CoA decarboxylase recombinant expression carrier is by such as sequence table
Obtained in the multiple cloning sites of yliK-argK-ygfG gene cluster fragment inserting expressioning carriers pLXM1 shown in sequence 7.
In above-mentioned recombinant expression carrier, the amino acid sequence such as sequence table of the methylmalonyl-CoA mutase
Shown in middle sequence 8；The amino acid sequence of the GTP kinases is as shown in sequence 9 in sequence table；The methylmalonyl coenzyme
The amino acid sequence of A decarboxylases is as shown in sequence 10 in sequence table.
It is a still further object of the present invention to provide Rem-3 described above or Rem-5 described above or described above
Rem-7。
Recombinant bacterium described above or recombinant expression carrier described above or Rem-3 described above or Rem-5 or
Applications of the Rem-7 in production poly butyric-valerate falls within protection scope of the present invention.
Recombinant bacterium described above or recombinant expression carrier described above or Rem-3 described above or Rem-5 or
Applications of the Rem-7 in 3HV constituent contents in improving bacterial strain synthesis PHBV falls within protection scope of the present invention.
Final object of the present invention is to provide a kind of method for producing poly butyric-valerate.
The method for production poly butyric-valerate that the present invention is provided comprises the following steps：Using glucose as substrate,
Fermented and cultured recombinant bacterium described above or Rem-3 described above or Rem-5 or Rem-7, obtain the poly butyric-
Valerate.
In the above method, culture medium based on the fermentation medium；The preparation method of the basal medium：Every liter of base
Basal culture medium contains 6.7g Na2HPO4·2H2O、1.5g KH2PO4、1g(NH4)2SO4、0.2g MgSO4·7H2O, 1ml's is micro-
Secondary element and 20g glucose；The micro- preparation method：Contain 0.3g H in every liter of trace element3BO3、0.2g
CoCl2、0.1g ZnSO4·7H2O、0.03g MnCl2·4H2O、0.02g NaMoO4·2H2O、0.02g NiCl2·6H2O、
0.01g CuSO4·5H2O、0.01g CaCl2·2H2O and 0.06g Fe (NH4)2(SO4)2。
In the above method, propionic acid or propionate or valeric acid or valerate are not contained in the culture medium of the fermented and cultured.
There is advantages below using recombinant bacterium production poly butyric-valerate constructed by the present invention：Bacterial strain safety,
Raw material relative moderate, fermentation process is easily controlled, it is easy to large-scale production.
Brief description of the drawings
Fig. 1 is knockout carrier Δ prpC1pJQ200mp18Tc and Δ prpC2pJQ200mp18Tc checking.
Fig. 2 is the schematic diagram with yliK-argK-ygfG gene cluster expression vectors pZMwF.
Fig. 3 is the GC measurement results of PHBV standard items.
Fig. 4 is the GC measurement results that Rem-1 synthesizes PHBV.
Fig. 5 is the GC measurement results that genetic engineering bacterium synthesizes PHBV.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material, reagent used etc., unless otherwise specified, are commercially obtained in following embodiments.
True oxygen Roche bacterium (Ralstonia eutropha) H16 is purchased from DSM.
True oxygen Roche bacterium (Ralstonia eutropha) Rem-1 (being once named as 65-7) is true oxygen Roche bacterium
The bacterial strain that (Ralstonia eutropha) H16 is obtained after mutagenic treatment, true oxygen Roche bacterium (Ralstonia eutropha)
Rem-1 document " Chen Qi etc., using glucose fermentation produce Poly-β-hydroxybutyric acid bacterial strain seed selection, microbiology circular, 1994,
21 (6), mistake disclosed in 333-335 ", the public can obtain from Institute of Microorganism, Academia Sinica.
E.coli S17-1 are in document " Simon R PU, P ü ller A., A broad host range
mobilization system for in vivo genetic engineering:transposon mutagenasis in
gram negative bacteria,Nat.Biotechnol.,1983,1(9):Mistake disclosed in 784-789 ", the public can be therefrom
Institute of microbiology of the academy of sciences of state obtains.
PJQ200mp18Tc carriers are in document " Potter M., Steinb ü chel A., Poly (3-
hydroxybutyrate)granule-associated proteins:impacts on poly(3-
hydroxybutyrate)synthesis and degradation,Biomacromolecules,20056(2),552-60.”
Disclosed in mistake, the public can obtain from Institute of Microorganism, Academia Sinica.
PLXM1 plasmids are in document " Lu Xuemei etc., Ralstonia eutropha W50 L-arabinose metabolic pathway work
Journey is transformed, and microorganism journal, mistake disclosed in 2013,53 (12) 1147-1155. ", the public can grind from Chinese Academy of Sciences microorganism
Study carefully and obtained.
Escherichia coli W3110 is in document " Barfknecht T.R., Smith K.C., Ultraviolet radiation-
induced mutability of isogenic uvrA and uvrB strains of Escherichia coli K-
12W3110.Photochemistry and photobiology, 1977 (26), mistake disclosed in 643-645. ", the public can be therefrom
Institute of microbiology of the academy of sciences of state obtains.
PMDT19-simple plasmids are bought in precious bioengineering Co., Ltd, and catalog number is TAKARA Code：
D104。
The compound method of PG culture mediums：10g containing peptone, dusty yeast 5g, glucose 3g, ammonium sulfate in every liter of PG culture medium
3g。
The preparation method of basal medium：Every liter of basal medium contains 6.7g Na2HPO4·2H2O、1.5g KH2PO4、
1g(NH4)2SO4、0.2g MgSO4·7H2O, 1ml trace element and 20g glucose.
Contain 0.3g H in every liter of trace element3BO3、0.2g CoCl2、0.1g ZnSO4·7H2O、0.03g
MnCl2·4H2O、0.02g NaMoO4·2H2O、0.02g NiCl2·6H2O、0.01g CuSO4·5H2O、0.01g CaCl2·
2H2O and 0.06g Fe (NH4)2(SO4)2。
The structure of the gene knockout carrier of embodiment 1, prpC1 and prpC2
1st, the structure of prpC1 gene knockout carriers
Genomic DNA using very foster Roche bacterium (Ralstonia eutropha) H16 is template, using prpC1df/
PrpC1dr primers enter performing PCR amplification.Primer sequence is as follows：
prpC1df：5’-TAGATCTCAAGCGCGCCGGCTACCGGGCC-3’；
prpC1dr：5’-TTCTAGACAGGTCGAACTTCAGCACGCGCT-3’.
The size that amplification is obtained is 3222bp fragment, is connected on plasmid pMDT19-simple, and obtained restructuring is carried
Body is denoted as pMD19-prpC1, and recombinant vector pMD19-prpC1 is converted into bacillus coli DH 5 alpha, and picking single bacterium colony is extracted plasmid and entered
Row sequencing.Sequencing result shows：The sequence of pcr amplification product as shown in sequence 1 in sequence table, wherein comprising prpC1 genes and
The DNA fragmentation of its two ends homology arm.From 5 ' 878-2035, ends in the nucleotide sequence such as sequence 1 of prpC1 genes
Shown in nucleic acid molecule；The institute of sequence 2 in the amino acid sequence of the 2-Methylcitrate synthase -1 of prpC1 gene codes such as sequence table
Show.
Digestion is carried out to the pMD19-prpC1 of above-mentioned acquisition with restriction enzyme Sac II, due to prpC1 genetic fragments
In the inside of sequence 1 removes 1222bp's from sequence table after the restriction enzyme site containing two Sac II, therefore the plasmid enzyme restriction
Fragment, reclaims large fragment, and obtaining recombinant vector from after connecting with T4 ligases is denoted as pMD19- Δ prpC1, by pMD19- Δs prpC1
Bacillus coli DH 5 alpha is converted, picking single bacterium colony is extracted plasmid and is sequenced with prpC1df/prpC1dr primer pairs.Sequencing result
Show：The DNA molecular in sequence table shown in sequence 3 is carried on the plasmid, Δ prpC1DNA fragments are denoted as, the fragment is by sequence
The sequence that sequence 1 is obtained after being removed from the nucleotides of 5 ' end 1001-2222 in table.
With restriction enzyme Bgl II and Xba I pMD19- Δs prpC1 is carried out double digestion and smooth after with
PJQ200mp18Tc carriers are connected through Sma I digestions and dephosphorylized fragment with T4 ligases, convert bacillus coli DH 5 alpha, are applied
Cloth obtains transformant on the LB flat boards containing tetracycline.The plasmid of transformant is extracted, KpnI digestions are used.pJQ200mp18Tc
Carrier has two Kpn I restriction enzyme sites, during no foreign gene, and the result of digestion is the fragment of two 3kb sizes；When there is external source base
Because when multiple cloning sites are inserted, after KpnI digestions, nucleic acid gel electrophoresis obtains two bands differed in size, illustrates plasmid
In have the insertions of exogenous sequences.The plasmid is the knockout carrier containing prpC1 DNA homolog fragments, is named as
pJQ200mp18Tc：：Δ prpC1 (Fig. 1).
2nd, the structure of prpC2 gene knockout carriers
Genomic DNA really to support Roche bacterium H16 enters performing PCR amplification as template using primer prpC2df/prpC2dr,
Primer sequence is as follows：
prpC2df：TGAGCTCCGTGCATCCTTCCGAGGTCTTGT；
prpC2dr：TCTCGAGTCGAAGGATGATGCGATGGCATT.
The DNA fragmentation for obtaining 3218bp will be expanded, be connected on plasmid pMDT19-simple, obtained recombinant vector note
Make pMD19-prpC2, recombinant vector pMD19-prpC2 is converted into bacillus coli DH 5 alpha, picking single bacterium colony is extracted plasmid and surveyed
Sequence.Sequencing result shows：The sequence of pcr amplification product is as shown in sequence 4 in sequence table, and the PCR primer is to include prpC2 genes
And its DNA fragmentation of two ends homology arm.From 5 ' end 1032- in sequence 4 in the nucleotide sequence of prpC2 genes such as sequence table
Shown in 2229 nucleic acid molecules；In the amino acid sequence of the 2-Methylcitrate synthase -2 of prpC2 gene codes such as sequence table
Shown in sequence 5.
With restriction enzyme Pst I and Cla I to pMD19-prpC2 digestions, after digestion in recombinant vector pMD19-prpC2
The inside of sequence 4 removes 1443bp genetic fragment from sequence table, reclaims large fragment, and weight is obtained from after connecting with T4 ligases
Group carrier is denoted as pMD19- Δ prpC2, and pMD19- Δs prpC2 is converted into bacillus coli DH 5 alpha, and picking single bacterium colony is extracted plasmid and used
PrpC2df/prpC2dr primer pairs are sequenced, and the DNA molecular as shown in sequence 6 in sequence table are carried on the plasmid, altogether
1775bp, is named as Δ prpC2DNA fragments, and the fragment is from the core of 922-2364 of 5 ' ends by sequence in sequence table 4
The sequence that thuja acid is obtained after removing.
With restriction enzyme Sac I and Xho I pMD19- Δs prpC2 is carried out double digestion and smooth after with
PJQ200mp18Tc carriers are connected through Sma I digestions and dephosphorylized fragment with T4 ligases, convert bacillus coli DH 5 alpha, are applied
Cloth obtains transformant on the LB flat boards containing tetracycline.The plasmid of transformant is extracted, KpnI digestions are used.pJQ200mp18Tc
Carrier has two Kpn I restriction enzyme sites, during no foreign gene, and the result of digestion is the fragment of two 3kb sizes；When there is external source base
Because when multiple cloning sites are inserted, after KpnI digestions, nucleic acid gel electrophoresis obtains two bands differed in size, illustrates plasmid
In have the insertions of exogenous sequences.The plasmid is the knockout carrier containing prpC2 DNA homolog fragments, is named as
pJQ200mp18Tc：：Δ prpC2 (Fig. 2).
The structure of embodiment 2, prpC1 and prpC2 gene knock-out bacterial strains
1st, the structure of prpC1 gene knock-out bacterial strains
Gene knockout is carried out by the method for engaging transfer.By pJQ200mp18Tc：：Δ prpC1 knockout carriers are converted
E.coli S17-1, are coated on the LB flat boards containing tetracycline, filter out correct transformant, be named as Δ prpC
1pJQ200/S17-1。
Δ prpC 1pJQ200/S17-1 are used as the donor bacterium of engagement transfer and recipient bacterium Rem-1 carries out engagement transfer.Connect
The process for closing transfer is as follows：Recipient bacterium Rem-1 is inoculated in PG culture mediums first, it is 1.0 to be cultivated in 30 DEG C to OD values；By donor
Bacterium Δ prpC 1pJQ200/S17-1 are inoculated in LB cultures based on 37 DEG C of cultures, and it is 0.4 to grow to OD values；Take respectively 100 μ l by
Supernatant is removed in body bacterium and donor bacteria culture fluid, 3000 revs/min of centrifugations, two plants of bacterium is suspended with PG culture mediums fresh 100 μ l mixed
Close, the dual anti-LB flat boards containing ampicillin (50 μ g/ml) and tetracycline (5 μ g/ml) are coated on after putting 30 DEG C of culture 12h
On, 30 DEG C of cultures.Because Rem-1 can grow on 50 μ g/ml ampicillin plates, and E.coli S17-1 can not be
Grown on ampicillin plate, therefore after 30 DEG C of culture 48h, the bacterium colony only grown on dual anti-flat board is once exchanged
Rem-1 bacterium colonies, sift out purpose bacterial strain, line the LB flat boards containing 20% sucrose, picking single bacterium colony, with prpC1df/prpC1dr
Correct gene knock-out bacterial strain Δ prpC1/Rem-1 is filtered out with bacterium colony PCR for primer, obtained Strain Designation is Rem-3.With
PrpC1df/prpC1dr is primer, bacterium colony PCR checkings is carried out to Rem-3, the clip size of acquisition is 2kb, and uses prpC1df/
The clip size that prpC1dr primer pair primary colonies Rem-1 carries out bacterium colony PCR acquisitions is 3.2kb, it was demonstrated that prpC1 is equal in Rem-3
It has been knocked.
2nd, the structure of prpC2 gene knock-out bacterial strains
Except by pJQ200mp18Tc：：Δ prpC1 knockout carriers replace with pJQ200mp18Tc：：Δ prpC2 is converted
E.coli S17-1, obtain Δ prpC2pJQ200/S17-1 be used as Conjugative tiansfer donor bacterium, using prpC2df/prpC2dr as
Primer is screened outside correct gene knock-out bacterial strain with bacterium colony PCR, gene knock-out bacterial strain Δ prpC2/Rem-1 construction method with it is upper
The construction method for stating gene knock-out bacterial strain Δ prpC1/Rem-1 is identical, and obtained Strain Designation is Rem-5.With prpC2df/
PrpC2dr is primer, bacterium colony PCR checkings is carried out to Rem-5, the clip size of acquisition is 1.8kb, and uses prpC2df/
The clip size that prpC2dr primer pair primary colonies Rem-1 carries out bacterium colony PCR acquisitions is 3.2kb, it was demonstrated that prpC2 is equal in Rem-5
It has been knocked.
3rd, prpC1 and prpC2 gene is while the structure of knock-out bacterial strain
PrpC2 genes are knocked out in Rem-3.Concrete operations are removed pJQ200mp18Tc：：Δ prpC1 knockout carriers are replaced
For pJQ200mp18Tc：：Δ prpC2 Transformed E .coli S17-1, obtain Δ prpC2pJQ200/S17-1 and are used as Conjugative tiansfer
Donor bacterium, replaces with Rem-3 by recipient bacterium Rem-1 and correct base is screened by primer bacterium colony PCR of prpC2df/prpC2dr
Outside because of knock-out bacterial strain, Δ prpC1 Δs prpC2/Rem-1 construction method is with said gene knock-out bacterial strain Δ prpC1/Rem-1's
Construction method is identical, and obtained Strain Designation is Rem-7.Using prpC1df/prpC1dr as primer, bacterium colony PCR is carried out to Rem-7
Checking, the clip size of acquisition is 2kb, using prpC2df/prpC2dr as primer, and bacterium colony PCR checkings are carried out to Rem-7, is obtained
Clip size be 1.8kb, it was demonstrated that prpC1 and prpC2 have been knocked in Rem-7.
Embodiment 3, the structure for producing PHBV genetic engineering bacteriums
1st, the expression vector pZMwf containing foreign gene cluster yliK-argK-ygfG is built
Using Escherichia coli W3110 genomic DNA as template, using primer muyayf/muyayr, obtained through PCR amplifications
Size is 3929bp yliK-argK-ygfG gene clusters, by the yliK-argK-ygfG gene clusters, is connected to pMD19-T
On simple, obtained recombinant vector is denoted as pT-yliK-argK-ygfG, and recombinant vector pT-yliK-argK-ygfG is converted
Escherichia coli, picking single bacterium colony is extracted plasmid and is sequenced.The sequence of primer pair is as follows：
Sense primer Muyayf：5’-TGCGAGCTCATCGTTAATTCTTCAGAAGCGTTCGT-3’；
Anti-sense primer Muyayr：5’-TATAAGCTTTTAATGACCAACGAAATTAGGTT-3’。
Double digestion is carried out to pT-yliK-argK-ygfG with restriction enzyme XbaI and HindIII, yliK- is obtained
ArgK-ygfG gene cluster fragments, carry out double digestion to expression vector pLXM1 with restriction enzyme XbaI and HindIII, obtain
Large fragment；YliK-argK-ygfG gene cluster fragments are connected with large fragment, obtained recombinant vector is denoted as pZMwf (such as Fig. 2
It is shown)；PZMwf is converted into bacillus coli DH 5 alpha, chlorampenicol resistant screening, the plasmid of picking positive colony.
Sequencing result shows：The yliK-argK- inserted between the Xba I and Hind III digestions site of pLXM1 carriers
YgfG gene clusters fragment shows that carrier is correct as shown in the nucleic acid molecule of sequence 7 in sequence table.YliK-argK-ygfG genes
The albumen of cluster coding is methylmalonyl-CoA mutase, GTP kinases and methylmalonyl-CoA decarboxylase.Its
In, the amino acid sequence of methylmalonyl-CoA mutase is as shown in sequence 8 in sequence table, and methylmalonyl is auxiliary
The coding gene sequence of enzyme A mutases is as shown in the 1st to 2143 nucleic acid molecule of sequence 7 in sequence table；The ammonia of GTP kinases
Base acid sequence as shown in sequence 9 in sequence table, in the coding gene sequence of GTP kinases such as sequence table the 2138th of sequence 7 to
Shown in 3131 nucleic acid molecules；The institute of sequence 10 in the amino acid sequence of methylmalonyl-CoA decarboxylase such as sequence table
Show, the 3144th to 3929 core of sequence 7 in the coding gene sequence of methylmalonyl-CoA decarboxylase such as sequence table
Shown in thuja acid molecule.
2nd, the structure of PHBV genetic engineering bacteriums is produced
Expression vector pZMwf with target gene cluster yliK-argK-ygfG is imported by electroporated method
Rem-1 competent cell, screening positive clone on chloramphenicol flat board obtains genetic engineering bacterium, life through bacterium colony PCR checkings
Entitled Rem-2.YliK-argK-ygfG gene cluster fragments shown in nucleic acid molecules of the Rem-2 containing sequence in ordered list 7.
The preparation of true oxygen Roche bacterium Rem-1 competent cells：By true oxygen Roche bacterium Rem-1 single bacterium colonies in solid PG culture mediums
Upper overnight incubation, is then inoculated in 30ml liquid PG culture mediums, 30 DEG C of culture 8h, and bacterium solution is placed in into ice bath cooling afterwards
15min, is collected by centrifugation cell.With 10% glycerine repeated washing, 3 cells of precooling；It is eventually adding cold the 10% of 100 μ l sterilizings
Glycerine, suspension cell, ice bath 20min, packing is preserved or is directly used in electroporated after -80 DEG C.
The expression vector pZMwf with target gene cluster yliK-argK-ygfG is passed through in aforementioned manners electroporated
Method imports Rem-3 competent cell, screening positive clone on chloramphenicol flat board, and gene is obtained through bacterium colony PCR checkings
Engineering bacteria, is named as Rem-4.YliK-argK-ygfG genes shown in nucleic acid molecules of the Rem-4 containing sequence in ordered list 7
Cluster fragment.
The expression vector pZMwf with target gene cluster yliK-argK-ygfG is passed through in aforementioned manners electroporated
Method imports Rem-5 competent cell, screening positive clone on chloramphenicol flat board, and gene is obtained through bacterium colony PCR checkings
Engineering bacteria, is named as Rem-6.YliK-argK-ygfG genes shown in nucleic acid molecules of the Rem-6 containing sequence in ordered list 7
Cluster fragment.
The expression vector pZMwf with target gene cluster yliK-argK-ygfG is passed through in aforementioned manners electroporated
Method imports Rem-7 competent cell, screening positive clone on chloramphenicol flat board, and gene is obtained through bacterium colony PCR checkings
Engineering bacteria, is named as Rem-8.YliK-argK-ygfG genes shown in nucleic acid molecules of the Rem-8 containing sequence in ordered list 7
Cluster fragment.
Embodiment 4, engineering bacteria fermentation production poly butyric-valerate
Picking Rem-2, Rem-3, Rem-4, Rem-5, Rem-6, Rem-7 and Rem-8 single bacterium colony, is cultivated in solid PG respectively
Rule on base overnight incubation, then access contains 20 μ g/mL chloramphenicol basal mediums, 30 DEG C of culture 18-20h, by culture with
10% inoculum concentration is transferred in the shaking flask equipped with the basal medium now prepared (culture Rem-2, Rem-4, Rem-6 and Rem-8
Shi Tianjia 0.1-15 μM VB12), continue to cultivate.During fermented and cultured, respectively at 8 hours, 24 hours, add within 32 hours
The glucose of glucose 3 times, every time addition 1ml 20%, while adjusting pH to 7.0, fermented and cultured 48h.Meanwhile, use identical bar
Part culture Rem-1 bacterium are used as control.
Zymotic fluid 10mL is taken after fermentation ends, 12000 revs/min, centrifugation 5min collects thalline, and thalline is washed with water into two
It is secondary, weighed after 70 DEG C of drying.Weigh 20-30g and dry thalline, thalline will be dried and be transferred to anaerobism pipe, the acidifying of 2mL benzoic acid is added
Methanol and 2mL chloroforms, are capped after covering tightly, 100 DEG C of water-bath 4h, are taken out and are placed after room temperature, add 2mL deionizations H2O is extracted, and is moved to
10mL anaerobism pipes, 3-hydroxybutyrate methyl esters (3HB methyl esters) and 3- hydroxyl methyls (3HV first are detected using gas chromatography
Ester) component.
Gas chromatographic analysis uses Shimadzu GC-2010 gas chromatographs, and chromatographic column is DB-5 (SHIMADZU companies), column length
25 meters, 0.25um is thick, internal diameter 0.25m, fid detector.It is carrier gas with high-purity nitrogen, hydrogen is combustion gas, and air is combustion-supporting gas.
Column temperature：180 DEG C, 250 DEG C of injector temperature, using shunt mode, split ratio is 2.250 DEG C of detector temperature.Poly- hydroxyl fourth
Acid-valerate (PHBV) standard items are purchased from Sigma companies.Experiment sets three repetitions, results averaged.
The gas chromatographic analysis collection of illustrative plates of poly butyric-valerate (PHBV) standard items is as shown in figure 3, going out for 3HB methyl esters
Peak time is 3.3min, and the appearance time of 3HV methyl esters is 3.9min.The gas chromatographic analysis collection of illustrative plates of control strain tunning is such as
Shown in Fig. 4.The gas chromatographic analysis collection of illustrative plates of engineering bacteria fermentation product (Rem-2 shake flask fermentations product) is as shown in figure 5, retain
The peak that time is 3.3min is 3HB methyl esters, and the peak that retention time is 3.9min is 3HV methyl esters.
The genetic engineering obtained prpC1 gene knockouts or prpC2 gene knockouts or prpC1 and prpC2 are knocked out simultaneously after
The fermenting experiment result of bacteria strain is as shown in table 1.
The shake flask fermentation experiment of table 1, Rem-1, Rem-3, Rem-5 and Rem-7
Note：L in table represents the volume of zymotic fluid
As a result show：Compared with Rem-1, the 3HV components that Rem-3 3HV constituent contents improve 57.6%, Rem-5 contain
The 3HV constituent contents that amount improves 24.2%, Rem-7 improve 3 times.The above results illustrate to block by the metabolism of propionyl coenzyme A
Road can significantly improve the content of 3HV components in bacterial strain PHBV synthesis.
YliK-argK-ygfG gene clusters are expressed in different host strain, engineering bacteria fermentation produces PHBV result such as table
Shown in 2.
Table 2, Rem-2, Rem-4, Rem-6 and Rem-8 shake flask fermentation experiment
Note：L in table represents the volume of zymotic fluid
As a result show, compared with Rem-1, Rem-2 3HV constituent contents improve 24.8 times, illustrate to strengthen propionyl coenzyme A
Synthesis can significantly improve bacterial strain PHBV synthesis in 3HV components content.Compared with Rem-3, Rem-4 3HV constituent contents
Improve 27.9 times；Compared with Rem-5, Rem-6 3HV constituent contents improve 14.4 times；Compared with Rem-7, Rem-8's
3HV constituent contents improve 20.8 times.The above results illustrate the metabolic bypass for blocking propionyl coenzyme A, while strengthening propionyl coenzyme A
Synthesis can significantly improve bacterial strain PHBV synthesis in 3HV components content.
Claims (6)
1. recombinant bacterium, by the encoding gene argK of encoding gene yliK, GTP kinases of methylmalonyl-CoA mutase
The true oxygen Roche bacterium (Ralstonia of host is imported with the encoding gene ygfG of methylmalonyl-CoA decarboxylase
Eutropha), the recombinant bacterium is obtained；The true oxygen Roche bacterium of host is true oxygen Roche bacterium Rem-1 or true oxygen Roche bacterium Rem-3
Or true oxygen Roche bacterium Rem-5 or true oxygen Roche bacterium Rem-7；
The amino acid sequence of the methylmalonyl-CoA mutase is as shown in sequence 8 in sequence table；
The amino acid sequence of the GTP kinases is as shown in sequence 9 in sequence table；
The amino acid sequence of the methylmalonyl-CoA decarboxylase is as shown in sequence 10 in sequence table；
The true oxygen Roche bacterium Rem-1 is Ralstonia eutropha 65-7；
The Rem-3 is that true oxygen Roche bacterium Rem-1 lacks the bacterium obtained after the gene of 2-Methylcitrate synthase -1 prpC1；
The Rem-5 is that true oxygen Roche bacterium Rem-1 lacks the bacterium obtained after the gene of 2-Methylcitrate synthase -2 prpC2；
The Rem-7 is that true oxygen Roche bacterium Rem-1 lacks the gene of 2-Methylcitrate synthase -1 prpC1 and the 2- methyl
The bacterium obtained after the gene of citrate synthase -2 prpC2；
The amino acid sequence of the 2-Methylcitrate synthase -1 is as shown in sequence 2 in sequence table；
The amino acid sequence of the 2-Methylcitrate synthase -2 is as shown in sequence 5 in sequence table.
2. recombinant bacterium according to claim 1, it is characterised in that：The volume of the methylmalonyl-CoA mutase
Code gene yliK, the encoding gene argK of the GTP kinases and the methylmalonyl-CoA decarboxylase encoding gene
YgfG imports the true oxygen Roche bacterium of host by recombinant expression carrier pZMwf；
The construction method of the recombinant expression carrier pZMwf comprises the following steps：By the yliK- as shown in sequence 7 in sequence table
In argK-ygfG gene cluster fragment inserting expressioning carriers pLXM1 multiple cloning sites, obtained recombinant vector is denoted as pZMwf.
3. application of the recombinant bacterium in production poly butyric-valerate described in claim 1 or 2.
4. the recombinant bacterium described in claim 1 or 2 is improving 3- during bacterial strain synthesizes poly- 3-hydroxybutyrate copolymerization 3- hydroxyl valerates
Application in hydroxypentanoic acid constituent content.
5. a kind of method for producing poly butyric-valerate, comprises the following steps：Using glucose as substrate, fermented and cultured power
Profit requires the recombinant bacterium described in 1 or 2, obtains the poly butyric-valerate.
6. method according to claim 5, it is characterised in that：Propionic acid or third are not contained in the culture medium of the fermented and cultured
Hydrochlorate or valeric acid or valerate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410758183.3A CN104450594B (en) | 2014-12-10 | 2014-12-10 | Produce genetic engineering bacterium and its construction method and the application of poly butyric-valerate |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410758183.3A CN104450594B (en) | 2014-12-10 | 2014-12-10 | Produce genetic engineering bacterium and its construction method and the application of poly butyric-valerate |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104450594A CN104450594A (en) | 2015-03-25 |
| CN104450594B true CN104450594B (en) | 2017-08-25 |
Family
ID=52897353
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410758183.3A Active CN104450594B (en) | 2014-12-10 | 2014-12-10 | Produce genetic engineering bacterium and its construction method and the application of poly butyric-valerate |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450594B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107012245B (en) * | 2017-05-12 | 2023-05-12 | 兰州海关技术中心 | Real-time fluorescence PCR (polymerase chain reaction) kit for detecting bean epidemic disease bacteria and detection method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102212501B (en) * | 2011-03-31 | 2013-06-12 | 山东大学 | Recombinant escherichia coli and method for applying same to produce poly(3-hydroxybutyrate-3-hydroxyvalerate) (PHBV) by utilizing single carbon source |
-
2014
- 2014-12-10 CN CN201410758183.3A patent/CN104450594B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104450594A (en) | 2015-03-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103981203B (en) | 5 amino-laevulic acid superior strains and its preparation method and application | |
| CN101663389B (en) | An amidase gene knock-out engineered strain for nitrile hydratase production, its construction and application | |
| CN101880696B (en) | Method for producing L-lactic acid by fermentation and bacterial strain using same | |
| CN105734002B (en) | A kind of recombination glutamate producing bacterium strain and the preparation method and application thereof | |
| CN103881954B (en) | Gamma-polyglutamic acid-genetic engineering bacterium and high yield gamma-polyglutamic acid-method thereof are produced in one strain | |
| CN104651291B (en) | One plant of recombinant bacterial strain for producing phenol and its application | |
| CN104651287A (en) | Engineering bacterium for synthesizing glycosylglycerol and application thereof | |
| CN108102995A (en) | A kind of D-Psicose 3- epimerases production bacterial strain and its process for fixation | |
| CN107574176A (en) | A kind of improved resveratrol biological production | |
| CN102816729A (en) | Construction and application of polygene knockout strain of Halomonas sp. TD01 | |
| CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
| CN107287143A (en) | The Recombinant organism and its construction method of high yield butanol and application | |
| CN109321590A (en) | Utilize the genetic engineering bacterium and its construction method of acetic acid production Pfansteihl and application | |
| CN101096651B (en) | Engineering bacterium for expressing poly hydroxy fatty acid ester and its construction method and application | |
| CN101463358B (en) | Nitrile hydratase gene cluster and use thereof | |
| CN103497922B (en) | Recombination klebsiella pneumonia capable of co-producing 3-HP and P3HP, and preparation method and application thereof | |
| CN107201374A (en) | The construction method of the butanediol high-yielding engineering bacterial strains of optical voidness meso 2,3 and application | |
| CN102952774B (en) | Application in a kind of engineering bacteria and aborning long-chain 3-hydroxy fatty acid | |
| CN104762242B (en) | The production bacterium of mevalonic acid and the method for producing mevalonic acid | |
| CN102517303B (en) | Recombination blue-green alga for producing lactic acid as well as preparation method and applications thereof | |
| CN104450594B (en) | Produce genetic engineering bacterium and its construction method and the application of poly butyric-valerate | |
| CN107460152A (en) | Produce recombinant bacterium, construction method and the purposes of rhodioside and the like | |
| CN104789516A (en) | Synechocystis-6803 genetically engineered bacterium capable of producing 3-hydroxypropionic acid, and construction method and application thereof | |
| CN110387344A (en) | Produce the recombinant bacterium of L-Leu, the production method of its construction method and L-Leu | |
| CN104611284A (en) | Strain for production of cyclodextrin glucosyltransferase and application of strain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |