CN107012245B

CN107012245B - Real-time fluorescence PCR (polymerase chain reaction) kit for detecting bean epidemic disease bacteria and detection method thereof

Info

Publication number: CN107012245B
Application number: CN201710331889.5A
Authority: CN
Inventors: 尤佳; 王溪桥; 王军平; 文朝慧; 满岳; 周小平
Original assignee: Lanzhou Customs Technical Center
Current assignee: Lanzhou Customs Technical Center
Priority date: 2017-05-12
Filing date: 2017-05-12
Publication date: 2023-05-12
Anticipated expiration: 2037-05-12
Also published as: CN107012245A

Abstract

The invention provides a Taqman Real-Time PCR kit for detecting a phaseolus vulgaris epidemic disease bacterium and a detection method thereof, wherein the kit comprises amplification premix liquid, fluorescence correction liquid, positive control, negative control, upstream and downstream primers, probes, RNase-free ddH ₂ O. The kit utilizes specific amplification primers and Taqman probes, adopts Real-Time PCR technology, performs qualitative analysis on a sample to be detected through Ct value, has accurate and visual result, saves Time and labor, and shortens the detection Time to 50 minutes; the sensitivity is higher than that of the common PCR, and the PCR can be used for detecting low-micro-content phaseolus vulgaris epidemic disease bacteria samples, and the threshold value of detecting DNA reaches 180 fg/. Mu.l; the reagent consumable cost is lower, and the method is suitable for mass detection business of exit and entrance port quarantine departments and detection research of scientific research institutions.

Description

Real-time fluorescence PCR (polymerase chain reaction) kit for detecting bean epidemic disease bacteria and detection method thereof

Technical Field

The invention relates to the field of microorganism detection, in particular to a Taqman Real-Time PCR kit for detecting a bean corona epidemic and a detection method thereof.

Background

Kidney bean epidemic disease bacteriaPseudomonas savastanoi pv．phaseolicola) Is an inbound plant quarantine pest in China. The host range is mainly leguminous plants including soybean, kidney bean, pea, mung bean and the like. The legume vigor caused by the pathogen infection occurs in europe, asia, america, africa, and oceangoin, and can cause serious losses of legume crops, sometimes even in the absence of harvest. The bean halamic epidemic disease bacteria are transmitted by the seed with bacteria in long distance, the optimum growth temperature of the bacteria is 25-30 ℃, and the bacteria are grown in ChinaEach leguminous crop producing region has conditions for its colonization. Once the germ is transmitted into China, the germ has to have serious influence on soybean industry in China. In recent years, with the increase of domestic consumption demands, the imported soybean quantity in China is in a blowout situation, and the imported soybean quantity in 2016 reaches 8391 ten thousand tons. Most foreign soybean major countries are epidemic areas of bean corona epidemic pathogens, so that the pathogens are highly dangerous to be transmitted into China along with imported leguminous plant materials.

The detection method of the bean corona epidemic disease bacteria comprises a physiological biochemical method, a fatty acid analysis method, a pathogenicity test, a slide agglutination test, an enzyme linked immunosorbent assay and the like, but the conventional methods have long identification time and low sensitivity, so that the rapid detection technology research on the bean corona epidemic disease bacteria carried in imported leguminous crops is accelerated, and the method becomes the problem which is more and more urgent to solve at present.

TaqMan Real-time PCR is based on a common PCR method, a fluorescent marked probe is added, the probe is an oligonucleotide, and a report fluorescent group and a quenching fluorescent group are respectively marked at two ends of the probe. When the probe is complete, the fluorescent signal emitted by the reporter group is absorbed by the quencher group; during PCR amplification, the 5'-3' exonuclease activity of Taq enzyme is used for carrying out enzyme digestion degradation on the probe to separate a report fluorescent group from a quenching fluorescent group, so that a fluorescence monitoring system can receive a fluorescence signal, namely, one fluorescence molecule is formed for each amplified DNA chain, and the accumulation of the fluorescence signal and the formation of a PCR product are completely synchronous. The whole PCR process is monitored in real time by utilizing fluorescence signal accumulation, and the whole process only needs one hour, and in addition, various defects of common molecular biology are removed. The report of the real-time fluorescence method establishment of the quarantine pest, namely the bean epidemic disease bacteria, is not found at home and abroad.

Development of a rapid diagnosis technology suitable for port quarantine is important to strictly quarantine the bean corona epidemic bacteria and prevent the introduction of the pathogenic bacteria. However, the current authoritative detection method is a method for quarantining and identifying the phaseolus vulgaris epidemic disease bacteria by the national quality supervision and inspection bureau issued by the national institutes of republic of people's republic of China (SN/T1586.2-2008) of the industry standard of entry and exit inspection and quarantine, which comprises the following steps: physiological and biochemical index detection, pathogenicity detection and common molecular method. Wherein the detection of biochemical indicators for suspected strains must be accomplished in at least four ways: the method comprises the steps of performing next experiment on suspicious colonies removed by enzyme positive, oxidase negative, D-mannitol negative and glutarate negative, and having long experiment period; the pathogenicity detection can not be used as a detection method alone, and is often used as an auxiliary identification means; the sensitivity of the common PCR method is common, and two steps of PCR amplification and agarose gel electrophoresis are needed, the time is at least 3 hours, and the nucleic acid dye used in the electrophoresis experiment pollutes the environment, has high carcinogenicity and has a certain influence on the health of human bodies. In addition, for other plant pathogens, the 16S rDNA universal primer commonly used in the laboratory can be used as a primer for PCR amplification sequencing to identify, but the 16S rDNA universal primer has extremely poor specificity for bacterial identification under pseudomonas, and is difficult to identify the species. Therefore, for port quarantine, the daily import and export detection traffic is large, the strain identification effect by using the common method is poor, the detection efficiency is low, and meanwhile, the detection period is long, so that the operation cost of imports and exporters can be increased.

Therefore, the invention aims to provide a Taqman Real-Time PCR kit for detecting the bean corona epidemic and a detection method thereof.

Disclosure of Invention

In view of the defects of the prior art, the invention provides a Taqman Real-Time PCR kit for detecting the phaseolus vulgaris and a detection method thereof, wherein a specific amplification primer and a Taqman probe are utilized, a Real-Time PCR technology is adopted, and the phaseolus vulgaris epidemic detection qualitative analysis is carried out on a sample to be detected through a Ct value.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

a Taqman Real-Time PCR kit for detecting the vigna phaseoloides comprises a kit main body and reagents as listed in table 1; wherein the kit body comprises: the box body is hollow and contains refrigerating fluid; placing a reagent in the box; a box cover is arranged above the box body; one side of the box body is provided with a drawer, and DNA of a sample to be detected is placed in the drawer. A cavity with a small hole is further formed in one side of the kit, the cavity is separated from the freezing liquid in the kit by an elastic plastic sheet, the volume of the freezing liquid expands when being solidified, the plastic sheet bends towards one side of the cavity, and the expansion pressure is relieved, so that the kit is prevented from being burst.

Table 1 reagents contained in the kit

Containing reagents	Specification of specification
		PCR Forward Primer	2OD
PCR Reverse Primer	2OD
		Taqman Probe	2OD
Amplification premix	1ml
		RNase-free ddH ₂ O	1.5ml
Fluorescence correction fluid	1ml
		Positive control	100μl
Negative control	100μl

Preferably, a Taqman Real-Time PCR kit for detecting the bean corona epidemic has the sequence PCR Forward Primer: 5'-GTGGGTACATCTGGAATC-3'; the bacillus subtilis argK is designed by taking a vigna unguiculata argK gene as a template.

Preferably, a Taqman Real-Time PCR kit for detecting the bean corona epidemic has the sequence PCR Reverse Primer: 5'-CTGACATCCTCCGTATTG-3'; the bacillus subtilis argK is designed by taking a vigna unguiculata argK gene as a template.

Preferably, a Taqman Probe sequence in a Taqman Real-Time PCR kit for detecting the bean corona epidemic is as follows: 5'- (FAM) ATCACCGTCGCACCATACGA (TAMRA) -3'; the bacillus subtilis argK is designed by taking a vigna unguiculata argK gene as a template.

Preferably, the amplification premix used for detecting the phaseolus vulgaris Taqman Real-Time PCR kit comprises: DNA polymerase, 2 XPCR buffer (500 mM/L KCl, 100 mM/L Tris-HCl, 150mM/L MgCl) ₂ Gelatin 1 mg/ml), dNTP stock solution, RNase H.

Preferably, the fluorescence correction fluid used for detecting the Taqman Real-Time PCR kit of the bean corona epidemic disease bacteria comprises: ROX fluorescent dye.

Preferably, the positive control in the Taqman Real-Time PCR kit for detecting the phaseolus vulgaris is DNA extracted and purified by using a phaseolus vulgaris standard strain.

Preferably, a negative control in a Taqman Real-Time PCR kit for detecting the group bean corona epidemic is purified DNA extracted from healthy soybean seeds.

Preferably, the Taqman Real-Time PCR kit for detecting the phaseolus vulgaris epidemic disease bacteria is preserved at the temperature of-20 ℃ and is hermetically preserved to prevent pollution.

A Taqman Real-Time PCR detection method for detecting a bean corona epidemic disease bacterium comprises the following operation steps:

1. diluting the probe and the primer;

2. preparing a PCR reaction solution;

3. performing Real-time PCR reaction;

4. and (5) analyzing experimental results.

Preferably, one usesThe method for detecting the Taqman Real-Time PCR of the bean sickness bacteria comprises the following steps of: the probe and primer were centrifuged for 5min before uncapping, and then RNase-free ddH was used according to nmol number ₂ O was formulated as an Oligo solution at a concentration of X. Mu.M. Adding RNase-free ddH into an Oligo solution with concentration of X mu M ₂ O volume:

v (ml) =nmol number/X

Preferably, a Taqman Real-Time PCR detection method for detecting the phaseolus vulgaris is provided, wherein the PCR reaction solution is prepared according to the method shown in the table 2 when the PCR reaction solution is prepared in the step 2:

TABLE 2 preparation method of PCR reaction solution

Reagent(s)	Usage amount
		Amplification premix
	10 μl
		PCR Forward Primer(10μM)	0.4 μl
PCR Reverse Primer(10μM)	0.4 μl
		Taqman Probe	0.2 μl
RNase-free ddH ₂ O	6.6 μl
		DNA	2μl
Fluorescence correction fluid	0.4μl
		Total	20 μl

Preferably, the Taqman Real-Time PCR detection method for detecting the bean corona epidemic disease bacteria comprises the following steps:

hold Stage Pre-denaturation

Reps:1

95 ℃ for 30 seconds

PCR Stage PCR reaction

Reps：40

95 ℃ for 5 seconds

60 ℃ for 30 seconds.

Preferably, the Taqman Real-Time PCR detection method for detecting the bean corona epidemic disease bacteria comprises the following specific method of step 4 experiment result analysis:

after the reaction, the Real-time PCR amplification curve and CT value were confirmed.

If the CT of the detection results of 2 parallel samples of the sample to be detected is more than or equal to 40, the CT of the positive control detection is more than or equal to 20 and less than or equal to 36, and a typical amplification curve appears, and the negative control and blank control results are normal, the sample can be judged not to detect the phaseolus vulgaris epidemic pathogen at the moment.

If CT is less than or equal to 36 in 2 parallel samples of the sample to be detected, CT is less than or equal to 20 and less than or equal to 36 in positive control detection, a typical amplification curve appears, and negative control and blank control results are normal, so that the detection of the phaseolus vulgaris in the sample can be judged.

If the CT of the 2 parallel samples of the sample to be detected is 36 < 40 and a typical amplification curve appears, the CT of the positive control is 20-36 and a typical amplification curve appears, the negative control and the blank control result are normal, and then the real-time fluorescence PCR detection is reworked after the DNA template quantity is properly increased.

Preferably, the method for detecting the Taqman Real-Time PCR of the bean sickness bacteria requires a Real-Time PCR amplification instrument, an autoclave centrifuge tube, a micropipette and an autoclave gun head besides the Taqman Real-Time PCR kit for detecting the bean sickness bacteria.

The beneficial effects are that: the vigna unguiculata itself has toxin resistance coding gene argK, and the gene is only in vigna unguiculata and pseudomonas syringae kiwi pathogenicityP．syringae pv．actinidiae) Two bacteria; the target gene detected using argK has a high degree of specificity. The traditional method adopts a 16S rDNA universal primer as a detection target gene, has low specificity on pseudomonas syringae, and is difficult to identify the species because at least 23 strains are searched in genebank to be paired with the pseudomonas syringae. The invention designs the Taqman probe and the amplification primer, optimizes the system to obtain the optimal system configuration and the amplification program condition, and produces the Real-time PCR detection kit based on the Taqman probe for the bean sickness virus, and the multiple test results prove that the kit can rapidly and specifically detect the bean sickness virus from the strain to be tested, and the sensitivity of the kit is far higher than that of the conventional PCR, and the threshold value for detecting DNA reaches 180 fg/mu L.

The design of the kit can further facilitate the test, and the kit is internally provided with a refrigerating fluid, so that the reagent and the sample DNA can keep low temperature in the test process, and the test result is more accurate.

The invention can greatly save the detection time cost of the bean corona epidemic disease bacteria, and the whole experiment only needs 50 minutes; the reagent used for detection is nontoxic and environment-friendly. The detection experiment process is simple to operate, the system is configured and is on-line, and the whole scale is visible; the reagent consumable in the kit has low cost and is suitable for mass detection business of port quarantine departments; the sensitivity of the kit is far higher than that of the conventional PCR, and the threshold value for detecting DNA reaches 180 fg/. Mu.L; the kit has strong specificity, and once a positive result appears in a sample, the sample can be judged to contain the epidemic disease of the kidney bean in China.

Drawings

FIG. 1 is an amplification curve of a Taqman Real-Time PCR detection method for detecting a group bean epidemic disease bacterium according to the present invention.

FIG. 2 is a sensitivity detection amplification curve of a probe pair of the Taqman Real-Time PCR detection method for detecting the epidemic disease bacteria of the kidney bean, which is used for detecting the epidemic disease bacteria of the kidney bean.

FIG. 3 is a diagram showing the pathogenicity of a positive strain used for detecting the Taqman Real-Time PCR detection method of the epidemic disease bacteria of bean.

FIG. 4 is a schematic diagram of a Taqman Real-Time PCR detection kit for detecting the epidemic disease of Phaseolus vulgaris.

FIG. 5 is a schematic diagram of a section of a Taqman Real-Time PCR detection kit for detecting the epidemic disease of bean of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the following detailed description of the embodiments of the present invention will be given with reference to the accompanying drawings. Examples of these preferred embodiments are illustrated in the accompanying drawings. The embodiments of the invention shown in the drawings and described in accordance with the drawings are merely exemplary and the invention is not limited to these embodiments.

It should be noted here that, in order to avoid obscuring the technical solution of the present invention due to unnecessary details, only the structures and/or processing steps closely related to the solution according to the present invention are shown in the drawings, while other details having little relation are omitted.

Example 1

As shown in fig. 4 and 5, a Taqman Real-Time PCR kit for detecting a phaseolus vulgaris, comprising a kit body and reagents as listed in table 3; wherein the kit body comprises: the box body 3 is hollow and contains a refrigerating fluid 8; reagent 2 is placed in the box; a box cover 1 is arranged above the box body; one side of the box body 3 is provided with a drawer 4, and DNA 5 of a sample to be detected is placed in the drawer 4. The kit is characterized in that a small-hole cavity 6 is further formed in one side of the kit, the cavity 6 is separated from a freezing liquid 8 in the kit by an elastic plastic sheet 7, the volume of the freezing liquid 8 expands when being solidified, the plastic sheet 7 bends towards one side of the cavity 6, and the expansion pressure is relieved, so that the kit is prevented from being burst.

TABLE 3 reagents contained in the kit

Further, a Taqman Real-Time PCR kit for detecting the bean corona epidemic has a PCR Forward Primer sequence as follows: 5'-GTGGGTACATCTGGAATC-3'.

Further, a Taqman Real-Time PCR kit for detecting the bean corona epidemic has a PCR Reverse Primer sequence as follows: 5'-CTGACATCCTCCGTATTG-3'.

Further, the Taqman Probe sequence in the Taqman Real-Time PCR kit for detecting the bean corona epidemic is as follows: 5'- (FAM) ATCACCGTCGCACCATACGA (TAMRA) -3'.

Further, the amplification premix used for detecting the phaseolus vulgaris Taqman Real-Time PCR kit comprises: DNA polymerase, 2 XPCR buffer (500 mM/L KCl, 100 mM/L Tris-HCl, 150mM/L MgCl) ₂ Gelatin 1 mg/ml), dNTP stock solution, RNase H.

Further, the fluorescence correction fluid used for detecting the phaseolus vulgaris Taqman Real-Time PCR kit comprises: ROX fluorescent dye.

Furthermore, the positive control in the Taqman Real-Time PCR kit for detecting the phaseolus vulgaris epidemic disease bacteria adopts DNA extracted and purified by the phaseolus vulgaris epidemic disease bacteria standard strain.

Further, a negative control used in a Taqman Real-Time PCR kit for detecting the vigna unguiculata is prepared by extracting and purifying DNA from healthy soybean seeds.

Further, the Taqman Real-Time PCR kit for detecting the phaseolus vulgaris epidemic disease bacteria is preserved at the temperature of minus 20 ℃ and is preserved in a closed manner, so that pollution is prevented.

Example 2

The embodiment provides a Taqman Real-Time PCR detection method for detecting a bean epidemic disease bacterium, which comprises the following operation steps:

1. diluting the probe and the primer;

2. preparing a PCR reaction solution;

3. performing Real-time PCR reaction;

4. analyzing experimental results;

preferably, a Taqman Real-Time PCR detection method for detecting the bean corona epidemic is provided, wherein the probe and primer dilution in the step 1 comprises the following steps: the probe and primer were centrifuged for 5min before uncapping, and then RNase-free ddH was used according to nmol number ₂ O is formulated intoThe concentration was X. Mu.M Oligo solution. Adding RNase-free ddH into an Oligo solution with concentration of X mu M ₂ O volume:

v (ml) =nmol number/X

Preferably, a Taqman Real-Time PCR detection method for detecting the phaseolus vulgaris is provided, wherein the PCR reaction solution is prepared according to the method shown in the table 4 when the PCR reaction solution is prepared in the step 2:

TABLE 4 preparation method of PCR reaction solution

hold Stage Pre-denaturation

Reps:1

95 ℃ for 30 seconds

PCR Stage PCR reaction

Reps：40

95 ℃ for 5 seconds

60 ℃ for 30 seconds.

Example 3

The embodiment provides a specific method for detecting the Taqman Real-Time PCR detection of the bean corona epidemic, which comprises the following steps:

1.1 test strains

Separating the vigna unguiculata from individual samples of different plantsPseudomonas savastanoipv．phaseolicola) 3 parts of strain and bacterial wilting pathogen of kidney beansCurtobacterium flaccumfaciens pv.flaccumfaciens) The common bacterial epidemic disease of the kidney beansXanthomonas axonopodis pv.phaseoli) Bacterial leaf spot of tomatoPseudomonas syringaepv. Timato), bacterial fruit spots of watermelonAcidovorax avenaesubsp. Citrulli) Bacterial ulcer of tomatoClavibacter michiganensis subsp.michiganensis) Bacterial scab of tomatoXanthomonas campestris pv.vesicatoria) 1 strain sample each.

1.2 Nucleic acid preparation

Single colony is selected, ground by liquid nitrogen, strain DNA is extracted by adopting TIANGEN DP320 plant genome DNA extraction kit, the concentration of the extracted DNA is measured by an ultramicro nucleic acid protein instrument, and the extracted DNA is preserved at the temperature of minus 20 ℃.

1.3 Specificity test of probes

The specific detection of the real-time fluorescence PCR is carried out on the probe by taking the isolated strain DNA of individual samples of different plants of the bean sickness bacteria and other tested strain DNA as templates. The PCR reaction solution is prepared according to the instruction of the kit, and positive control, negative control and blank control are set at the same time. The reaction system is shown in Table 5 below:

TABLE 5 specificity detection reaction System for PCR

1.4 Sensitivity test of probes

Measuring the concentration of positive sample DNA by using an ultramicro nucleic acid protein instrument, and then carrying out 10-time gradient dilution on the extracted DNA, wherein the dilution is 10 tubes: 1.8. Mu.g/ml, 1.8X10 ^-1 μg/ml、1.8×10 ^-2 μg/ml、1.8×10 ^-3 μg/ml、1.8×10 ^-4 μg/ml、1.8×10 ^-5 μg/ml、1.8×10 ^-6 μg/ml、1.8×10 ^-7 μg/ml、1.8×10 ^-8 μg/ml、1.8×10 ^-9 μg/ml. Mu.l each was taken as a dieThe plate was subjected to real-time fluorescent PCR amplification with the same reaction system as 1.3. Ct is less than or equal to 36 as a positive standard threshold.

1.5 Real-time PCR reaction

Amplification was performed according to the two-step PCR amplification standard procedure: 95 ℃ for 30s;95℃for 5s,60℃for 30s,40 cycles. The Real-time PCR instrument sets the probe reporter fluorophore FAM and the quencher TAMRA. CT is less than or equal to 36 as a positive standard threshold value.

1.6 Inoculation of positive strains

The strain with positive result is obtained by Real-time PCR reaction, inoculated on healthy leguminous crops, placed in a 24 ℃ climatic incubator, and observed for disease symptoms.

2 analysis of results

2.1 specificity of probes

The probe provided by the kit is adopted to separate individual samples of different plants to obtain the strain of the vigna unguiculata and other tested strains, and the specific detection of the real-time fluorescence PCR is carried out. The results show that the probe shows specific positive amplification for 3 samples of the vigna unguiculata strain and the positive control, the fluorescence signal is obviously increased, and no fluorescence signal is detected for the target strain and the negative control and the blank control (shown in figure 1). The kit probe has very good specificity to the bean corona epidemic bacteria.

2.2 sensitivity test of probes

Measuring positive sample DNA concentration of 18 mug/ml by ultramicro nucleic acid protein instrument, carrying out real-time fluorescence PCR amplification on stock solution DNA template and 10 times of DNA template after gradient dilution simultaneously, 18 mug/ml, 1.8 mug/ml and 1.8X10 ^-1 μg/ml、1.8×10 ^-2 μg/ml、1.8×10 ^-3 μg/ml、1.8×10 ^-4 Mu g/ml have obvious amplification curve, 1.8X10 ^-5 The μg/ml CT value is greater than 36 (as shown in FIG. 2), so that the sensitivity of the mixed probe is 1.8X10 ^-4 Mu.g/ml, i.e.180 fg/. Mu.l, is far higher than the sensitivity of conventional PCR.

2.3 detection of pathogenicity of Positive Strain

Strains with positive results obtained by the Real-time PCR reaction are inoculated on healthy leguminous crops, the leguminous crops are placed in a climatic incubator at 24 ℃, the disease condition of cotyledons is observed after three days, the cotyledons shrink and deform, obvious brown spots and halos appear (as shown in figure 3), and the disease symptoms are the same as those of the epidemic disease bacteria of the phaseolus vulgaris.

In summary, the embodiment of the invention provides a Taqman Real-Time PCR kit for detecting the phaseolus vulgaris and a detection method thereof, wherein the Taqman Real-Time PCR kit uses specific amplification primers and Taqman probes, and performs qualitative analysis on the phaseolus vulgaris by Ct value on a sample to be detected by adopting Real-Time PCR technology.

The foregoing is merely exemplary of the application and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the application and are intended to be comprehended within the scope of the application.

<110> Gansu entry and exit inspection and quarantine bureau inspection and quarantine comprehensive technical center

<120> Taqman Real-Time PCR kit for detecting phaseolus vulgaris and detection method thereof

<160> 3

<210> 1

<211> 111

<212> DNA

<213> Kidney bean epidemic disease bacterium (Pseudomonas savastanoi pv. Phaseolicola)

<400> 1

gtgggtacat ctggaatc 18

<210> 2

<211> 114

<212> DNA

<400> 2

ctgacatcct ccgtattg 18

<210> 3

<211> 20

<212> DNA

<400> 3

atcaccgtcg caccatacga 20

Claims

1. Be used for detecting bean corona epidemic fungusPseudomonas savastanoi pv.phaseolicola) The Taqman Real-Time PCR detection method is characterized by adopting reagents PCR Forward Primer, PCR Reverse Primer, taqman Probe, amplification premix and RNase-free ddH ₂ O, fluorescence correction, positive and negative controls, and were performed using the following procedure: (1) probe and primer dilution; (2) preparing PCR reaction liquid; (3) performing Real-time PCR reaction; (4) analyzing experimental results;

the PCR Forward Primer sequence is as follows: 5'-GTGGGTACATCTGGAATC-3'; the PCR Reverse Primer sequence is as follows: 5'-CTGACATCCTCCGTATTG-3' the Taqman Probe sequence is: 5'- (FAM) ATCACCGTCGCACCATACGA (TAMRA) -3';

the step 1 of probe and primer dilution comprises the following steps: the probe and primer were centrifuged for 5min before uncapping, and then RNase-free ddH was used according to nmol number ₂ O is prepared into an Oligo solution with the concentration of X mu M; adding RNase-free ddH into an Oligo solution with concentration of X mu M ₂ O volume: v (ml) =nmol number/X;

the step 2 of preparing PCR reaction liquid comprises the following steps: 10. Mu.l of amplification premix, 10. Mu.M PCR Forward Primer 0.4.4. Mu.l, 10. Mu.M PCR Reverse Primer 0.4.4. Mu.l, taqman Probe 0.2. Mu.l, RNase-free ddH ₂ O6.6. Mu.l, DNA 2. Mu.l, fluorescence correction fluid 0.4. Mu.l;

the step 3 is a two-step PCR amplification standard program when Real-time PCR reaction is carried out, and specifically comprises the following steps: pre-denaturation: 95 ℃ for 30 seconds; PCR reaction at 95℃for 5 seconds, 60℃for 30 seconds, 40 cycles;

the specific method for analyzing the experimental result in the step 4 is as follows: confirming a Real-time PCR amplification curve and CT values after the reaction is finished; if the CT of the detection results of 2 parallel samples of the sample to be detected is more than or equal to 40, the CT of the positive control detection is more than or equal to 20 and less than or equal to 36, and a typical amplification curve appears, and the negative control and blank control results are normal, at the moment, the sample can be judged not to detect the phaseolus vulgaris epidemic pathogen; if CT is less than or equal to 36 in 2 parallel sample detection results of the sample to be detected, CT is less than or equal to 20 and less than or equal to 36 in positive control detection and a typical amplification curve appears, and negative control and blank control results are normal, at the moment, the sample can be judged to detect the phaseolus vulgaris epidemic pathogen; if the CT of the 2 parallel samples of the sample to be detected is 36 < 40 and a typical amplification curve appears, the CT of the positive control is 20-36 and a typical amplification curve appears, the negative control and the blank control result are normal, and then the real-time fluorescence PCR detection is reworked after the DNA template quantity is properly increased.

2. The application of the primer taking the vigna unguiculata argK gene as a template in the port quarantine of beans is characterized in that the primer sequence is shown in a sequence table SEQ ID NO: 1. SEQ ID NO:2 and SEQ ID NO:3.