CN105274022A - Lecanicillium psalliotae LpTS01 strain and application thereof in prevention and treatment of bemisia tabaci - Google Patents
Lecanicillium psalliotae LpTS01 strain and application thereof in prevention and treatment of bemisia tabaci Download PDFInfo
- Publication number
- CN105274022A CN105274022A CN201510444910.3A CN201510444910A CN105274022A CN 105274022 A CN105274022 A CN 105274022A CN 201510444910 A CN201510444910 A CN 201510444910A CN 105274022 A CN105274022 A CN 105274022A
- Authority
- CN
- China
- Prior art keywords
- bemisia tabaci
- strain
- lpts01
- bacterial strain
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The present invention belongs to the technical field of biological pesticides, and specifically discloses lecanicillium psalliotae LpTS01 strain and application thereof in prevention and treatment of bemisia tabaci. The lecanicillium psalliotae LpTS01 strain is isolated and purified from soil in Zhongchuan town Yongdeng County in Gansu Province, and is preserved in China Center for Type Culture Collection (CCTCC) on March 26, 2015, and the accession number is CCTCC No. M2015166. The lecanicillium psalliotae LpTS01 strain is highly pathogenic to B-type bemisia tabaci, sixth day after inoculation, the medial lethal concentration LC50 of B-type bemisia tabaci second instar nymphs is 0.36 * 10<6> spores / mL, and the median lethal time LT50 is 4.23 d (in a concentration of 1.0 *10<6> conidiospores / mL). The lecanicillium psalliotae LpTS01 strain as a living biological pesticide is pollution-free to environment, non-toxic to humans and animals, and suitable for organic agricultural product production.
Description
Technical field
The present invention relates to biological pesticide technical field, particularly, relate to a strain cutter spore Verticillium LpTS01 and preventing and treating the application in Bemisia tabaci.
Background technology
Bemisia tabaci
bemisiatabaci(Gennadius) the little Aleyrodes of Hemiptera Hemiptera Aleyrodidae Aleyrodidae is belonged to
bemisia, B and the Q biotype of Bemisia tabaci is global major pest, and serious harm Global Agriculture is produced, and causes serious financial consequences.In China, all there is the insect pest of generation Bemisia tabaci in 20 provinces such as Guangdong, Guangxi, Hainan, Fujian, Yunnan, Shanghai, Zhejiang, Jiangxi, Hubei, Sichuan, Shaanxi, Beijing, Taiwan, Xinjiang, Hebei, Tianjin, Shandong, Shanxi, Anhui, Guizhou.Bemisia tabaci becomes, nymph all draws food plant phloem juice with lancet thorn, and it takes food in a large number and plant can be caused weak, and taking food a large amount of honeydews secreted in process can bring out sooty mold, causes the commodity values such as photosynthesis of plant decline and fruit to reduce.More seriously, Bemisia tabaci can also propagate geminivirus infection Begomovirus (
begemovirus) virus, with tomato yellow Potato Leaf Roll Virus (PLRV) (TYLCV) to represent, cause tomato yellow leaf curl virus sick, cause tremendous economic to lose to agriculture production.
The control of Bemisia tabaci mainly contains the methods such as cultural control, physical control, chemical prevention, biological control, and chemical prevention is main method.Life-time service chemical prevention can cause insect to develop immunity to drugs problem, needs to continue to increase chemical agent usage quantity, thus cost accounting is improved constantly in the process of preventing and treating.The excessive use of chemical pesticide affects environmental safety and species diversity in addition, and the security of chemical pesticide control has become the key factor of restriction agricultural insect pests control, and carries out and utilize biological control method to prevent and treat Bemisia tabaci and become a kind of trend.Fungus insecticide has the advantages such as host range is wide, environmentally safe, pest control does not develop immunity to drugs, recently large quantity research has been carried out in the domestic and international biological control to Bemisia tabaci, research comprise utilize natural enemy insect and entomopathogen (mainly containing entomogenous fungi) to carry out preventing and treating, the exploitation of wild entomogenous fungi, biotechnology restructuring, novel dosage forms research and development etc.Multiple entomogenous fungi is had to infect Bemisia tabaci, as rose dark brown Isaria
isariafumosorosea, seat shell spore bacterium
aschersoniaaleyrodis, Verticillium lecanii
verticilliumlecaniiand beauveria bassiana
beauveriabassianadeng, and more existing related invention patent is open:
Number of patent application 201310392214.3 discloses a kind of separation and cultural method of rose dark brown Isaria bacteria strain;
Number of patent application 201410449469.3 discloses a kind of Strain of Beauveria bassiana SCWJ-2 and application thereof, and its biological prevention and control agent can be used for the control of Bemisia tabaci, Frankliniella occidentalis, green onion aphid and/or black peach aphid;
Number of patent application 201410449467.4 discloses a kind of Strain of Beauveria bassiana GZGY-1-3 and application thereof, and its biological prevention and control agent can be used for the control of Bemisia tabaci, Frankliniella occidentalis, green onion aphid and/or black peach aphid;
Number of patent application 201410255857.8 discloses a strain gradually narrow Lecanicillium lecanii (preserving number is CGMCCNo.9220) and the application in control crop nematode and aleyrodid thereof;
Number of patent application 201210449949.0 openly discloses a kind of rose dark brown rod spore trichoderma strain (preserving number CCTCCNO:M2012400) and is preventing and treating the application in Bemisia tabaci;
Number of patent application 201410317110.0 discloses a kind of gene recombination rose dark brown rod spore mould If01GM(preserving number CCTCCNO:M2014199) and prevent and treat the application of Bemisia tabaci;
Number of patent application 201310635374.6 discloses the compounded pesticides of a kind of beauveria bassiana and Buprofezin and prevents and treats the application of the insects such as the aleyrodid such as Bemisia tabaci and trialeurodes vaporariorum class, tea lesser leafhopper;
Number of patent application 201010125937.3 discloses a kind of beauveria bassiana Bb-N1 bacterial strain (preserving number is CCTCCNO:B201005) and its preparation method and application, can prevent and treat the insects such as Bemisia tabaci;
Number of patent application 200910037747.3 discloses a kind of Verticillium lecanii and abamectin compounded desinsection host and sterilant, and this compounded pesticides has good prevention effect to insects such as Trialeurodes vaporariorum Westwood, Bemisia tabaci, aphid, small cabbage moth, thrips;
Number of patent application 200810220002.6 discloses a kind of beauveria bassiana fungi and destruxins mixed insecticide, remarkable to Bemisia tabaci toxic action;
Number of patent application 200810220003.0 discloses desinsection host and the sterilant of a kind of destruxins and buprofezin compound, effectively solves the resistance problems of Bemisia tabaci parathiazine ketone;
Number of patent application 200810029163.7 discloses a kind of verticillium lecanii strain VL-N6(bacterial strain preserving number: CCTCCNO:M208086), this bacterial strain has the very strong insecticidal effect that infects to insects such as the multiple sucking pest such as aleyrodid, aphid and thrips;
Number of patent application 200710031516.2 discloses a kind of Aschersonia aleyrodis strain AA01-N8(bacterial strain preserving number: CCTCCNO:M207087) and application, it has the multiple sucking pest such as aleyrodid, aphid and very strong infects insecticidal effect;
Number of patent application 200710031511.X discloses a kind of Paecilomyces Fumosoroseus strain PF01-N10(bacterial strain preserving number CCTCCNO:M207088), it has the very strong insecticidal effect that infects to pests with chewing mouthparts such as the multiple sucking pest such as aleyrodid, aphid and small cabbage moths;
Number of patent application 200710187638.0 1 strain high efficient strain Verticillium lecanii CA190404(preserving number CGMCCNO:1126) and preparation, can be used for control greenhouse sucking pest-aleyrodid (Bemisia tabaci and trialeurodes vaporariorum), aphid and thrips;
Number of patent application 200610132314.2 discloses the compounded pesticides of a kind of destruxins and Avrmectin, has good prevention effect to Bemisia tabaci, and has remarkable synergism;
Number of patent application 200810089529.X discloses a kind of Macrophomina beauveria bassiana HFW-05 bacterial strain (preserving number CGMCCNO:2356), has very high virulence effect to insects such as Bemisia tabaci, small cabbage moth and aphids.
But, up to now, not yet find that cutter spore Verticillium is for preventing and treating the report of Bemisia tabaci.
Summary of the invention
The technical problem to be solved in the present invention provides material for developing new fungus insecticide, provides a plant height virulence and stable cutter spore lecanii strain.
Another object of the present invention is to provide described cutter spore lecanii strain and is preventing and treating the application in Bemisia tabaci.
To achieve these goals, the present invention is achieved by following scheme:
One strain cutter spore Verticillium (Lecanicilliumpsalliotae) bacterial strain LpTS01, described bacterial strain is preserved in China typical culture collection center (CCTCC) on March 26th, 2015, deposit number is CCTCCNo.M2015166, preservation address: Wuhan University of Wuhan City of Hubei China province.
LpTS01 bacterial strain is that separation and purification obtains from the soil in Zhong Chuan town, Yongdeng County, Gansu Province, and this bacterial strain cultivates 14d on czapek's solution, bacterium colony subcircular, diameter 45 ± 1mm; Bacterium colony front white, circle centre position mycelia consolidation, radial to connecting edge diffusion in wheel, colony edge mycelia is loosened, neatly; The bacterium colony back side takes on a red color, and begins to shoal gradually from inside to outside from the center of circle, and the radial mycelia of wheel also obviously can be found out in edge.Examine under a microscope, mycelial growth initial stage white, flocculence, aerial hyphae is flourishing.Mycelia has interval, has branch, and branch is tapered to top, raw conidium on top.Conidium Dan Sheng, easily comes off, circular, oval, oval or short fusiformis, colourless or micro-band color and luster.Conidiophore base portion expands, and upwards becomes taper, Dan Sheng, is born in aerial hyphae to raw or wheel, and colyliform grows 3 ~ 4 bottles stalks at same position, and colyliform bottle stalk in aerial hyphae top can reach 4 ~ 6.Conidium Dan Sheng, oval or avette, long 1.46 ± 0.14 μm, wide 0.97 ± 0.10 μm.
The ITS1-5.8S-ITS4rDNA sequence of LpTS01 bacterial strain is as shown in SEQIDNO:1, by known array comparison in this sequence and ncbi database, phylogenetic tree construction, result shows, LpTS01 bacterial strain and a strain cutter spore Verticillium (number of logining is AB160994) belong to one together, and supporting rate reaches 97%.
By above-mentioned biological character and Physiology and biochemistry and Molecular Identification known, LpTS01 strain classification status belongs to Mycophyta (Eumycota), mitosporic fungi class (Mitosporicfungi), hyphomycetes (Hyphomycetes), hyphomycetales (Hyphomycetales), Si Bao section (Hyphomycetaceae), Verticillium
(Verticillium).
Invention also provides described cutter spore lecanii strain to the control and application of Bemisia tabaci.
In laboratory conditions, cutter spore Verticillium conidial suspension arranges 1.1 × 10
6individual/mL, 3.3 × 10
6individual/mL, 10 × 10
6individual/mL, 30 × 10
6individual/mL, 90 × 10
6individual/mL5 concentration, adopt pickling process process by Japan's blade of Bemisia tabaci Nymph infringement in 2 ages, after medicine, 2d, 4d, 6d, 8d, 10d investigate mortality ratio.Result shows, the Bemisia tabaci 2 age nymph virulence of cutter spore Verticillium conidium to Japan of causing harm is very high, 30 × 10
6during conidium/mL concentration, after medicine, 2d, 4d, 6d, 8d, 10d cumulative correction mortality ratio reaches 14.84%, 50.66%, 74.37%, 85.07%, 87.75% respectively; 90 × 10
6during conidium/mL concentration, after medicine, 2d, 4d, 6d, 8d, 10d cumulative correction mortality ratio reaches 18.28%, 56.54%, 79.17%, 88.41%, 91.29% respectively.
With SPSS7.0 software, regression analysis is carried out to cumulative correction mortality ratio, death time and Bemisia tabaci cumulative mortality, process latter 6 days toxic limit medium dose (LC
50) be 0.36 × 10
6conidium/mL; Conidium concentration 10 × 10
6individual/mL time, median lethal time (LT
50) be 4.23d, spore concentration 9.0 × 10
7individual/mL time, LT
50be worth minimum, be only 3.61d.
The present invention is and tool setting spore Verticillium is infected Bemisia tabaci and observes, cutter spore Verticillium conidial suspension floods 2-3d after Japan's blade, under fluorescence inverted microscope, can be observed white hypha and infect Bemisia tabaci 2 nymph in age, nymph color becomes withered and yellow, shrivelled death; 5d(infects mid-term), a large amount of white hypha invasion Bemisia tabaci Nymph, the shrivelled death of a large amount of 2-3 nymph in age polypide; Also find that tobacco powder nit infects by mycelia and besieged, until blade withered (12d), have no its hatching is larva always, illustrate that its mycelia can suppress Bemisia tabaci egg hatch, but whether uncertain its has direct toxic action to Bemisia tabaci worm's ovum.
Compared with prior art, the present invention has following beneficial effect:
The cutter spore Verticillium that a strain virulence that the present invention is newly developed is high and stable, this bacterial strain is a kind of insect pathogenic fungus, as a kind of living organisms agricultural chemicals, has environmentally safe, to the avirulent feature of people and animals, is applicable to organic farm products Production requirement.
Accompanying drawing explanation
Fig. 1 is the colonial morphology that bacterial strain is cultivated 14 days on czapek's solution.
Fig. 2 is bacterial strain conidial fructification and conidium.
Fig. 3 is that bacterial strain infects Bemisia tabaci morphological specificity; A cutter spore Verticillium infects Bemisia tabaci Nymph and worm's ovum figure (59X); B cutter spore Verticillium infects Bemisia tabaci worm's ovum figure (150X).
Fig. 4 is the ITS1-5.8S-ITS4rDNA gene-specific amplification electrophorogram of bacterial strain; M:DNAMarkerDL2000; 1,2LpTS01 is about 560bp.
Fig. 5 is that tree grows in the rDNA-ITS region branch of bacterial strain.
Embodiment
The present invention is elaborated further below in conjunction with Figure of description and specific embodiment.Following embodiment is the present invention's preferably embodiment, the present invention mainly sets forth the invention thought of described bacterial strain, embodiment is not related one by one in an embodiment, but therefore do not limit the present invention, change, the modification done under other any does not deviate from spirit of the present invention and principle, substitute, combine, simplify, the substitute mode of equivalence should be regarded as, be included in the present invention.
embodiment 1the separation of cutter spore Verticillium LpTS01 bacterial strain, screening
Gather the soil in Zhong Chuan town, Yongdeng County, Gansu Province, pedotheque sieves and removes stone grain and foreign material, gets pure land 10g and is suspended in the tween 80 solution of 90mL0.05%, shake up, and leaves standstill 15min, gets its supernatant liquor 2mL and be diluted in 8mL0.05% tween 80.
Select to cultivate: by above-mentioned for 0.1mL inoculation of suspension liquid on Selective agar medium planar surface, with triangle glass rod uniform application.At 25 DEG C, constant temperature culture 3 ~ 6d, then uses transfering loop picking mycelia on single bacterium colony, is inoculated on PDA flat board and continues to cultivate, be stored in 4 DEG C of refrigerators for subsequent use after purifying.
Through aforesaid operations, from soil, filter out a strain has pathogenic effects fungi to Bemisia tabaci, numbering LpTS01.
embodiment 2the qualification of bacterial strain LpTS01
The bacterial strain LpTS01 that embodiment 1 is screened cultivates 14d, bacterium colony subcircular, diameter 45 ± 1mm on czapek's solution; Bacterium colony front white, circle centre position mycelia consolidation, radial to connecting edge diffusion in wheel, colony edge mycelia is loosened, neatly; The bacterium colony back side takes on a red color, and begin from the center of circle to shoal gradually from inside to outside, the radial mycelia of wheel (see accompanying drawing 1) also obviously can be found out in edge.Examine under a microscope, mycelial growth initial stage white, flocculence, aerial hyphae is flourishing.Mycelia has interval, has branch, and branch is tapered to top, raw conidium on top.Conidium Dan Sheng, easily comes off, circular, oval, oval or short fusiformis, colourless or micro-band color and luster.Conidiophore base portion expands, and upwards becomes taper, Dan Sheng, is born in aerial hyphae to raw or wheel, and colyliform grows 3 ~ 4 bottles stalks at same position, and colyliform bottle stalk in aerial hyphae top can reach 4 ~ 6.Conidium Dan Sheng, oval or avette, long 1.46 ± 0.14 μm, wide 0.97 ± 0.10 μm (see accompanying drawing 2).
The molecular biology identification of bacterial strain: adopt ITS1 and ITS4 Auele Specific Primer, the ITS1-5.8S-ITS4rDNA gene fragment of amplification bacterial strain LpTS01, the electrophoresis result of PCR primer is shown in Fig. 4, the ITS1-5.8S-ITS4rDNA gene fragment that Fig. 4 shows bacterial strain LpTS01 is about 560bp, after order-checking, determine that its sequence is as shown in SEQIDNO:1,568bp.Input this section of sequence at GenBank after order-checking, the DNA sequence dna computer result that is ranked shows, a strain cutter spore Verticillium (
lecanicilliumpsalliotae) (number of logining is AB160994) highly similar.Be outer group by this bacterial strain and other close 11 kinds of bacterial strains, build its phylogenetic evolution tree.Result shows, aimed strain and a strain cutter spore Verticillium (
lecanicilliumpsalliotae) (number of logining is AB160994) belong to one together, supporting rate reaches 97%(and sees accompanying drawing 5).Therefore, ITS1-5.8S-ITS4rDNA region branch grow tree be accredited as cutter spore Verticillium (
lecanicilliumpsalliotae).
From above qualification result: the classification position of cutter spore Verticillium LpTS01 belongs to Mycophyta (Eumycota), mitosporic fungi class (Mitosporicfungi), hyphomycetes (Hyphomycetes), hyphomycetales (Hyphomycetales), Si Bao section (Hyphomycetaceae), Verticillium
(Verticillium).
This bacterial strain is preserved in China typical culture collection center (CCTCC) on March 26th, 2015, and deposit number is CCTCCNo.M2015166, preservation address: Wuhan University of Wuhan City of Hubei China province.
embodiment 3
Conidium produces: the cutter spore Verticillium LpTS01 bacterial strain slant strains of depositing of going bail for, scrape the conidium that takes a morsel and be placed in sterilized centrifuge tube, instill sterilized 0.02% tween-80 solution, vibration shakes up, again spore suspension is seeded on PDA flat board, with paint daubs by spore uniform application on flat board, cultivate about 14d in 25 DEG C of incubators, scraping top layer conidium is for subsequent use.
Conidium suspension preparation: accessed in the tween-80 solution of 0.02% of sterilizing by the conidium of scraping, measure spore concentration with blood counting chamber, is mixed with the conidial suspension of required different concns, for subsequent use.
Several entomogenous fungi is compared Bemisia tabaci virulence: apply above-mentioned conidium, is AuTS01, AuTS02, LpTS01 bacterial strain and is mixed with 1.0 × 10 respectively from the BbTS03 bacterial strain of Jiuquan, Gansu Province soil by the soil code name from Zhong Chuan town, Yongdeng County, Gansu Province
8individual spore/mL, under experiment indoor conditions, is inoculated in the Type B Bemisia tabaci Nymph on potted plant Japan seedling, investigates the mortality ratio of Bemisia tabaci after process respectively at 2d, 3d, 4d, 6d, 8d, 10d by spore suspension.
Dead borer population/process front borer population × 100% is accumulated during cumulative mortality (%)=investigation
Corrected mortality (%)=(process mortality ratio-contrast mortality ratio)/(1-contrasts mortality ratio) × 100%
Different strains to the cumulative correction mortality ratio of Bemisia tabaci as table 1.The cumulative mortality of result display LpTS01 bacterial strain to Bemisia tabaci is the highest, and 6d, 8d, 10d after process, Bemisia tabaci Nymph cumulative mortality is respectively 80.52%, 88.98% and 91.49%, demonstrates the virulence very strong to Bemisia tabaci.
Table 1.5 kind of bacterial strain to 2 age Bemisia tabaci Nymph cumulative mortality
Note: in table, data are mean number ± standard deviation, with after column data not same letter represent at P < 0.05 level difference significantly (DuncanShi duncan's new multiple range method)
embodiment 4 cutter spore Verticillium is to the toxicity test of Bemisia tabaci
The conidium produced in application above-described embodiment 3, under experiment indoor conditions, is inoculated in the Type B Bemisia tabaci Nymph on potted plant Japan seedling, investigates the mortality ratio of Bemisia tabaci after process respectively at 2d, 4d, 6d, 8d, 10d by different concns spore suspension.
Dead borer population/process front borer population × 100% is accumulated during cumulative mortality (%)=investigation
Corrected mortality (%)=(process mortality ratio-contrast mortality ratio)/(1-contrasts mortality ratio) × 100%
Lethality rate, the median lethal concentration(LC&-{50}) (LC of each bacterial strain is calculated with SPSS software analysis
50) and median lethal time (LT
50).
Result shows, this bacterial strain is fine to the effect of Bemisia tabaci Nymph, process latter 6 days to 2 age Bemisia tabaci Nymph toxic limit medium dose (LC
50) be 0.36 × 10
6conidium/mL.Refer to table 2, table 3 and table 4.
Table 2 cutter spore Verticillium LpTS01 bacterial strain is to Bemisia tabaci 2 nymph in age accumulated correction mortality ratio
Note: in table, data are mean number ± standard deviation, with after column data not same letter represent that at P < 0.05 level difference significantly (DuncanShi duncan's new multiple range method) unit of spore concentration is × 10
6individual/mL.
Table 3 cutter spore Verticillium LpTS01 bacterial strain is to the LC of Bemisia tabaci
50regression equation and LC
50value
Table 4 cutter spore Verticillium LpTS01 bacterial strain is to Bemisia tabaci LT
50regression equation and LT
50value
Note: in table 4, the unit of concentration is × 10
6individual/mL.
The present invention is and tool setting spore Verticillium is infected Bemisia tabaci and carried out observing (accompanying drawing 3).Cutter spore Verticillium conidial suspension floods 2-3d after Japan's blade, under fluorescence inverted microscope, can be observed white hypha and infects Bemisia tabaci 2 nymph in age, and nymph color becomes withered and yellow, shrivelled death; 5d(infects mid-term), a large amount of white hypha invasion Bemisia tabaci Nymph, the shrivelled death of a large amount of 2-3 nymph in age polypide; Also find that tobacco powder nit infects by mycelia and besieged, until blade withered (12d), have no its hatching is larva always, illustrate that its mycelia can suppress Bemisia tabaci egg hatch, but whether uncertain its has direct toxic action to Bemisia tabaci worm's ovum.
SEQUENCELISTING
<110> Agricultural University Of South China
<120> mono-strain cutter spore Verticillium LpTS01 and preventing and treating the application in Bemisia tabaci
<130>
<160>1
<170>PatentInversion3.3
<210>1
<211>568
<212>DNA
<213>ITS1-5.8S-ITS4rDNA sequence
<400>1
gggggaaggggctcactcccaacccttatgtgaacataccataatgttgcttcggcggac60
tcgccccggcgtccggacggcctagcgccgcccgcggcccggacccaggcggccgccgga120
gaccaccaaaactattttgtatcagcagttttttctgaatccgccgcaaggcaaaacaaa180
tgaatcaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaa240
atgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacatt300
gcgcccgccagcattctggcgggcatgcctgttcgagcgtcatttcaaccctcgacttcc360
ctttggggaaatcggcgttggggactggcagcataccgccggccccgaaatggagtggcg420
gcccgtccgcggcgacctctgcgtagtaatccaacctcgcaccggaaccccgacgtggcc480
acgccgtaaaacaccccactttctgaacgttgacctcggatcaggtaggaatacccgctg540
aacttaagcatatcaaaagccggaggaa568
Claims (4)
1. strain cutter spore Verticillium (Lecanicilliumpsalliotae) bacterial strain LpTS01, it is characterized in that, described bacterial strain is preserved in China typical culture collection center (CCTCC) on March 26th, 2015, and deposit number is CCTCCNo.M2015066.
2. cutter spore Verticillium described in claim 1 (
lecanicilliumpsalliotae) bacterial strain LpTS01 preventing and treating the application in Bemisia tabaci.
3. application according to claim 2, is characterized in that, described Bemisia tabaci of preventing and treating is the conidium of gathering in the crops cutter spore Verticillium, becomes concentration to be 10 with 0.02% tween-80 solution preparation
7the suspension of conidium/mL, adopts foliar spray method that suspension is applied to field in Bemisia tabaci Nymph occurrence in peak period.
4. cutter spore Verticillium described in claim 1 (
lecanicilliumpsalliotae) mycelia of bacterial strain LpTS01 suppressing the application in Bemisia tabaci egg hatch.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510444910.3A CN105274022B (en) | 2015-07-27 | 2015-07-27 | One plant of knife spore Verticillium dahliae LpTS01 and its application in Bemisia tabaci is prevented |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510444910.3A CN105274022B (en) | 2015-07-27 | 2015-07-27 | One plant of knife spore Verticillium dahliae LpTS01 and its application in Bemisia tabaci is prevented |
Publications (2)
Publication Number | Publication Date |
---|---|
CN105274022A true CN105274022A (en) | 2016-01-27 |
CN105274022B CN105274022B (en) | 2018-06-19 |
Family
ID=55143862
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510444910.3A Active CN105274022B (en) | 2015-07-27 | 2015-07-27 | One plant of knife spore Verticillium dahliae LpTS01 and its application in Bemisia tabaci is prevented |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105274022B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114097828A (en) * | 2021-11-23 | 2022-03-01 | 安徽农业大学 | Lecanicillium lecanii oil agent and preparation method and application thereof |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101440349A (en) * | 2007-11-20 | 2009-05-27 | 中国农业科学院植物保护研究所 | Effective bacterial strain for preventing and controlling greenhouse sucking pest and preparation thereof |
CN101513192A (en) * | 2009-03-10 | 2009-08-26 | 华南农业大学 | Compound desinsection primary agent and pesticide consisting of verticillium lecanii and abamectin |
CN103243030A (en) * | 2013-05-09 | 2013-08-14 | 浙江省柑桔研究所 | Lecanicilliumpsalliotae strain used for preventing and treating diaphorina citri |
CN104195050A (en) * | 2014-06-11 | 2014-12-10 | 张艳军 | Lecanicillium attenuatum and application of lecanicillium attenuatum to control of crop nematodes and bemisia tabaci |
-
2015
- 2015-07-27 CN CN201510444910.3A patent/CN105274022B/en active Active
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101440349A (en) * | 2007-11-20 | 2009-05-27 | 中国农业科学院植物保护研究所 | Effective bacterial strain for preventing and controlling greenhouse sucking pest and preparation thereof |
CN101513192A (en) * | 2009-03-10 | 2009-08-26 | 华南农业大学 | Compound desinsection primary agent and pesticide consisting of verticillium lecanii and abamectin |
CN103243030A (en) * | 2013-05-09 | 2013-08-14 | 浙江省柑桔研究所 | Lecanicilliumpsalliotae strain used for preventing and treating diaphorina citri |
CN104195050A (en) * | 2014-06-11 | 2014-12-10 | 张艳军 | Lecanicillium attenuatum and application of lecanicillium attenuatum to control of crop nematodes and bemisia tabaci |
Non-Patent Citations (2)
Title |
---|
TINGYAN DONG ET AL.: "ISOLATION AND CLASSIFICATION OF FUNGAL WHITEFLY ENTOMOPATHOGENS FROM SOILS OF QINGHAI-TIBET PLATEAU AND GANSU CORRIDOR IN CHINA", 《PLOS ONE》 * |
邱君志 等: "金属离子对蜡蚧菌几丁质酶活力的影响", 《激光生物学报》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114097828A (en) * | 2021-11-23 | 2022-03-01 | 安徽农业大学 | Lecanicillium lecanii oil agent and preparation method and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN105274022B (en) | 2018-06-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102776130B (en) | Metarhizium anisopliae and application thereof | |
CN109777743B (en) | Entomogenous fungus strain SB009 with high pathogenic capability to bemisia tabaci and application thereof | |
CN111961598B (en) | Isaria javanicus strain and application thereof in aspect of preventing and treating phyllotreta striolata | |
CN107418899B (en) | Beauveria bassiana BbL25 strain for preventing and treating red imported fire ants and application thereof | |
CN103160442A (en) | Paecilomyceslilacinus strain having strong pathogenicity for diaphorina citri | |
CN105274008B (en) | One plant of Paecilomyces lilacinus PlTS01 and its application in preventing Bemisia tabaci | |
CN102021122B (en) | High-efficiency insecticidal fungus and applications thereof | |
CN113684136B (en) | Broad-spectrum insecticidal beauveria bassiana strain and application thereof | |
CN108102929A (en) | A kind of Java Isaria of anti-pymetrozine and its application | |
Ying et al. | Evaluation of the biocontrol potential of Aspergillus welwitschiae against the root-knot nematode Meloidogyne graminicola in rice (Oryza sativa L.) | |
El Kichaoui et al. | Development of Beauveria bassiana-Based Bio-Fungicide Against Fusarium Wilt Pathogens for Capsicum Annuum, a Promising Approach Toward Vital Biocontrol Industry in Gaza Strip. | |
CN103109870B (en) | Application of fermentation supernatant liquid of pseudomonas | |
El-Hindi | Safe approach to the Biological Control of the Tomato Leafminer Tuta absoluta by entomopathogenic fungi Beauveria bassiana isolates from Gaza Strip | |
Mseddi et al. | Selection and characterization of thermotolerant Beauveria bassiana isolates and with insecticidal activity against the cotton‐melon aphid Aphis gossypii (G lover)(H emiptera: A phididae) | |
CN103122314B (en) | Isaria fumosoroseus and application thereof for preventing and treating bemisia tabaci | |
CN105670938B (en) | It is a kind of kill holotrichia oblita beauveria bassiana and its application | |
CN114317293A (en) | Spaceflight entomogenous fungus strain SCAUHT18 with high pathogenicity and high ultraviolet resistance to common thrips and application thereof | |
CN103627641B (en) | Screening and identifying method and application of jinhua strain capable of degrading cypermethrin | |
CN105274007B (en) | One plant of Metarhizium anisopliae var. Anisopliae MaTS02 and its application in terms of preventing and treating Bemisia tabaci | |
CN101597574A (en) | One Paecilomyces cateniannulatus strain with high yield of spores and screening thereof and application method | |
CN108998395B (en) | Bacillus amyloliquefaciens and application thereof | |
CN106479904A (en) | One plant of flat sand green muscardine fungus and its application | |
CN110679611A (en) | Application of fusarium proliferatum in prevention and control of invasive plant xanthium sibiricum | |
CN105274022B (en) | One plant of knife spore Verticillium dahliae LpTS01 and its application in Bemisia tabaci is prevented | |
CN1439270A (en) | Preparing method for lilacinin against nematoda eggs |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |