CN102021122B - High-efficiency insecticidal fungus and applications thereof - Google Patents
High-efficiency insecticidal fungus and applications thereof Download PDFInfo
- Publication number
- CN102021122B CN102021122B CN2010105383280A CN201010538328A CN102021122B CN 102021122 B CN102021122 B CN 102021122B CN 2010105383280 A CN2010105383280 A CN 2010105383280A CN 201010538328 A CN201010538328 A CN 201010538328A CN 102021122 B CN102021122 B CN 102021122B
- Authority
- CN
- China
- Prior art keywords
- bacterial strain
- mbjqh2
- spore
- powder
- muscardine fungus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention relates to the field of biological control, in particular to a high-efficiency insecticidal fungus and applications thereof. The invention provides a high-efficiency insecticidal fungus metarhizium strain MBJQH 2-2 which effectively prevents and control scaraboid underground pests, is friendly and compatible with the environment and has a preservation number of CGMCC (China General Microorganism Conservation Center) No. 4275. The metarhizium strain of the invention is rooted in the nature, returns to the nature, is friendly and compatible with the environment, pollution-free and residue-free, has unique high-efficiency control action on the scaraboid underground pests, can be used as a pollution-free novel pesticide and used in an innoxious production process of underground pests, such as crops, fruit trees, forest, lawn, and the like. Proved by field prevention and control tests, the invention has favorable prevention effect and reaches the prevention effect on a plurality of important scaraboid larvae up to 60-70 percent.
Description
Technical field
The present invention relates to the biological control field, relate to a kind of efficient insecticide fungi and uses thereof particularly.
Background technology
Plant such as agricultural, forestry, gardening and herbage, lawn are attacked by disease and pest often, wherein the chafer class pest cause harm very seriously, and lack the method for administering efficiently.China's chafer kind is many, and 1500 kinds, it is wide to distribute, and it is mainly caused harm in larval stage since the whole personal history phase of larva entirely in soil, disguised strong, appetite is huge, gnaws roots of plants, rhizome or root system, causes the infringement of the serious underproduction or plant.The general time is caused the crop loss of 10-30%, and the regional heavy losses that have are to 50-80%, even total crop failure.To adopt chemical pesticide control, its resistance is obviously increased for a long time, general agricultural chemicals is difficult to reach effective improvement; Sometimes the riskiest pesticide of having to use; Cause residual and environmental pollution, become and hinder the obstacle that the export of farm produce is earned foreign exchange, also direct threats the people's healthy living.In recent years China strengthens pesticide residue and environmental pollution improvement, and to ensure agricultural product security and environmental ecology balance, the high toxicity agricultural chemicals of original use is disabled or limit the use of, and does not still have effective higher effective and lower toxic pesticide.The Along with people's growth in the living standard increases with the non-polluted farm product increasing demand organic, and non-harmful plant protection technologies such as development and applying biological agricultural chemicals become the production urgent problem.
Compare with chemical pesticide, biological pesticide has unique advantage in the control of phytopathy insect, like the wholesomeness to the different target insect; The field long-lasting; Insect is difficult for developing immunity to drugs, to natural enemy, person poultry safety's property and with environment compatibility etc., thereby can be in effective control disease and pest; Safeguard ecologic food chain and environmental balance, become research and development focus in recent years.
Utilization has the natural biological resource of control action kou to insect, is the important channel that addresses the above problem.Green muscardine fungus is one type of insect pathogenic fungus as biological pesticide the most potential, and report has 200 various insects Ceng Jing to be infected by green muscardine fungus in the summary of Li Zengzhi etc.Green muscardine fungus since can be under the natural soils environment long-term surviving, can control subterranean pest-insect effectively and break out and cause harm.Green muscardine fungus is as the biological pesticide resource, and its advantage is to come from the physical environment biology, and specific disease pest and weed is had the special efficacy control action kou; High to non-target biological safety; Pollution-free noresidue, compatible with environmental friendliness, be applicable to the nuisanceless production process of farm crop; Add that industrial fermentation technology capable of using carries out the mass-producing propagation production, has the market development potential.
Green muscardine fungus is having unique potentiality and clear superiority based on to the body wall contact infection mechanism of insect with in the medium-term and long-term characteristic of surviving of field soil aspect the control subterranean pest-insect especially cockchafer class pest.But different strains has strong specificity to the virulence of different pest species.Subterranean pest-insect is of a great variety, the personal history phase is long and resistance is strong, and edatope is complicated in addition, really had the bacterial strain of control application potential must pass through artificial screening and improved strain.
Summary of the invention
In order to address the above problem, contriver of the present invention proposes and has accomplished the present invention.
The purpose of this invention is to provide and a kind ofly can effectively prevent and treat cockchafer class subterranean pest-insect, the efficient insecticide fungi green muscardine fungus bacterial strain MBJQH2-2 compatible with environmental friendliness.
A purpose more of the present invention provides the cultural method of above-mentioned green muscardine fungus bacterial strain MBJQH2-2.
A purpose more of the present invention provides the application of above-mentioned green muscardine fungus bacterial strain MBJQH2-2.
A purpose more of the present invention provides the biotic pesticide of a kind of cockchafer subclass subterranean pest-insect.
Contriver of the present invention respectively from Hebei, the farmland on ground such as Shandong, Jiangsu, Beijing, Guizhou or the grub corpse that the forest land collects soil and green stiff fungus infection illness; In the laboratory, carry out mikrobe separation, purifying; The green muscardine fungus bacterial classification of preserving purifying obtains 12 bacterial strains altogether in PDAY test tube substratum.The bacterial classification inoculation of purifying on the PDAY plate culture medium, was cultivated 10-12 days in 25 ± 1 ℃ of incubators, collected conidial powder, carry out biological assay, obtain 3 bacterial strains with higher toxicity action according to the final mortality ratio screening of grub.With these 3 bacterial strains inoculate the grub polypide repeatedly and from the sick worm again separation and purification and biology measure and select, obtain serial rejuvenation bacterial strain.Successively environment collects different types of grub from different fields; Be respectively peanut field Holotrichia parallela, black greatly gill cockchafer and anomala corpulenta, 2 kinds of lawn cockchafers, 1 planting fruit-trees cockchafer; 1 kind of plateau shrub cockchafer; Carry out biological assay with above-mentioned same procedure, compare rejuvenation bacterial strain and the initially insecticidal activity of bacterial strain, finishing screen is selected efficient bacterial strain Metarhizium anisopliae MBJQH2-2.This green muscardine fungus bacterial strain MBJQH2-2 (Metarhizium anisopliae) is stored in Chinese common micro-organisms DSMZ (preservation centre address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica on October 27th, 2010; Postcode: 100101), its deposit number is: CGMCC No.4275.
The nucleotide sequence in the ITS1-5.8S-ITS2rDNA zone of said bacterial strain is shown in SEQ ID No.1:
CCGAGTTAAGGGAAACCGACTTCCACTCCCACCCCTGTGATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCGCCCGCCGGGGACCCAAACCTTCTGAATTTTTTAATAAGTATCTTCTGAGTGGTTAAAAAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACGCCCCTCAAGTCCCCTGCGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTTCCAGCACAGCCGTCCCTTAAATTAATTGGCGGTCTCGCCGTGGCCCTCCTCTGCGCAGTAGTAAAGCACTCGCAACAGGAGCCCGGCGCGGTCCACTGCCGTAAAACCCCCCAACTTTTTATA
For this bacterial strain is used for pest control, the present invention also provides a large amount of cultural methods of above-mentioned green muscardine fungus MBJQH2-2 bacterial strain, and its step comprises:
1) liquid seeds is cultivated: the obtaining liq substratum wherein contains sucrose 3%, yeast extract powder 1%.To the shaking in the bottle of substratum is housed, inoculum size is 2-3 * 10 with the bacterial classification spore inoculating
5Spore/mL cultivates 48h on 25 ± 1 ℃, 200rpm shaking table.
2) liquid amplification culture: the obtaining liq substratum wherein contains sucrose 2%, Semen Maydis powder 1%, yeast 1%, potassium hydrogenphosphate 0.1%, sal epsom 0.05%, copper sulfate 0.001%.In liquid seeds inoculation fermentation jar, inoculum size is 2-5% by volume, and 25 ± 1 ℃ of controlled temperature, rotating speed 50-280rpm begin ventilation, air flow 0.7～1, fermentation culture 48-60h behind the 16h.
3) solid fermentation is cultivated: the preparation solid medium, wherein contain husk or broken wheat straw 35-55%, and wheat bran or cavings 40-50, polished rice powder 5-25%, each component sum is 100%.Used container can be sieve basket, ventilative sack or Cans etc.Liquid culture is inoculated in the solid medium of sterilization; Inoculum size is volume: weight ratio 0.8-1, and base-material suitable depth 5-8cm cultivated 10-14 days in 25 ± 1 ℃ of culturing room; Dry back promptly obtains leavened prod with sieve method or the whirlwind method separated and collected spore powder of shaking.
The present invention also provides the application of above-mentioned green muscardine fungus MBJQH2-2 bacterial strain, and green muscardine fungus MBJQH2-2 spore of the present invention can be processed the form throwing of pulvis, granule and spread the insect pest generating area.Preferably, before use above-mentioned green muscardine fungus MBJQH2-2 spore powder is diluted dispersion with earth or industrial inorganic fillings such as zeyssatite, kaolin etc., process the pulvis of the every gram of spore content 10-20 hundred million spores, throw then and spread the zone that subterranean pest-insect is taken place.Perhaps, before use with spore powder according to the wettable powder working method, process the wettable powder of the every gram of spore content 20-100 hundred million spores, convert to spray or water behind the water and drench the zone that subterranean pest-insect is taken place.Perhaps,, process the granule of the every gram of spore content 2-10 hundred million spores, throw then and spread the zone that subterranean pest-insect is taken place before use with the working method of spore powder according to granule.Wherein, all can use green muscardine fungus MBJQH2-2 bacterial strain preparation of the present invention at seeding time with during the plant growth,, all possibly work the mischief in the crop growth period from the early spring to the late autumn because cockchafer class subterranean pest-insect life stage is long.Therefore, according to the biotic pesticide of cockchafer subclass subterranean pest-insect of the present invention, it comprises the spore powder of above-mentioned green muscardine fungus bacterial strain MBJQH2-2.
Green muscardine fungus is one type of insect pathogenic fungus, through being attached to insect cuticle, producing germ tube and penetrate the polypide epidermis and invade, consumes polypide nutrition, and self breeds fast, produces toxin, causes the death of polypide tissue injury and pathology.High humidity is beneficial to the sprouting and the intrusion of muscardine spore, holds dusk and rain and can improve control effect with bacterium preceding opportunity.Green muscardine fungus has long survival ability in soil simultaneously, can before plant is obviously endangered the phase, use, and uses back several months and next year can keep certain preventive effect.
Green muscardine fungus bacterial strain of the present invention comes from nature and belongs to nature,, pollution-free noresidue compatible with environmental friendliness; Cockchafer class subterranean pest-insect there is unique efficient control action kou; Can be used as nuisanceless novel agrochemical, be used for the innoxious production process of subterranean pest-insects such as farm crop, fruit tree, forest, lawn.Have good control effect through the field controling test proof, several kinds of important kind cockchafer larva preventive effects are reached 60-70%.
Description of drawings
Fig. 1 is the conidium form of M.anisopliae MBJQH2-2 bacterial strain.
Fig. 2 is the electrophorogram of the genomic dna of M.anisopliae MBJQH2-2 bacterial strain.
Fig. 3 is the ITS1-5.8S-ITS2rDNA fragment of M.anisopliae MBJQH2-2 bacterial strain.
Fig. 4 is for to be infected morbific chafer larva by green muscardine fungus MBJQH2-2, a left side: healthy worm; Right: the worm of falling ill.
Green muscardine fungus bacterial strain MBJQH2-2 (Metarhizium anisopliae) is stored in Chinese common micro-organisms DSMZ (preservation centre address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica on October 27th, 2010; Postcode: 100101), its deposit number is: CGMCCNo.4275.
Embodiment
In conjunction with specific embodiment the present invention is described further.
Separation, the purifying of embodiment 1 green muscardine fungus MBJQH2-2 bacterial strain
Respectively from Hebei, the farmland on ground such as Shandong, Jiangsu, Beijing, Guizhou or the grub corpse that the forest land collects soil and green stiff fungus infection illness, carry out in the laboratory that mikrobe separates, purifying.
Separation, purification step are: the thalline on the careful picking worm corpse, be inoculated on the selective medium, and under 25 ℃ of temperature, cultivated 7 days; The resolution bacterium colony is also transferred on the new selective medium plate; Under 25 ℃ of temperature, cultivate more than 14 days, treat that bacterium colony produces spore fully after, transfer in the bacterium culture medium test tube; After cultivating 14 days under 25 ℃ of temperature, preserve in 4 ℃ of refrigerator cold-storages.
The green muscardine fungus bacterial classification of preserving purifying obtains 12 bacterial strains altogether in PDAY test tube substratum.The bacterial classification inoculation of purifying on the PDAY plate culture medium, was cultivated 10-12 days in 25 ± 1 ℃ of incubators, collected conidial powder, carry out biological assay.Measuring method is that spore powder is quantitatively joined in the soil, puddles evenly, forms every gram soil and contains 2 * 10
7The mixed bacterium soil of spore is gathered grub and is put into above-mentioned bacterium soil from the field, every bacterial strain is handled 20 grubs, and 3 repetitions in 23-26 ℃ of cultivation 20 days, obtain 3 bacterial strains with higher toxicity action according to the final mortality ratio screening of grub.These 3 bacterial strains are inoculated the grub polypide and separation and purification again from the sick worm repeatedly, obtain the rejuvenation bacterial strain.Successively environment collects different types of grub from different fields; Be respectively peanut field Holotrichia parallela, black greatly gill cockchafer and anomala corpulenta, 2 kinds of lawn cockchafers, 1 planting fruit-trees cockchafer; 1 kind of plateau shrub cockchafer; Carry out biological assay with above-mentioned same procedure, compare rejuvenation bacterial strain and the initially insecticidal activity of bacterial strain, finishing screen is selected efficient bacterial strain Metarhizium anisopliae MBJQH2-2.Green muscardine fungus bacterial strain MBJQH2-2 (Metarhizium anisopliae) is stored in Chinese common micro-organisms DSMZ (preservation centre address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica on October 27th, 2010; Postcode: 100101), its deposit number is: CGMCC No.4275.
The morphology and the biological property of embodiment 2 bacterial strains
Preparation PDAY substratum, its component and compound method are boiled 15min for fresh potato 200g is added the about 1000mL of water, with liquid stay after the filtered through gauze; Add glucose 20g, yeast extract powder 5g, agar 15g, heating is melted agar fully, quantitatively to 1000mL; Divide and install in the triangular flask; Place high pressure steam sterilizer to keep 20min for 121 ℃, pour in the petridish when cooling, process dull and stereotyped for use to about 60 ℃.
On the PDAY plate culture medium, inoculate conidium, cultivate 2d for 25 ℃, the visible bacterium colony of visual inspection; The bacterium colony mycelia fine hair shape that is white in color continues to cultivate 3-4d, and visible bacterium colony enlarges growth; The surface has green spores to produce, and color gradually becomes the dark olive green look by light green.
In the cell of matrix slide glass, drip the PDAY substratum of sterilization, the inoculation conidium is cultivated 3-4d for 25 ℃, observes visible conidiophore Dan Sheng, bottle stalk column Dan Sheng in microscopically.Conidium short cylindrical middle part is slightly narrow but not obvious, the blunt circle in two ends or slightly sharp, and big or small 5-8 * 2-3 μ m, the generation long-chain that on the bottle stalk, joining end to end, as shown in Figure 1.
The rrna ITS region nucleotide sequence characteristic of embodiment 3 bacterial strains
Preparation LM substratum, its component and compound method add water to 1000mL for taking by weighing sucrose 20g, peptone 5g, divide to be filled to triangular flask, place high pressure steam sterilizer to keep 20min for 121 ℃, cool to room temperature subsequent use.
The inoculation conidium is to above-mentioned substratum, and inoculum size is 2-3 * 10
5Spore/mL cultivates 48h on 25 ± 1 ℃, 200rpm shaking table, with staying mycelia behind the filter paper filtering, it is subsequent use to extract moisture.
Extract genomic dna with the CTAB method.Undertaken by conventional DNA extraction operation, obtain genomic dna, as shown in Figure 2.
' ' ATATGCTTAAGTTCAGCGGGT carries out pcr amplification for GTTTCCGTAGGTGAACCTGC and primer 25 with ITS1-5.8S-ITS2rDNA zone primer 15; The dna fragmentation that obtains increasing; Like Fig. 3; Fragment is carried out nucleotide sequence detect, obtain the nucleotide sequence in bacterial strain ITS1-5.8S-ITS2rDNA zone, shown in SEQ ID No.1.
The fermentation culture of embodiment 4 bacterial strains
Carry out according to the following steps:
1) liquid seeds is cultivated: the obtaining liq substratum, its component and compound method add water to 1000mL for taking by weighing sucrose 30g, yeast extract powder 10g, divide to be filled to triangular flask, place high pressure steam sterilizer to keep 20min for 121 ℃, cool to room temperature subsequent use.To the shaking in the bottle of substratum is housed, inoculum size is 3 * 10 with the bacterial classification spore inoculating
5Spore/mL cultivates 48h on 25 ± 1 ℃, 200rpm shaking table.
2) liquid amplification culture: the obtaining liq substratum, its component and compound method add water to 1000mL for to take by weighing sucrose 20g, Semen Maydis powder 10g, yeast 10g, potassium hydrogenphosphate 1g, sal epsom 0.5g, copper sulfate 0.01g in following ratio.Logical HCS to 121 ℃ maintenance 20min cools to room temperature subsequent use in fermentor tank.With 1) in the liquid seeds inoculation fermentation jar cultivated, 2% inoculation by volume, 25 ± 1 ℃ of controlled temperature, rotating speed 150-200rpm begins ventilation, air flow 0.7～1, fermentation culture 54h behind the 16h.
3) solid fermentation is cultivated: the preparation solid medium; Its component and compound method are for to take by weighing husk 350g, wheat bran 550g, polished rice powder 100 in following ratio; Mix the back branch and install in the Cans, loading amount height 6cm is with the air-permeable envelope capping; Place high pressure steam sterilizer to keep 20min for 121 ℃, cool to room temperature subsequent use.With 2) liquid culture be inoculated in the solid medium of sterilization, inoculum size is a volume: weight ratio 0.8, in 25 ± 1 ℃ of culturing room, cultivated 14 days.
4) dry back promptly obtains leavened prod with sieve method or the whirlwind method separated and collected spore powder of shaking.
Late June collects anomala corpulenta and big black gill cockchafer adult respectively from the field, at the experiment indoor feeding, treat it and lay eggs that the ovum of getting the 3-5 age in days carries out biological assay.Measuring method is mixed with 5 * 10 for spore powder that fermentation culture is obtained with 0.05% the TW80 aqueous solution
7The spore suspension of spore/mL is immersed in 20sec in the spore suspension with worm's ovum, places filter paper to inhale after the taking-up immediately and removes excessive moisture, is embedded in the sterile soil of water cut 17%.30 worm's ovums of every processing, 3 repetitions are blank with the TW80 aqueous solution.In 23-26 ℃ of room temperature hatching 12 days, relatively confirm the restraining effect of bacterial strain to worm's ovum according to the larva number of hatching.The result sees table 1, proves that bacterial strain can suppress a certain proportion of egg hatch.
Table 1 green muscardine fungus MBJQH2-2 is to the restraining effect of two kinds of chafer ovum hatchings
In August, to collect the chafer larva be 240 of grubs in the peanut field from Shandong.The spore powder that fermentation culture is obtained quantitatively joins in the soil, puddles evenly, forms every gram soil and contains 5 * 10
7, 10 * 10
7, 50 * 10
7The different concns mixed bacterium soil of spore divides to install in the small plastic box, and every box is put into 1 of grub; Add potato block and make feed, every concentration is handled 20 grubs, 3 repetitions; With the blank soil that does not add the bacterium powder is contrast; Cultivated 24 days for 23-26 ℃, inspection in per 3 days is once relatively confirmed the effect of bacterial strain according to the final mortality ratio of grub.The result sees table 2, proves that bacterial strain can efficiently infect the chafer larva, and the chafer larval mortality increases and increases along with spore concentration.Observe dead polypide and become stiff, transfer to and preserved moisture in the clean petridish 3 days, can see the polypide surface growth and go out mycelia, produce green spores afterwards, as shown in Figure 4.
Table 2 green muscardine fungus MBJQH2-2 different concns spore is to the dissemination of chafer larva
Embodiment 7 bacterial strains are to the action effect of rutelian larva
Late May collects a kind of rutelian from golf course tree, its larva lawn, court of causing harm.Adult at the experiment indoor feeding, is treated its hatching of laying eggs, raise 1 age, 2 ages and the 3 instar larvaes mensuration that makes an experiment during the phase.Measuring method quantitatively joins in the soil for the spore powder that fermentation culture is obtained, and puddles evenly, forms every gram soil and contains 66.6,33.3,16.7,8.3,4.2 * 10
7The gradient concentration mixed bacterium soil of spore divides to install in the flowerpot.1 instar larvae is handled every basin and is put into 30 of grubs, 3 repetitions; 2 ages and 3 instar larvaes are handled every basin and are put into 20 of grubs respectively, 4 repetitions.Add grass roots and make feed.With the blank soil that does not add the bacterium powder is contrast.Cultivated 24 days for 25-28 ℃, inspection in per 3 days is once relatively confirmed the effect of bacterial strain according to the final mortality ratio of grub.The result sees table 3, proves that bacterial strain can effectively infect local court rutelian larva.Observe dead polypide and become stiff, transfer to and preserved moisture in the clean petridish 3 days, can see the polypide surface growth and go out mycelia, produce green spores afterwards.
Table 3 green muscardine fungus MBJQH2-2 is to the dissemination of the different instar larvaes of golf course cockchafer
Embodiment 8 bacterial strains are to the action effect of the sub-larva of Holotrichia parallela
Late June collects the Holotrichia parallela adult near the elm peanut field, Hebei, at the experiment indoor feeding, treats it and lays eggs, hatches, and raises 1 age, 2 ages, 3 instar larvaes and carries out biological assay during the phase.Measuring method quantitatively joins in the soil for the spore powder that fermentation culture is obtained, and puddles evenly, forms every gram soil and contains 5 * 10
7The mixed bacterium soil of spore divides to install in the small plastic box, and every box is put into 1 of grub, adds potato block and makes feed.Every instar larvae is handled 30 grubs, repeats for 3 times, and be contrast with the blank soil that does not add the bacterium powder, 23-26 ℃ of incubated at room temperature 24 days relatively confirmed the effect of bacterial strain according to the final mortality ratio of grub.The result sees table 4, proves that bacterial strain can effectively infect each instar larvae of Holotrichia parallela, and is higher to the infection rate of low instar larvae.Observe dead polypide and become stiff, transfer to and preserved moisture in the clean petridish 3 days, can see the polypide surface growth and go out mycelia, produce green spores afterwards, calculate the bombys batryticatus rate.
Table 4 green muscardine fungus MBJQH2-2 is to the dissemination of the different instar larvaes of Holotrichia parallela
| Worm age | Mortality ratio % | Bombys batryticatus rate % |
| One age | 86.3(±3.7) | 46.7 |
| Two ages | 81.7(±7.4) | 35.0 |
| Three ages | 57.5(±5.5) | 23.3 |
Embodiment 9 bacterial strains are to four of the action effect of chafer larva
With about 5 mu peanut be divided into 18 sub-districts of 3 * 6, carry out 6 kinds of processing, be respectively 3 kinds and execute bacterium amount, a kind of microbial inoculum and add 20% macro-chemistry agricultural chemicals, a kind of macro-chemistry agricultural chemicals and blank and handle, every processing is established 3 sub-districts and is repeated, random alignment.Treatment process is for to come into bloom at peanut, sprays the peanut plant base portion after the wettable powder of bacterial strain spore is converted water, and ridging covers then.Chemical pesticide is used the phoxim emulsifiable concentrate agent, and by specification consumption and method are used.When harvesting peanut, extract 1m
2Sample prescription repeats for 3 times, and investigation peanut wormed fruit rate and output are estimated the action effect that bacterial strain is prevented and treated the subterranean pest-insect grub.The result sees table 5, shows after green muscardine fungus MBJQH2-2 is used in the field to reduce grub harm, reduces the wormed fruit rate, increases peanut yield.
Table 5 green muscardine fungus MBJQH2-2 control peanut field grub effect
* 0 contrast; 0.5 times of amount of 1 microbial inoculum; 1 times of amount of 2 microbial inoculums; 1.5 times of amounts of 3 microbial inoculums; 0.2 times of amount of 0.5 times of amount+medicament of 4 microbial inoculums; 1 times of amount of 5 medicaments (constant is converted water for 1000 times)
Claims (5)
1. efficient insecticide fungi green muscardine fungus bacterial strain Metarhizium anisopliae MBJQH2-2, its deposit number is: CGMCC No.4275.
2. the cultural method of the said green muscardine fungus bacterial strain of claim 1 Metarhizium anisopliae MBJQH2-2 is characterized in that, said method comprising the steps of:
1) liquid seeds is cultivated: the obtaining liq substratum, wherein contain sucrose 3%, and yeast extract powder 1%, to the shaking in the bottle of substratum is housed, inoculum size is 2-3 * 10 with the bacterial classification spore inoculating
5Spore/mL cultivates 48h on 25 ± 1 ℃, 200rpm shaking table;
2) liquid amplification culture: the obtaining liq substratum wherein contains sucrose 2%, Semen Maydis powder 1%, yeast 1%; Potassium hydrogenphosphate 0.1%, sal epsom 0.05%, copper sulfate 0.001%; In liquid seeds inoculation fermentation jar, inoculum size is 2-5% by volume, 25 ± 1 ℃ of controlled temperature, rotating speed 50-280rpm; Begin ventilation behind the 16h, air flow 0.7～1, fermentation culture 48-60h;
3) solid fermentation is cultivated: the preparation solid medium wherein contains husk or broken wheat straw 35-55%, wheat bran or cavings 40-50%; Polished rice powder 5-25%, each component sum is 100%, liquid culture is inoculated in the solid medium of sterilization; Inoculum size is volume: weight ratio 0.8-1, and base-material suitable depth 5-8cm cultivated 10-14 days in 25 ± 1 ℃ of culturing room; Dry back promptly obtains leavened prod with sieve method or the whirlwind method separated and collected spore powder of shaking.
3. the said green muscardine fungus bacterial strain of claim 1 Metarhizium anisopliae MBJQH2-2 is to the pesticidal use of cockchafer subclass subterranean pest-insect.
4. the biotic pesticide of a cockchafer subclass subterranean pest-insect is characterized in that, comprise the spore powder of the described green muscardine fungus bacterial strain of claim 1 Metarhizium anisopliae MBJQH2-2.
5. biotic pesticide according to claim 4 is characterized in that, said sterilant is pulvis or granule.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105383280A CN102021122B (en) | 2010-11-05 | 2010-11-05 | High-efficiency insecticidal fungus and applications thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105383280A CN102021122B (en) | 2010-11-05 | 2010-11-05 | High-efficiency insecticidal fungus and applications thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102021122A CN102021122A (en) | 2011-04-20 |
| CN102021122B true CN102021122B (en) | 2012-05-30 |
Family
ID=43862907
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105383280A Expired - Fee Related CN102021122B (en) | 2010-11-05 | 2010-11-05 | High-efficiency insecticidal fungus and applications thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102021122B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103004888B (en) * | 2012-05-16 | 2014-07-30 | 中国农业科学院植物保护研究所 | Metarrhizium anisopliae granular preparation and preparation method thereof |
| CN103783030B (en) * | 2013-12-26 | 2016-06-08 | 中国农业科学院植物保护研究所 | The method of the green ground beetle of a kind of predatory natural enemy insect and green muscardine fungus combination control insect |
| CN105039181A (en) * | 2015-08-19 | 2015-11-11 | 云南农业大学 | Metarhizium anisopliae MAYX130921 and application thereof |
| CN105176834A (en) * | 2015-08-24 | 2015-12-23 | 赵彦龙 | Efficient insecticidal fungus strain screening technology for preventing and controlling forest insects including yponomeuta evonymellus, naxa seriaria motschulsky and malacosoma neustria testacea |
| CN105255740A (en) * | 2015-09-16 | 2016-01-20 | 云南省烟草公司大理州公司 | Isaria farinose (Holmskiold)Fries IFMZ130719 and application thereof |
| CN106479904B (en) * | 2016-11-30 | 2019-07-16 | 南京农业大学 | One plant of flat sand green muscardine fungus and its application |
| CN110256168A (en) * | 2019-07-23 | 2019-09-20 | 甘玮 | Disinsection fungal organic fertilizer |
| CN113289305A (en) * | 2021-05-24 | 2021-08-24 | 安徽农业大学 | Method for reducing pesticide residue and jointly killing insects by using metarhizium anisopliae |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1448502A (en) * | 2002-12-16 | 2003-10-15 | 张泽华 | Green muscardine and use thereof |
| CN1542123A (en) * | 2003-11-07 | 2004-11-03 | 重庆大学 | Metarhizium anisopliae |
| CN101654658A (en) * | 2009-05-26 | 2010-02-24 | 重庆大学 | Pesticidal metarhizium anisopliae strain |
-
2010
- 2010-11-05 CN CN2010105383280A patent/CN102021122B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1448502A (en) * | 2002-12-16 | 2003-10-15 | 张泽华 | Green muscardine and use thereof |
| CN1542123A (en) * | 2003-11-07 | 2004-11-03 | 重庆大学 | Metarhizium anisopliae |
| CN101654658A (en) * | 2009-05-26 | 2010-02-24 | 重庆大学 | Pesticidal metarhizium anisopliae strain |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102021122A (en) | 2011-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101481668B (en) | Bacillus thuringiensis suspending agent for killing cotton spider mites, preparation and use | |
| CN102021122B (en) | High-efficiency insecticidal fungus and applications thereof | |
| CN102776130B (en) | Metarhizium anisopliae and application thereof | |
| CN102363750B (en) | Insecticidal fungus and application thereof | |
| CN105316243B (en) | A kind of preparation method and applications of agricultural root-knot nematode compound biocontrol fungicide | |
| CN107299069B (en) | Agricultural microbial preparation and application thereof in preventing and treating root-knot nematodes of melons and watermelon fusarium wilt | |
| Di Marco et al. | Applications of Trichoderma to prevent Phaeomoniella chlamydospora infections in organic nurseries | |
| CN105705629A (en) | Isolated strain of clonostachys rosea for use as a biological control agent | |
| CN105039167B (en) | A kind of beauveria bassiana DSXJ 07 and its application | |
| CN102177921B (en) | Compound biological control agent as well as preparation method and application thereof | |
| CN104130958A (en) | Bacillus subtilis and application of bacillus subtilis in preventing and curing peony root-knot nematode | |
| CN101280320A (en) | Method for preparing antibiotic substance from chaetomium globosum of plant endophytic fungi | |
| CN112889843B (en) | Killed rice-germ bacillus wettable powder for preventing and treating citrus red spiders and application thereof | |
| CN109673672B (en) | Application of aspergillus versicolor HY12 strain | |
| CN103981108A (en) | Beauveria bassiana for preventing radysia odoriphaga and application thereof | |
| CN101366394B (en) | Composite biological insecticide | |
| CN106472591B (en) | Ecological insecticidal bactericide and preparation method thereof | |
| CN101889583B (en) | Anti-Cydia pomonella biological pesticide and preparation method thereof | |
| KR100976037B1 (en) | Use of the antifungal bacterial paenibacillus polymyxa kc028 and plant extracts as antifungicides and insecticides | |
| CN107821440A (en) | Insecticidal suspending agent that a kind of tea-geometrid-type polyhedrosis viruses compound with beauveria bassiana powder and its preparation method and application | |
| CN109337822B (en) | Beauveria bassiana BRNS50206 and application thereof | |
| CN1128213C (en) | Fungal strain and method for preventing and killing weeds | |
| EP1384405B1 (en) | Bactericidal, bacteriostatic and fungicidal composition comprising two or more live species of trichoderma | |
| CN104232487A (en) | Nosema bombycis for controlling Athetis lepigone and application thereof | |
| JP5168687B2 (en) | How to protect against plant diseases caused by root-knot nematodes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120530 Termination date: 20141105 |
|
| EXPY | Termination of patent right or utility model |