CN105154527A

CN105154527A - Application of GMFB (glia maturation factor beta), GMFB disrupter and application of GMFB disrupter

Info

Publication number: CN105154527A
Application number: CN201510430391.5A
Authority: CN
Inventors: 徐国彤; 吕立夏
Original assignee: Tongji University
Current assignee: Tongji University
Priority date: 2015-07-21
Filing date: 2015-07-21
Publication date: 2015-12-16
Anticipated expiration: 2035-07-21
Also published as: CN105154527B; WO2017012143A1

Abstract

The invention relates to application of GMFB (glia maturation factor beta) as a biomarker for early diagnosis of diabetic retinopathy and for diabetes progression, application of GMFB as a therapeutic target of diabetic retinopathy, a GMFB disrupter and application of the GMFB disrupter. Compared with the prior art, the invention proves that the GMFB content in vitreous body is significantly improved in early period of diabetes in rats of STZ-induced I type diabetes (TIDM). The invention is the first to prove that GMFB content gradually drops with the development of DR (diabetic retinopathy), therefore the GMFB is applicable to dynamic detection of DR progress; the invention is the first to prove that by interfering GMFB expression in rats of DR, visual function can be protected; and the invention is the first to prove that GMFB mediates retinopathy mechanism, including causing decrease of glutamine synthetase of Muller cell, death of ganglion cells and inducing autophagy of photoreceptor cells.

Description

The application of the application of GMFB, GMFB agent interfering and GMFB agent interfering

Technical field

The present invention relates to the purposes of cytokine GMFB, especially relate to GMFB as the application of diabetic retinopathy early diagnosis biomarker and as the target spot of Results, the application of GMFB agent interfering and GMFB agent interfering.

Background technology

Along with the acceleration of China's rapid development of economy and aging process, diabetes (diabetesmilletus, DM) morbidity just in zooming trend, becomes the important Chronic Non-Communicable Diseases of another serious harm people ' s health after cardiovascular and cerebrovascular diseases, tumour.The World Health Organization is inferred, will reach 300,000,000 diabetes mellitus in China patient in 2025.Diabetic retinopathy (DiabeticRetinopathy, DR), be called for short sugar net sick, the modal complication of diabetes, in DM patient, 1/3 there is DR, 1/10 there is the diabetic macular edema (diabeticmacularedema that mortality threatens eyesight, or the sick (proliferativediabeticretinopathy of proliferative sugar net DME), PDR), have a strong impact on patients ' life quality, in world wide, DR has become significant burden on society and social concern.DR was once considered to amphiblestroid microangiopathies, and Lesion of Microcirculation is the classics mark of DR, but increasing evidence implicates neurodegeneration in the pathologic process of DR is an earliest events, and participated in the development of microvascular abnormality.Histology epineural unit's apoptosis and reactive gelatinize are the neurodegenerative most important features of DR.Current DM contributes eye and does not find any Microcirculation abnormality in eye examination, but has had main neurodegenerative feature.Pattern of retinal ganglion cells (RGC) is the cell of the generation apoptosis that DR is detected at first; RGC loses and causes nerve fiber layer thinning, DM patient or have the DM patient of slight DR to be detected by OCT all to detect, without any the DMI type of microangiopathies and II type Patient Detection ERG (electroretinogram, electroretinogram) abnormal.Neuron Apoptosis is along with the change of Muller spongiocyte.It is not immediately clear which is first event in DR for Neuron Apoptosis and gelatinize.The research neurodegenerative mechanism of DR and qualification are very important for the new therapeutic strategy of research and development neurodegenerative mediation person.Necessary from Point of View of Clinical Early Identification neurodegeneration for the application of the medicine based on neuroprotective.

DR neurodegenerative Mechanism Study present situation: the neurodegenerative main mechanism of mediation DR has minimizing and the chronic inflammatory diseases that extracellular exitotoxicity L-glutamic acid (Glutamate, Glu) is gathered, oxidative stress increases, retina secretes protective factors.SchellinSA etc. detect by light microscopic and Electronic Speculum and find, the early stage Muller nucleus of DM changes, and retinal endothelial cell, pericyte have no obvious pathological change, ultrastructure and the physiological function of the early stage retinal Muller cells of DM change, not only affect early stage DM patients' neural cell function and extremely (show as visual sensitivity and the decline of colour vision susceptibility, retina vibration potential b ripple is abnormal), and affect the progression of whole DR.In the neurodegenerative molecule of research mediation DR, we more pay close attention to the molecule that Muller cell produces.

Glia maturation factor beta (gliamaturationfactorbeta, GMFB) and neurodegeneration: GMFB the earliest from the acid plasmosin of the 17kd of ox brain separation and purification, high conservative in evolution, produce primarily of astroglia cell in central nervous system, important effect is had to cerebral tissue growth, differentiation and regeneration, it is expressed and raises in the growth period, grows up and obviously reduces.At rat retina GMFB only at Muller cell expressing, within 14 days, express to one-tenth is average annual from embryo.Recently research display GMFB is a kind of proinflammatory factor, closely related with people's central nervous system degenerative disease, as Alzheimer's disease and Parkinson's disease.GMFB knock out mice can resist the toxicity of experimental autoimmune encephalomyelitis and MPTP (1-methyl 4-phenyl-1,2,3,6-tetrahydropyridine).

Comprise following 4 classes for the cytokine that DR progress is relevant at present: (1), regulate the factor of natural immunity: IL-1b, IL-10; (2) factor of lymphocyte activator propagation and differentiation is regulated: IL-6 and IL-12; (3) relevant to the activating macrophage factor: TNFa and TGFb (4) chemokine, as MCP-1, SDF-1 etc., also has no the effect report of GMFB in DR at present.

Summary of the invention

Object of the present invention is exactly the application providing the application of a kind of GMFB, GMFB agent interfering and GMFB agent interfering in order to overcome defect that above-mentioned prior art exists.

Object of the present invention can be achieved through the following technical solutions:

The present invention finds that GMFB expresses at the ganglion cell layer of rat retina, inner nuclear layer, retinal pigment epithelium layer, can detect that GMFB content obviously raises at the first day of the blood sugar increasing of the diabetes (DM) of STZ-induction at vitreum, last till 4th week, then decline gradually, can be used as the process that biomarker detects DR morbidity.GMFB process rat Muller cell (amphiblestroid spongiocyte) causes glutamine synthetase content to reduce, and causes Muller cell function impaired; Autophagy is caused with GMFB process photoreceptor cell system 661w; In normal SD rats subretinal space injection 3*10^6gcAAV2/8-GMFB virus, 6 weeks after injection, occur ERG decreased amplitude, retina stratum nucleare is thinning, and photoreceptor cell is lost, and apoptosis occurs ganglion cell.This discovery confirms that GMFB obviously raises in early days at DR first, the sex change of mediation neural retina, at the DR first day of STZ-induction, ERG detects can find b ripple decreased amplitude, prompting visual function damage, the infringement of oxidative stress to neural retina that may cause with hyperglycemia is relevant.Detect after carrying out subretinal space injection 3*10^6gcAAV2/8-shGMFB4 week, compare empty viral group of injection, ERG detects B ripple and increases, and prompting visual function is protected.

A first aspect of the present invention, provides the application of GMFB as the biomarker of diabetic retinopathy early diagnosis and course advancement.

Described biomarker refers to the course advancement of the content assessment DR detecting vitreum GMFB.

A second aspect of the present invention; provide the application of GMFB as diabetic retinopathy therapy target; and provide the mechanism that GMFB mediates retinal degeneration, the expression of DR rat retina GMFB albumen can be lowered by perturbation technique, thus protection visual function.

A third aspect of the present invention, provide GMFB agent interfering, described GMFB agent interfering is interference GMFB activity or the material lowering GMFB expression, described GMFB agent interfering is the shGMFB of chemosynthesis, or comprise the carrier of shGMFB, wherein, shGMFB is little hair fastener GMFB oligonucleotide (smallhairpinGMFB, shGMFB).

A fourth aspect of the present invention, provides the application of GMFB agent interfering, the pharmaceutical composition that GMFB agent interfering becomes for the preparation of prevention, improvement or treatment of diabetic retinopathy.

The present invention utilizes ELISA method to detect the content of STZ-induction DM rat vitreum GMFB, and discovery GMFB maintains latter 4 weeks of high-level extremely morbidity early stage remarkable rising of experimental DM rat, then declines gradually.Then find; in type i diabetes (TIDM) rat of STZ-induction, adopt RNA perturbation technique to lower GMFB and express and can suppress gelatinize, obviously lower the expression (marker of gelatinize) of GFAP; reduce inflammatory factor secretion, protection visual function.And the GMFB process LAN of AAV2/8 mediation can cause ganglion cell's apoptosis, infringement visual function, last experiment in vitro adopts GMFB process Muller cell to cause Muller cell transformation glutamate toxicity ability to decline, and declines relevant with glutamine synthase; With GMFB process 661w cell, cause photoreceptor cell autophagy dead.This illustrates that GMFB can be used as a biomarker of DR generation, development, and GMFB also can be used as the target of DR early intervention simultaneously, and protects visual function.

The present invention confirms first in type i diabetes (TIDM) rat of STZ-induction, significantly raises at vitreum content at the early stage GMFB of morbidity.Confirm the disease progression along with DR first, GMFB content declines gradually, can be in progress with detection of dynamic DR; Confirm that interference DR rat GMFB expresses first, can visual function be protected.Confirm that GMFB mediates the mechanism of retinal degeneration, comprises and causes the glutamine synthase of Muller cell to reduce first, cause ganglion cell dead, and induction light receptor cell causes autophagy.

Compared with prior art, the present invention has the following advantages:

1) at the retina of DR rat, find that GMFB all expresses at ganglion cell layer, inner nuclear layer, RPE layer, significantly raise at vitreum GMFB content at DR extremely early stage (first day of blood sugar increasing);

2) retinal degeneration is caused at normal SD rats process LAN GMFB.Confirm the mechanism of GMFB mediates neurodegenerative first, comprise and cause Muller cells glutamine synthase to reduce, ganglion cell's apoptosis and the death of photoreceptor cell autophagy;

3) at DR retina interference GMFB, gelatinize process is suppressed, protection visual function.

Accompanying drawing explanation

Fig. 1: the GMFB expression of results of to fall ill different stratum nucleare at DR;

Fig. 2: GMFB concentration is along with the result of variations of the DR course of disease in the vitreum of the TIDM rat of STZ-induction;

Fig. 3: AAV2/8-shGMFB interference induces the visual function of DR to affect result on STZ-;

Fig. 3 a:shGMFB subretinal space injection DR rat, GMFB and GFAP result of variations;

Fig. 3 b:shGMFB subretinal space injection DR rat, the 4th, six week ERG detects b ripple result after injection;

Fig. 3 c:shGMFB subretinal space injection DR rat, 4th week mRNA level in-site detects GFAP, GMFB expression of results after injection;

Fig. 4: GMFB process LAN result;

6 weeks rear casing layer changing conditions after the injection of Fig. 4 a:AAV2/8-GMFB subretinal space;

6 weeks deutomerite apoptosis situations after the injection of Fig. 4 b:AAV2/8-GMFB subretinal space;

Fig. 5: GMFB process Muller is on the impact of glutamine synthase;

Fig. 6: GMFB process 661w causes autophagy result.

Embodiment

Below in conjunction with the drawings and specific embodiments, the present invention is described in detail.

In following examples, 661w is purchased from ATCC, and substratum is low sugar DMEM.RMC-1 clone is prepared by laboratory, and substratum is DMEM in high glucose, containing 10% serum and 1%P/S.Culture environment is 37 DEG C, 5%CO ₂with 95% air.Process LAN using AAV2/8 as carrier mediated GMFB, is denoted as carrier A AV2/8-GMFB; AAV2/8-shGMFB is designated as using AAV2/8 as the interference carrier of carrier mediated GMFB.AAV2/8-shGMFB and AAV2/8-GMFB is the virus that commercial package is good, and purchased from Wuhan Wei Nuosai Bioisystech Co., Ltd, titre 10^9gc/ml, LC3 virus is purchased from Chinese Hang Seng thing, and rat GMFBELISA test kit is purchased from elabscience.

Embodiment 1

GMFB is in the expression of the different stratum nucleare of diabetic retina

1, diabetes rat preparation: adopt male SD rat, 160-180g, first by hungry for rat 24 hours before experiment.One intra-peritoneal injection STZ (60mg/kg body weight) brings out DM, the isopyknic citric acid solution of Normal group abdominal injection; After 24 hours, docking is got blood and is surveyed blood sugar, and blood glucose value supplements injection STZ lower than the rat of 250mg/dL.Survey blood sugar for three days on end.Blood sugar is defined as DM rat (blood sugar will be excluded lower than the rat of 250mg/dL) more than the rat of 250mg/dL for three days on end.Although preparation is DM rat, change situation at inspection eye, at least two weeks time, can detect that neural retina, RPE, vascular endothelial cell, BRB, ERG etc. change and support that pathology has occurred retina, can DR model be used as.

2, the real-time quantitative PCR of laser microprobe dating sample detects GMFB expression:

Different time points retina is got in fresh acquisition, prepare frozen section, section is directly attached on the film of laser cutting, is prepared (Lycra Lasermicrodissection (LMD) 6500) according to Lycra laser shots preparation method.Slice thickness is 8um, collects the inner nuclear layer of 3 sections, outer nuclear layer, ganglion cell layer and retinal pigment epithelium layer respectively in the Trizol of 0.5ml, carries out extracted total RNA.Through reverse transcription and Real-time PCR Analysis, semiquantitative method is adopted to calculate.

Key step is as follows:

1. tissue collecting laser cutting obtained is at 0.5mlTrizol lysate.

2. then transfer to the centrifuge tube of 1.5mL, add the chloroform of 1/5th volumes, after violent mixing, with centrifugal 15 minutes of the rotating speed 4 DEG C of 12000rpm.

3. after centrifugal, supernatant is transferred in new centrifuge tube, note not getting middle egg white layer, add isopyknic Virahol, add 1ul20ug/ml glycogen as nucleic acid carrier, ice bath 20 minutes.

Centrifugal 15 minutes of the rotating speed 4 DEG C of 4.12000rpm, supernatant discarded, washes the ethanol precipitated with 75% 1-2 time.

5. after will precipitating drying at room temperature, by appropriate 8ulDEPC water dissolution.

RNA reverse transcription, cDNA Article 1 chain is obtained by the M-MLV ThermoScript II of Promega company, and key step is as follows:

1. first get 8ulRNA to mix with the reverse transcription reagents supermix of 2 μ LTakara, then 37 degree 15 minutes, 85 degree 5 seconds terminate reverse transcriptions.

Primer sees the following form 1.

Table 1 is for detecting the primer of gene

Name	forward	reverse
			qRo-GAPDH	CCCCTTCATTGACCTCAACTACA	TCCCATTCTCAGCCTTGACTGT
qRo-GFAP	CCTTGACCTGCGACCTTGAG	CCTGTTCGCGCATTTGC
			qRo_GMFB	GATGATGTACGCTGGGAGTAAGAAC	GGTCTTCGGTGTTTCTTATTTCAAA

Reverse transcription system is as table 2:

Table 2 reverse transcription system

Reagent	Consumption (μ L)	Final concentration
			5×supermix	2	1×
Total serum IgE	8	50-100ng

Reverse transcription program: 37 DEG C 15 minutes, 85 DEG C 5 seconds, then can be for subsequent use in-20 DEG C of Refrigerator stores.

Quantitative PCR

Using cDNA first chain that obtains after RNA reverse transcription as template, design primer is as table 1.Utilize the SYBRGreen real-time fluorescence quantitative PCR detection kit of Tian Gen company, the expression amount of testing goal gene.Pcr amplification condition is as follows: 94 DEG C of sex change 10 minutes, enter circulation (95 DEG C of 5sec, 60 DEG C of 60sec), 40 circulations altogether, and collects solubility curve.

Experimental result as shown in Figure 1, wherein, GCL, ganglioncelllayer ganglion cell layer; INL, innercelllayer, inner nuclear layer; ONL, outernuclearlayer outer nuclear layer; RPE, retinalpigmentepithelia, retinal pigment epithelium.As seen in Figure 1, at normal control rat retina, GMFB expresses main at ganglion cell layer, at the first day of blood sugar increasing, ganglion cell layer and RPE cellular layer up-regulated, DM morbidity one week, GMFB obviously raised in the expression of ganglion cell layer, RPE cellular layer, expresses start to raise at inner nuclear layer; DM morbidity 2 weeks, GMFB, at ganglion cell layer and RPE layer down-regulated expression, expressed progressively raise, higher than the expression of the DM GMFB of a week at inner nuclear layer at inner nuclear layer, outer nuclear layer.

Embodiment 2

In the vitreum of the TIDM rat of STZ-induction, GMFB concentration is along with the change of the DR course of disease

STZ is adopted to prepare type i diabetes model, method is with embodiment 1, the vitreum of diabetes rat is collected at different time points, each time point only collects 6-8, collect respectively, it is for subsequent use that 1000g shifts supernatant in 4 degree after centrifugal 20 minutes, carry out ELISA detection, result participates in Fig. 2, in Fig. 2, Cont is normal control, PI is after postinjection injection, DM and diabetes, as shown in Figure 2, at the first day of blood sugar increasing, find that GMFB significantly raises, then slightly decline, and maintain high level, decline gradually from 4th week, DM morbidity the 8th week, be down to and normal control similar level.The elisa test kit of the GMFB of rat to illustrate according to test kit purchased from Elabscience (article No. is E-EL-Ro419C) and carries out, and key step comprises:

1. sample collection: rat vitreum collects rear 1000 × g centrifugal 20 minutes, gets supernatant for detecting

2. preparation work before detecting:

(1) within 20 minutes, from refrigerator, take out test kit in advance, balance to room temperature.By concentrated cleaning solution distilled water dilution (1:25).

(2) standard substance preparation: in 10000 × g centrifugal 1 minute, add standard substance & sample diluting liquid 1.0mL in freeze-drying standard substance, screw pipe lid, leave standstill 10 minutes, turn upside down for several times, after it fully dissolves, it is mixed gently (concentration is 1000ng/mL) with pipettor.Then doubling dilution (note: not direct carry out doubling dilution in reacting hole) is carried out as required.Suggestion is mixed with following concentration: 1000,500,250,125,62.5,31.25,15.625,0ng/mL, standard substance & sample diluting liquid is directly as blank well 0ng/mL.As prepared 500ng/mL standard substance: the above-mentioned standard substance getting 0.5mL1000ng/mL add in the EP pipe containing 0.5mL standard substance & sample diluting liquid, and mix, the rest may be inferred for all the other concentration.

(3) biotinylated antibody working fluid: calculate before experiment when time experiment institute's expense (in 100 μ L/ holes), answer polygamy 100-200 μ L during actual preparation.Use first 15 minutes, become working concentration with biotinylated antibody diluted concentrated biological elementization antibody (1:100).The same day uses.

(4) enzyme conjugates working fluid: calculate before experiment when time experiment institute's expense (in 100 μ L/ holes), answer polygamy 100-200 μ L during actual preparation.Use first 15 minutes, become working concentration with the concentrated HRP enzyme conjugates (1:100) of enzyme combination diluent dilution.The same day uses.

3. operation steps:

Before experiment starts, each reagent all should balance to room temperature; When reagent or sample preparation, all need abundant mixing, and avoid bubbling as far as possible.

1. application of sample: establish blank well, standard orifice, testing sample hole respectively.Blank well adds standard substance & sample diluting liquid 100 μ L, and remaining hole adds standard substance or testing sample 100 μ L respectively, notes not having bubble, is added on bottom enzyme plate, does not touch hole wall as far as possible, rock mixing gently during application of sample by sample.To enzyme plate overlay film, hatch 90 minutes for 37 DEG C.For ensureing experimental result validity, each experiment please use new standard solution.

2. discard liquid, dry, need not wash.Add biotinylated antibody working fluid 100 μ L (in 15 minutes before use prepare) in each hole, enzyme plate adds overlay film, 37 DEG C of incubations 1 hour.

3. discard liquid in hole, drying, washes plate 3 times, each immersion 1-2 minute, about 350 every holes of μ L/, dries and pat on thieving paper to be patted dry by liquid in hole.

4. every hole adds enzyme conjugates working fluid (preparing in 15 minutes before use) 100 μ L, adds overlay film, 37 DEG C of incubations 30 minutes.

5. discard liquid in hole, dry, wash plate 5 times, method is with step 3.

6. every hole adds substrate solution (TMB) 90 μ L, and enzyme plate adds that overlay film 37 DEG C of lucifuges are hatched and (takes the circumstances into consideration to shorten or extend according to reality colour developing situation, but may not exceed 30 minutes for about 15 minutes.When obvious gradient appears in standard orifice, can stop).

7. every hole adds stop buffer 50 μ L, termination reaction, now blue vertical turn of yellow.The addition sequence of stop buffer should be as far as possible identical with the addition sequence of substrate solution.

8. use microplate reader in the optical density(OD) (OD value) in each hole of 450nm wavelength measurement immediately.Microplate reader power supply should be opened in advance, preheater apparatus, set trace routine.

Embodiment 3

Interference GMFB improves DR Rat Visual function

1, prepare type i diabetes rat model, method is with embodiment 1.

In the STZ-TIDM rat morbidity same day (refer to rat for three days on end blood sugar concentration more than the first day after 250mg/dL), subretinal space injection of AAV 2/8-shGMFB3ul, detects GFAP immunofluorescence in 4 weeks after injection, points out gelatinize to be suppressed.AAV2/8-shGMFB interference induces the visual function impact of DR as shown in Figure 3 to STZ-.

Result, see Fig. 3 a, makes glial fibrillary acidic albumen (GFAP) express at DR rat retina interference GMFB and declines.4', 6-diamidino-2-phenylindone (DAPI) is a kind of fat-soluble fluorescence dye, dyes to nucleus; Zsgreen is a kind of green-ticket, and RPE is retinal pigment epithelium, and ONL is outer nuclear layer, and INL is inner nuclear layer, and GCL is ganglion cell layer, and merge is overlapping, and the fluorescence of the fluorescence of green, red fluorescence and blueness is carried out overlap.

Result is see Fig. 3 b, and after disturbing GMFB virus after injection, 4 weeks ERG detection display b ripples increase, the quantitative statistics that prompting visual function improves.

Result, see Fig. 3 c, to be disturbed after GMFB virus 4 weeks after injection, is expressed significantly decline, have significant difference in mRNA level in-site through quantitative PCR detection GFAP and GMFB.

What extract that RNA adopts is the method for Trizol cracking, and key step is as follows:

1. cell PBS damping fluid is washed 1-2 time, add Trizol lysate (the corresponding 1mL lysates in a hole of such as six orifice plates) in proportion.

2. cell is after wall, transfers to the centrifuge tube of 1.5mL, adds the chloroform of 1/5th volumes, after violent mixing, with centrifugal 15 minutes of the rotating speed 4 DEG C of 12000rpm.

3. after centrifugal, supernatant is transferred in new centrifuge tube, note not getting middle egg white layer, add isopyknic Virahol, ice bath 20 minutes.

5. after will precipitating drying at room temperature, by appropriate DEPC water dissolution.Survey concentration.

1. the oligod (T) of the RNA and 2 μ L that first get 1-2 μ g mixes, and 72 DEG C of water-baths place 5 minutes, and ice bath is after 2 minutes immediately, oligod (T) is combined, gentle centrifugation with the poly-A tail of RNA.

2. add the dNTP (10 μMs) of 1.25 μ L, 1 μ LM-MLV ThermoScript II and 0.5 μ LRNA enzyme inhibitors, with DEPC water, reaction volume is adjusted to 25 μ L.42 DEG C of water-baths place 1 hour.

3.70 DEG C of placements make ThermoScript II inactivation in 10 minutes.The cDNA strand obtained is stored in-20 DEG C of refrigerators.

Reverse transcription system is as table 3:

Table 3 reverse transcription system

Reagent	Consumption (μ L)	Final concentration
			5×M-MLV buffer	4	1×
dNTP(10μM)	0.75	0.375mM
			miRNA RT primer(1μM)	1.2	60nM
M-MLV	0.2	20U
			RNA	1	0.2-200ng
H ₂O	12.85

Reverse transcription program: 16 DEG C 30 minutes, 42 DEG C 30 minutes, 85 DEG C are placed in 5 minutes on ice after 10 minutes immediately.Then can be for subsequent use in-20 DEG C of Refrigerator stores.

Quantitative PCR

Using cDNA first chain that obtains after RNA reverse transcription as template, design primer is as table 1 in embodiment 1.Utilize the SYBRGreen real-time fluorescence quantitative PCR detection kit of Tian Gen company, the expression amount of testing goal gene.Pcr amplification condition is as follows: 94 DEG C of sex change 10 minutes, enter circulation (95 DEG C of 5sec, 60 DEG C of 60sec), 40 circulations altogether, and collects solubility curve.

ERG method: APS full-automatic vision electrophysiologic study instrument (APS-2000) is purchased from Chongqing Kanghua Technology Co., Ltd..Do visual electrophysiology function check the day before yesterday, DM rat is transferred to dark place, carries out dark adatpation.Second day starts to do.The preparation of rat: anaesthetize to rats by intraperitoneal injection 2% vetanarcol (1mL/500g body weight), 1 × Su Mian Xin (0.1ml/200g) allows ophthalmoptosis, then a 0.5% tropicamide mydriasis (WuxiShanheGroup is given, Jiangsu, China), one 0.4% Oxybuprocaine surface anesthesia (EisaiCoLtd, Tokyo, Japan), every eyes are coated with some conductive pastes.Intercalative electrode: ground wire connects on rat tail, negative pole connects between rat two ear, and positive pole connects on two cornea eye, notes not contacting on eyelid and sclera.Open software " visual electrophysiology figure ", point " FERG ", then put 1,2 passages, one is left eye channel, and another is right eye channel, point " setting ", and stimulate number of times to be 2 times, frequency of stimulation is 0.05Hz; Click stimulus intensity (1)-0.0006325 (cd*s/m), (5)-0.006325 (cd*s/m), (9)-0.06325 (cd*s/m) successively, each intensity is interval 2min at least.Point " oscillography ", when the baseline of ripple is steady, clicks " collection ", after waiting the sound hearing " ticking ", gathers complete, click " preservation ".Click again " setting ", amendment number of documents and stimulus intensity, the like.After finishing etc. all intensity, change a rat.After all rats finish, open " file ", demarcate, double-click curve, curve becomes white, clicks " demarcation ".After having demarcated a ripple, by space bar, demarcate b ripple.All demarcation are complete, click " printing ", save as .PDF form.Click lower left corner button, exit software, close computer, shutdown amplifier.

Result is presented at AAV2/8-shGMFB virus and within the 4th week, 6 weeks, carries out ERG detection respectively at subretinal space injecting virus; after injection, within 4 weeks, there were significant differences; but within 6 weeks, do not have significant difference after injection, (Fig. 3 b), prompting GMFB interference can protect visual function.

Intraocular injection:

Before injection, rats by intraperitoneal injection 2% vetanarcol (1mL/400g body weight) are anaesthetized, then a 0.5% tropicamide mydriasis (WuxiShanheGroup is given, Jiangsu, China), a 0.4% Oxybuprocaine surface anesthesia (EisaiCoLtd, Tokyo, Japan).

During subretinal space injection, first do a passage with syringe needle 2mm place after temporo side angle limbus of sclera of No. 30, then syringe needle (the Lot#440602 of No. 33 is used, Hamilton, Reno, NV) and microsyringe (P/N:7634-01/00, the Hamilton of 5 μ L, Reno, NV) injection of AAV 2-CMV-hEPO.If inject successfully, the visible little balloon-shaped structure in eyeground, after several minutes, retina flattens, vesicle disappear, if having vitreous hemorrhage, the rat of lens lesion exclude this experiment.

Embodiment 4

At normal SD rats process LAN AAV2/8-GMFB

By 3*10^6gcAAV2/8-GMFB in the injection of normal rat subretinal space, method is with embodiment 3.After injection, 6w is separated retina, carries out frozen section, and carries out DAPI dyeing, adopts Photoshop to carry out stratum nucleare thickness measurement.

Result is see Fig. 4 a, and in virus injection district, outer nuclear layer thickness is obviously thinning, stratum nucleare thickness be zero be optic disk.

Result participates in Fig. 4 b, after virus injection 6 weeks, adopts TUNEL dyeing, finds to occur apoptosis positive signal at ganglion cell layer.

Retinal thickness is measured:

Frozen section row retinal thickness after DAPI dyeing is measured and cell-count analyses.Retinal thickness carries out under measuring the microscope amplified at 400 times.Measure at distance optic disk 1mm, carry out depending on nipple both sides, comprising: (1) outer limiting membrane-internal limiting membrane (OLM-ILM); (2) outer limiting membrane-ganglion cell layer (OLM-GCL); (3) outer nuclear layer-outer plexiform layer (ONL-OPL); (4) inner nuclear layer (INL); (5) outer nuclear layer (ONL).Each eyeball gets 5 retinal slices, often organizes 4 rats.

It is as follows that TUNEL detects key step:

Adopt InSituCellDeathDetectionKit test kit to detect apoptosis, carry out experimental implementation according to the flow process provided in test kit.Positive control is in advance by retina GradeIDNase-I incubated at room 10 minutes, and negative control is then only labelled liquid, not enzyme-added liquid.Sample washs 3 times with PBS after hatching 1 hour through 37 DEG C, directly observes under fluorescent microscope (Nikon, Yokohama, Japan), and excitation wavelength is 450-490nm.

Embodiment 5

GMFB process Muller is on the impact of glutamine synthase;

Rat Muller clone is incubated at DMEM-high glucose medium, containing 10% serum and dual anti-.Restructuring GMFB dry powder is dissolved in aseptic PBS solution, final concentration 500ug/ml, adds the DMEM-high glucose medium of serum-free, at different time point collecting cells by GMFB, extracting total protein, then carries out the detection of glutamine synthase (GS) with ELISA.

Result is shown in Figure 5, GMFB process Muller cell 8 hours, GS content decline, along with the prolongation continuous decrease in treatment time, extract proteins used and ELISA method the same.

Embodiment 6

GMFB process 661w cell causes autophagy

Mouse photoreceptor cell system is incubated at the low sugar culture-medium of DMEM-, and containing 10% foetal calf serum and dual anti-, RFP-GFP-LC3 adenovirus is purchased from Chinese Hang Seng thing.661w first uses RFP-GFP-LC3 adenovirus (titre is 10^10pfu) to infect 661w.Infect after 1 day, during with serum free medium containing GMFB process 661w.Shown in Figure 6, GMFB process 661w4 hour, cell starts to occur red and green fluorescence, point-like, prompting LC3 inserts on lysosome membrane, and prompting autophagy occurs, process 8 hours, punctate fluorescence is obvious, and the red green fluorescence of autophagy needs under Laser Scanning Confocal Microscope, carry out observation film making.

Above-mentioned is can understand and use invention for ease of those skilled in the art to the description of embodiment.Person skilled in the art obviously easily can make various amendment to these embodiments, and General Principle described herein is applied in other embodiments and need not through performing creative labour.Therefore, the invention is not restricted to above-described embodiment, those skilled in the art, according to announcement of the present invention, do not depart from improvement that scope makes and amendment all should within protection scope of the present invention.

Claims

1.GMFB is as the application of the biomarker of diabetic retinopathy early diagnosis and course advancement.

2. GMFB according to claim 1 is as the application of the biomarker of diabetic retinopathy early diagnosis and course advancement, it is characterized in that, before the surrounding of diabetic retinopathy, GMFB raises with the continuity of pathology time at investigation of intravitrous levels, after the surrounding of diabetic retinopathy, GMFB reduces with the continuity of pathology time at investigation of intravitrous levels.

3.GMFB is as the application of diabetic retinopathy therapy target.

4. GMFB according to claim 3 is as the application of diabetic retinopathy therapy target, it is characterized in that, the mechanism that GMFB mediates retinal degeneration reduces for causing the glutamine synthase of Muller cell.

5. GMFB according to claim 3 is as the application of diabetic retinopathy therapy target, it is characterized in that, GMFB mediates the mechanism of retinal degeneration for causing ganglion cell dead.

6. GMFB according to claim 3 is as the application of diabetic retinopathy therapy target, it is characterized in that, the mechanism that GMFB mediates retinal degeneration is that induction light receptor cell causes autophagy.

7. a GMFB agent interfering, is characterized in that, described GMFB agent interfering is interference GMFB activity or the material lowering GMFB expression.

8. GMFB agent interfering according to claim 7, is characterized in that, described GMFB agent interfering is the shGMFB of chemosynthesis or comprises the carrier of shGMFB, and wherein, shGMFB is little hair fastener GMFB oligonucleotide.

9. an application for GMFB agent interfering, for the preparation of the pharmaceutical composition that prevention, improvement or treatment of diabetic retinopathy become.