CN105154527B - The application of GMFB, the application of GMFB agent interferings and GMFB agent interferings - Google Patents

The application of GMFB, the application of GMFB agent interferings and GMFB agent interferings Download PDF

Info

Publication number
CN105154527B
CN105154527B CN201510430391.5A CN201510430391A CN105154527B CN 105154527 B CN105154527 B CN 105154527B CN 201510430391 A CN201510430391 A CN 201510430391A CN 105154527 B CN105154527 B CN 105154527B
Authority
CN
China
Prior art keywords
gmfb
application
diabetic retinopathy
rat
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201510430391.5A
Other languages
Chinese (zh)
Other versions
CN105154527A (en
Inventor
徐国彤
吕立夏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tongji University
Original Assignee
Tongji University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tongji University filed Critical Tongji University
Priority to CN201510430391.5A priority Critical patent/CN105154527B/en
Priority to PCT/CN2015/085945 priority patent/WO2017012143A1/en
Publication of CN105154527A publication Critical patent/CN105154527A/en
Application granted granted Critical
Publication of CN105154527B publication Critical patent/CN105154527B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

It is early diagnosed as diabetic retinopathy the present invention relates to GMFB and the application of the biomarker of disease progression, GMFB is as the application of diabetic retinopathy therapy target, the application of GMFB agent interferings and GMFB agent interferings.Compared with prior art, it the invention demonstrates that in type-1 diabetes mellitus (TIDM) rat of STZ inductions, is significantly increased in vitreum content in morbidity early stage GMFB.It confirms that the disease progression with DR, GMFB contents are gradually reduced for the first time, dynamic detection DR progress can be used;The GMFB expression of interference DR rats is confirmed for the first time, can protect visual function.It confirms that GMFB mediates the mechanism of retinosis for the first time, including the glutamine synthase of Muller cells is caused to reduce, cause ganglion cell dead, and photoreceptor cell is induced to cause autophagy.

Description

The application of GMFB, the application of GMFB agent interferings and GMFB agent interferings
Technical field
The present invention relates to the purposes of cell factor GMFB, are examined as diabetic retinopathy early stage more particularly, to GMFB The application of disconnected biomarker and the target spot as therapy intervention, the application of GMFB agent interferings and GMFB agent interferings.
Background technology
With the acceleration of China's rapid development of economy and aging process, diabetes (diabetes milletus, DM) Illness rate be just in zooming trend, become after cardiovascular and cerebrovascular disease, tumour another and seriously endanger people's health Important Chronic Non-Communicable Diseases.The World Health Organization speculates, 300,000,000 are up in diabetes mellitus in China patient in 2025.Glycosuria Sick retinopathy (Diabetic Retinopathy, DR), referred to as sugar net disease, are the most common complication of diabetes, in DM 1/3 occurs DR in patient, and 1/10 occurs diabetic macular edema (the diabetic macular that mortality threatens eyesight Edema, DME) or proliferative sugar net disease (proliferative diabetic retinopathy, PDR), seriously affect trouble Person's quality of life, DR has become significant burden on society and social concern in world wide.DR was once considered as retina Microangiopathies, Lesion of Microcirculation is the classical mark of DR, but more and more evidence prompts are refreshing in the pathologic process of DR It is an earliest events through denaturation, and participates in the development of microvascular abnormality.Histology epineural member apoptosis and reactive colloid Change is the neurodegenerative most important features of DR.DM contributes eye and does not find any Microcirculation abnormality in eye examination at present, but It is to have had the characteristics that main neurodegeneration.Pattern of retinal ganglion cells (RGC) is the thin of DR generation apoptosis detected at first Born of the same parents;RGC loss causes nerve fibre layer thinning, in DM patient or has the DM patient of slight DR all to be detected by OCT detections, In the DM I types and II type Patient Detections ERG (electroretinogram, electroretinogram) of no any microangiopathies It is abnormal.Neuron Apoptosis along with Muller spongiocytes variation.It is not immediately clear Neuron Apoptosis and colloidization which A is the event of first generation in DR.The neurodegenerative mechanism of DR and identification are studied in neurodegenerative mediation person for grinding The therapeutic strategy for sending out new is very important.From Point of View of Clinical Early Identification neurodegeneration for the drug based on neuroprotection Using being necessary.
The neurodegenerative Mechanism Study present situations of DR:The neurodegenerative main mechanisms of DR are mediated to have extracellular exitotoxicity paddy ammonia Sour (Glutamate, Glu) gathers, oxidative stress increases, the reduction of retina secretion protective factors and chronic inflammation. The light microscopic such as Schellin SA and Electronic Speculum detection find that DM early stage Muller nucleus has changed, and in retinal vessel Chrotoplast, pericyte simultaneously have no apparent pathological change, and the ultra microstructure and physiological function of DM early stage retinal Muller cells are Change, not only influence early stage DM patients' neural's cell function it is abnormal (show as visual sensitivity and colour vision susceptibility decline, Retina vibration potential b waves are abnormal), and influence the progression of entire DR.In research mediates the neurodegenerative molecules of DR, We more pay close attention to the molecule of Muller cells generation.
Glia maturation factor beta (glia maturation factor beta, GMFB) and neurodegeneration:GMFB The 17kd acidity plasmosins isolated and purified earliest from bovine brain, it is highly conserved in evolution, in central nervous system mainly by star Spongiocyte generates, and has important role, expression to be raised in the puberty brain tissue growth, differentiation and regeneration, adult is apparent It reduces.It only expresses in Muller cells in rat retina GMFB, is expressed from embryo at average annual within 14 days.Recently researches show that GMFB is a kind of proinflammatory factor, closely related with people's central nervous system degenerative disease, such as Alzheimer's disease and Parkinson's disease. GMFB knock out mice can resist experimental autoimmune encephalitis and MPTP (1- methyl 4-phenyl -1,2,3,6- tetrahydrochysenes Pyridine) toxicity.
Include following 4 class currently used for the relevant cell factor of DR progress:(1), the factor of natural immunity is adjusted:IL-1b, IL-10;(2) factor of lymphocyte activator proliferation and differentiation is adjusted:IL-6 and IL-12;(3) relevant with activating macrophage The factor:TNFa and TGFb (4) chemotactic factor (CF), such as MCP-1, SDF-1 also have no effect reports of the GMFB in DR at present.
Invention content
It is an object of the present invention to overcome the above-mentioned drawbacks of the prior art and provide a kind of application of GMFB, The application of GMFB agent interferings and GMFB agent interferings.
The purpose of the present invention can be achieved through the following technical solutions:
Present invention discover that GMFB is the ganglion-cell layer in rat retina, inner nuclear layer, retinal pigment epithelium layer table It reaching, first day in the blood glucose rise of the diabetes (DM) of STZ- inductions can detect GMFB content apparent increases in vitreum, Continue to 4th week, be then gradually reduced, can be used as the process of biomarker analyte detection DR morbidities.GMFB handles rat Muller Cell (spongiocyte of retina) causes the reduction of glutamine synthelase content, causes Muller cell functions impaired;With GMFB processing photoreceptor cell system 661w causes autophagy;In normal SD rats subretinal space injection 3*10^6gc AAV2/8- , 6 weeks after injection, there are ERG decreased amplitudes in GMFB viruses, and retina stratum nucleare is thinning, and photoreceptor cell is lost, ganglion cell's hair Raw apoptosis.This discovery confirms that GMFB in the apparent up-regulation of DR early stages, mediates neural retina denaturation, in the DR of STZ- inductions for the first time First day, ERG detections can find b wave decreased amplitudes, prompt visual function damage, may be with oxidative stress pair caused by hyperglycemia The damage of neural retina is related.It carries out subretinal space injection 3*10^6gc AAV2/8-shGMFB to detect after 4 weeks, to note It penetrates empty viral group to compare, ERG detection B waves increase, and visual function is prompted to be protected.
The first aspect of the present invention provides GMFB as diabetic retinopathy early diagnosis and disease progression The application of biomarker.
The biomarker refers to the disease progression for the content assessment DR for detecting vitreum GMFB.
The second aspect of the present invention provides applications of the GMFB as diabetic retinopathy therapy target, and provides GMFB mediates the mechanism of retinosis, can pass through the table that perturbation technique lowers DR rat retina GMFB albumen It reaches, to protect visual function.
The third aspect of the present invention, provides GMFB agent interferings, the GMFB agent interferings be interference GMFB activity or under It is chemically synthesized shGMFB, or the carrier comprising shGMFB to adjust the substance of GMFB expression, the GMFB agent interferings, wherein ShGMFB is small hair fastener GMFB oligonucleotides (small hairpin GMFB, shGMFB).
The fourth aspect of the present invention, provides the application of GMFB agent interferings, GMFB agent interferings are used to prepare prevention, improve or Treat the pharmaceutical composition of diabetic retinopathy.
The present invention has found that GMFB is being tested using the content of ELISA method detection STZ- induction DM rat vitreums GMFB Property DM rats early stage significantly increase maintain high level to 4 weeks after the onset, be then gradually reduced.Then it finds, is lured in STZ- In type-1 diabetes mellitus (TIDM) rat led, colloid can be inhibited by lowering GMFB expression using RNA perturbation techniques, hence it is evident that be lowered The expression (marker of colloid) of GFAP reduces inflammatory factor secretion, protects visual function.And the GMFB that AAV2/8 is mediated crosses table Up to ganglion cell's apoptosis can be caused again, visual function is damaged, last experiment in vitro is caused using GMFB processing Muller cells Muller cell transformation glutamate toxicity abilities decline, related with glutamine synthase decline;661w cells are handled with GMFB, are drawn It is dead to play photoreceptor cell autophagy.This illustrates that GMFB can be used as the biomarker that DR occurs, develops, while GMFB Also the targeting of DR early interventions is can be used as, and protects visual function.
The present invention is confirmed for the first time in type-1 diabetes mellitus (TIDM) rat that STZ- is induced, in morbidity early stage GMFB in glass Body content significantly increases.Confirm that the disease progression with DR, GMFB contents are gradually reduced for the first time, can use dynamic detection DR into Exhibition;The GMFB expression of interference DR rats is confirmed for the first time, can protect visual function.Confirm that GMFB mediates the machine of retinosis for the first time System, including the glutamine synthase of Muller cells is caused to reduce, cause ganglion cell dead, and photoreceptor cell is induced to cause Autophagy.
Compared with prior art, the present invention has the following advantages:
1) in the retina of DR rats, it is found that GMFB is expressed in ganglion-cell layer, inner nuclear layer, RPE layers, in the poles DR early stage (first day of blood glucose rise) is significantly increased in vitreum GMFB contents;
2) it is overexpressed GMFB in normal SD rats and causes retinosis.Confirm that GMFB mediates neurodegenerative machine for the first time System, including cause the reduction of Muller cells glutamine synthase, ganglion cell's apoptosis and photoreceptor cell autophagy are dead;
3) it interferes GMFB, colloid process to be suppressed in DR retinas, protects visual function.
Description of the drawings
Fig. 1:GMFB falls ill the expressions of results of different stratum nucleares in DR;
Fig. 2:STZ- induction TIDM rats vitreum in GMFB concentration with the DR courses of disease result of variations;
Fig. 3:AAV2/8-shGMFB interference induces the visual function of DR to influence result STZ-;
Fig. 3 a:ShGMFB subretinal spaces inject DR rats, GMFB and GFAP result of variations;
Fig. 3 b:ShGMFB subretinal spaces inject DR rats, and the four, the six weeks ERG detect b wave results after injection;
Fig. 3 c:ShGMFB subretinal spaces inject DR rats, and 4th week mRNA level in-site detects GFAP, GMFB table after injection Up to result;
Fig. 4:GMFB is overexpressed result;
Fig. 4 a:6 weeks rear casing layer situations of change after the injection of AAV2/8-GMFB subretinal spaces;
Fig. 4 b:6 weeks deutomerite Apoptosis situations after the injection of AAV2/8-GMFB subretinal spaces;
Fig. 5:GMFB handles influences of the Muller to glutamine synthase;
Fig. 6:GMFB processing 661w causes autophagy result.
Specific implementation mode
The present invention is described in detail with specific embodiment below in conjunction with the accompanying drawings.
In following embodiment, 661w is purchased from ATCC, and culture medium is low sugar DMEM.RMC-1 cell lines are prepared by laboratory, training It is DMEM in high glucose to support base, contains 10% serum and 1%P/S.Culture environment is 37 DEG C, 5%CO2With 95% air.Made with AAV2/8 For the overexpression of carrier mediated GMFB, it is denoted as carrier AAV2/8-GMFB;Using AAV2/8 as the interference carrier of carrier mediated GMFB It is denoted as AAV2/8-shGMFB.AAV2/8-shGMFB and AAV2/8-GMFB is the good virus of commercial package, and promise is tieed up purchased from Wuhan Bioisystech Co., Ltd is matched, titre 10^9gc/ml, LC3 virus is purchased from Chinese Hang Seng object, and rat GMFB ELISA kits are purchased from elabscience。
Embodiment 1
Expression of the GMFB in diabetic retina difference stratum nucleare
1, prepared by diabetes rat:Using male SD rat, 160-180g is first 24 hours hungry by rat before experiment.It is single Secondary intraperitoneal injection STZ (60mg/kg weight) induces DM, and isometric citric acid solution is injected intraperitoneally in Normal group;24 Docking takes blood to survey blood glucose, rat supplement injection STZ of the blood glucose value less than 250mg/dL after hour.Blood glucose is surveyed for three days on end.By blood glucose The rat for being more than for three days on end 250mg/dL is determined as DM rats (rat of the blood glucose less than 250mg/dL will be excluded).Although system Standby is DM rats, eye change situation is being checked, at least at two weeks, it is already possible to detect neural retina, RPE, blood The changes such as endothelial cell, BRB, ERG support retina to have occurred and that lesion, may be used as DR models.
2, the real-time quantitative PCR detection GMFB expression of laser microprobe dating sample:
Fresh acquisition takes different time points retina, prepares frozen section, and slice is placed directly against on the film of laser cutting, It is prepared (Lycra Laser microdissection (LMD) 6500) according to Lycra laser shots preparation method.Slice Thickness is 8um, respectively collect 3 slice inner nuclear layer, outer nuclear layer, ganglion-cell layer and retinal pigment epithelium layers in In the Trizol of 0.5ml, it is stripped total serum IgE.By reverse transcription and Real-time PCR Analysis, using the method meter of sxemiquantitative It calculates.
Key step is as follows:
1. the tissue collecting that laser cutting is obtained is in 0.5ml Trizol lysates.
2. be then transferred into the centrifuge tube of 1.5mL, it is added the chloroform of 1/5th volumes, after violent mixing, with 4 DEG C of the rotating speed of 12000rpm centrifuges 15 minutes.
3. after centrifugation, supernatant is transferred in new centrifuge tube, is careful not to get intermediate albumin layer, is added isometric Isopropanol, be added 1ul 20ug/ml glycogens as nucleic acid carrier, ice bath 20 minutes.
4. 4 DEG C of the rotating speed of 12000rpm centrifuges 15 minutes, discard supernatant, precipitation is washed 1-2 times with 75% ethyl alcohol.
After 5. drying at room temperature being precipitated, with suitable 8ul DEPC water dissolutions.
RNA reverse transcriptions, first chain of cDNA are obtained by the M-MLV reverse transcriptase of Promega companies, key step It is as follows:
1. take 8ul RNA and the reverse transcription reagents supermix of 2 μ L Takara to be uniformly mixed first, then 37 degree 15 points Clock, 85 degree are terminated reverse transcription in 5 seconds.
Primer see the table below 1.
Table 1 is used to detect the primer of gene
Name forward reverse
qRo-GAPDH CCCCTTCATTGACCTCAACTACA TCCCATTCTCAGCCTTGACTGT
qRo-GFAP CCTTGACCTGCGACCTTGAG CCTGTTCGCGCATTTGC
qRo_GMFB GATGATGTACGCTGGGAGTAAGAAC GGTCTTCGGTGTTTCTTATTTCAAA
Reverse transcription system such as table 2:
2 reverse transcription system of table
Reagent Dosage (μ L) Final concentration
5×supermix 2
Total serum IgE 8 50-100ng
Reverse transcription program:37 DEG C 15 minutes, 85 DEG C 5 seconds, then can be saved backup in -20 DEG C of refrigerators.
Quantitative PCR
Using the first chains of cDNA obtained after RNA reverse transcriptions as template, design primer such as table 1.Utilize Tiangeng company SYBR Green real-time fluorescence quantitative PCR detection kits, the expression quantity of testing goal gene.PCR amplification condition is as follows:94℃ Denaturation 10 minutes, into cycle (95 DEG C of 5sec, 60 DEG C of 60sec), 40 recycle altogether, and collect solubility curve.
Experimental result is as shown in Figure 1, wherein GCL, ganglion cell layer ganglion-cell layers;INL, inner cell Layer, inner nuclear layer;ONL, outer nuclear layer outer nuclear layers;RPE, retinal pigment epithelia, view Membranochromic pigments epithelial cell.As seen in Figure 1, in normal control rat retina, GMFB expression mainly in ganglion-cell layer, First day of blood glucose rise, ganglion-cell layer and RPE cellular layer up-regulated expressions are fallen ill one week in DM, and GMFB is in ganglion-cell layer, RPE The expression of cellular layer is obviously raised, and starts to raise in inner nuclear layer expression;It falls ill 2 weeks in DM, GMFB is in ganglion-cell layer and RPE layers of table Up to downward, is gradually raised in inner nuclear layer, outer nuclear layer expression, be higher than expression of the mono- week GMFB of DM in inner nuclear layer.
Embodiment 2
STZ- induction TIDM rats vitreum in GMFB concentration with the DR courses of disease variation
Type-1 diabetes mellitus model is prepared using STZ, method collects diabetes rat with embodiment 1, in different times point Vitreum, each time point are collected 6-8 only, are collected respectively, and transfer supernatant is spare after twenty minutes in 4 degree of centrifugations by 1000g, carries out ELISA is detected, and as a result participates in Fig. 2, and in Fig. 2, Cont is normal control, and PI is DM, that is, glycosuria after postinjection injections Disease, as shown in Figure 2, at first day of blood glucose rise, discovery GMFB was significantly increased, and is then declined slightly, and maintain high level, It is gradually reduced since 4th week, falls ill the 8th week, be down to and normal control similar level in DM.The elisa of the GMFB of rat Kit illustrates to carry out purchased from Elabscience (article No. is E-EL-Ro419C) according to kit, and key step includes:
1. sample collection:1000 × g is centrifuged 20 minutes after rat vitreum is collected, and takes supernatant for detecting
2. preparation before detection:
(1) shift to an earlier date 20 minutes and take out kit from refrigerator, balance to room temperature.Concentrated cleaning solution is diluted with distilled water (1:25)。
(2) standard items are prepared:In 10000 × g centrifuge 1 minute, be added standard items & sample diluting liquids 1.0mL to be lyophilized mark In quasi- product, pipe lid is screwed, stand 10 minutes, turn upside down for several times, after it is fully dissolved, with pipettor by its gently mixing (a concentration of 1000ng/mL).Then doubling dilution (note is carried out as needed:It is dilute multiple proportions not to be carried out directly in reacting hole It releases).It is recommended that being configured to following concentration:1000,500,250,125,62.5,31.25,15.625,0ng/mL, standard items & samples Dilution is directly as blank well 0ng/mL.Such as prepare 500ng/mL standard items:Take the above-mentioned standard product of 0.5mL1000ng/mL It is added in the EP pipes containing 0.5mL standard items & sample diluting liquids, mixing, the rest may be inferred for remaining concentration.
(3) biotinylated antibody working solution:It is calculated before experiment when time experiment institute's expense (in terms of 100 holes μ L/), is actually matched Polygamy 100-200 μ L are answered when processed.Using first 15 minutes, with biotinylated antibody diluted concentrated biological element antibody (1:100) at working concentration.The same day uses.
(4) enzyme conjugates working solution:Calculating is when time experiment institute's expense (in terms of 100 holes μ L/), practical preparation before experiment Answer polygamy 100-200 μ L.Using first 15 minutes, concentration HRP enzyme conjugates (1 is diluted with enzyme combination diluent:100) at work Make concentration.The same day uses.
3. operating procedure:
Before experiment starts, each reagent should all be balanced to room temperature;When reagent or sample preparation, it is both needed to mix well, and as possible It avoids blistering.
1. sample-adding:Blank well, gauge orifice, sample to be tested hole are set respectively.Blank well adds 100 μ L of standard items sample diluting liquid, Remaining hole adds 100 μ L of standard items or sample to be tested respectively, has been careful not to bubble, sample is added on ELISA Plate bottom when sample-adding, to the greatest extent Amount does not touch hole wall, gently shakes mixing.ELISA Plate overlay film is given, 37 DEG C are incubated 90 minutes.To ensure experimental result validity, often Secondary experiment please use new standard solution.
2. discarding liquid, dry, does not have to washing.100 μ L of biotinylated antibody working solution are added in each hole (before use Prepared in 15 minutes), ELISA Plate adds overlay film, and 37 DEG C incubate 1 hour.
3. discarding liquid in hole, dry, board-washing 3 times, impregnate 1-2 minutes every time, about 350 μ L/ are dried and inhaled per hole It is patted on water paper and pats dry liquid in hole.
4. (preparing) 100 μ L in 15 minutes before use per the enzyme conjugate working solution in hole, in addition overlay film, 37 DEG C incubate 30 points Clock.
5. discarding liquid in hole, dry, board-washing 5 times, method is the same as step 3.
6. adding 90 μ L of substrate solution (TMB) per hole, ELISA Plate is protected from light incubation 15 minutes or so (according to reality plus 37 DEG C of overlay film Develop the color situation shortening or extension as one sees fit on border, but may not exceed 30 minutes.When there is apparent gradient in gauge orifice, you can terminate).
7. adding 50 μ L of terminate liquid per hole, reaction is terminated, blue is vertical at this time turns yellow.The addition sequence of terminate liquid should as possible with The addition sequence of substrate solution is identical.
8. using microplate reader in the optical density (OD values) in each hole of 450nm wavelength measurements immediately.Microplate reader power supply should be opened in advance, Preheater apparatus sets detection program.
Embodiment 3
GMFB is interfered to improve DR rat visual functions
1, type-1 diabetes mellitus rat model is prepared, method is the same as embodiment 1.
On the day of STZ-TIDM rats fall ill (referring to rat, blood sugar concentration is more than first day after 250mg/dL for three days on end), Subretinal space injection of AAV 2/8-shGMFB 3ul, 4 weeks detection GFAP immunofluorescences, prompt colloid to be pressed down after injection System.It is as shown in Figure 3 that AAV2/8-shGMFB interference induces the visual function of DR to influence STZ-.
As a result referring to Fig. 3 a, in the case where DR rat retinas interference GMFB makes glial fibrillary acidic albumen (GFAP) express Drop.4', 6- diamidino -2-phenylindone (DAPI) are a kind of fat-soluble fluorescent dyes, are dyed to nucleus;Zsgreen It is a kind of green-ticket, RPE is retinal pigment epithelium, and ONL is outer nuclear layer, and INL is inner nuclear layer, and GCL is ganglion-cell layer, Merge is overlapping, and the fluorescence of the fluorescence of green, red fluorescence and blue is overlapped.
As a result referring to Fig. 3 b, 4 weeks ERG detection display b waves increase after interfering GMFB viruses after injection, and visual function is prompted to change Kind quantitative statistics.
As a result referring to Fig. 3 c, 4 weeks are interfered after GMFB viruses after injection, pass through quantitative PCR detection GFAP in mRNA level in-site It is remarkably decreased with GMFB expression, there is significant difference.
The method that extraction RNA is cracked using Trizol, key step are as follows:
1. cell is washed 1-2 times with PBS buffer solution, it is proportionally added into a Trizol lysates (such as hole of six orifice plates Corresponding 1mL lysates).
After 2. cell is from wall, it is transferred to the centrifuge tube of 1.5mL, is added the chloroform of 1/5th volumes, after violent mixing, with 4 DEG C of the rotating speed of 12000rpm centrifuges 15 minutes.
3. after centrifugation, supernatant is transferred in new centrifuge tube, is careful not to get intermediate albumin layer, is added isometric Isopropanol, ice bath 20 minutes.
4. 4 DEG C of the rotating speed of 12000rpm centrifuges 15 minutes, discard supernatant, precipitation is washed 1-2 times with 75% ethyl alcohol.
After 5. drying at room temperature being precipitated, with suitable DEPC water dissolutions.Survey concentration.
RNA reverse transcriptions, first chain of cDNA are obtained by the M-MLV reverse transcriptase of Promega companies, key step It is as follows:
1. the oligo d (T) of the RNA and 2 μ L of 1-2 μ g is taken to mix first, 72 DEG C of water-baths place 5 minutes, and ice bath 2 divides immediately Zhong Hou makes oligo d (T) be combined with the poly-A tails of RNA, gentle centrifugation.
2. dNTP (10 μM), 1 μ L M-MLV reverse transcriptase and the 0.5 μ L RNase inhibitors of 1.25 μ L is added, DEPC is used Water adjusts reaction volume to 25 μ L.42 DEG C of water-baths are placed 1 hour.
3. 70 DEG C are placed 10 minutes and reverse transcriptase are made to inactivate.- 20 DEG C of refrigerators are stored in by obtained cDNA is single-stranded.
Reverse transcription system such as table 3:
3 reverse transcription system of table
Reagent Dosage (μ L) Final concentration
5×M-MLV buffer 4
dNTP(10μM) 0.75 0.375mM
miRNA RT primer(1μM) 1.2 60nM
M-MLV 0.2 20U
RNA 1 0.2-200ng
H2O 12.85
Reverse transcription program:16 DEG C 30 minutes, 42 DEG C 30 minutes, 85 DEG C are immediately placed on 5 minutes on ice after ten minutes.Then may be used It is saved backup in -20 DEG C of refrigerators.
Quantitative PCR
Using the first chains of cDNA obtained after RNA reverse transcriptions as template, table 1 in design primer such as embodiment 1.Utilize Tiangeng The SYBR Green real-time fluorescence quantitative PCR detection kits of company, the expression quantity of testing goal gene.PCR amplification condition is such as Under:94 DEG C are denaturalized 10 minutes, and into cycle (95 DEG C of 5sec, 60 DEG C of 60sec), 40 recycle altogether, and collect solubility curve.
ERG methods:APS full-automatic vision electrophysiologic study instrument (APS-2000) is purchased from Chongqing Kanghua Technology Co., Ltd.. Visual electrophysiology functional check the previous day is done, DM rats are transferred to dark place, carry out dark adaptation.Start to do within second day.Rat Prepare:It is anaesthetized to 2% yellow Jackets of rats by intraperitoneal injection (1mL/500g weight), 1 × Su Mian Xin (0.1ml/200g) It allows exophthalmos, then gives 0.5% Tropicamide mydriasis of a drop (Wuxi Shanhe Group, Jiangsu, China), one 0.4% Oxybuprocaine surface anesthesia (Eisai Co Ltd, Tokyo, Japan) is dripped, each eye respectively applies some conductive pastes. Intercalative electrode:Ground wire connects on rat tail, and between cathode connects two ear of rat, anode connects on two cornea eyes, is careful not to contact On eyelid and sclera.Software " visual electrophysiology figure ", point " FERG " are opened, then puts 1,2 channels, one is left eye channel, another A is right eye channel, and point " setting ", stimulation number is 2 times, frequency of stimulation 0.05Hz;Stimulus intensity (1)-is clicked successively 0.0006325 (cd*s/m), (5) -0.006325 (cd*s/m), (9) -0.06325 (cd*s/m), each intensity are at least spaced 2min.Point " oscillography " is clicked " acquisition ", is waited after hearing a sound of " ticking " when the baseline of wave is steady, and acquisition finishes, and is clicked and " is protected It deposits ".It clicks again " setting ", changes number of documents and stimulus intensity, and so on.After being finished etc. all intensity, a rat is changed. It after all rats finish, opens " file ", is demarcated, double-click curve, curve becomes white, clicks " calibration ".A waves are demarcated Afterwards, by space bar, b waves are demarcated.All calibration finish, and click " printing ", save as .PDF formats.Lower left corner button is clicked, is moved back Go out software, close computer, closes amplifier.
As a result AAV2/8-shGMFB viruses are shown in and carry out ERG inspections respectively within the 4th week, 6 weeks in subretinal space injecting virus It surveys, there were significant differences within 4 weeks after injection, but does not have within 6 weeks significant difference, (Fig. 3 b) to prompt GMFB interference that can protect after injection Protect visual function.
Intraocular injection:
2% yellow Jackets of rats by intraperitoneal injection (1mL/400g weight) are anaesthetized before injection, then give a drop 0.5% Tropicamide mydriasis (Wuxi Shanhe Group, Jiangsu, China), a 0.4% Oxybuprocaine surface of drop It anaesthetizes (Eisai Co Ltd, Tokyo, Japan).
When subretinal space is injected, a channel is first done at 2mm after temporo side angle limbus of sclera with No. 30 syringe needles, is then used Micro syringe (the P/N of No. 33 syringe needles (Lot#440602, Hamilton, Reno, NV) and 5 μ L:, Hamilton, Reno, NV) injection of AAV 2-CMV-hEPO.If injected successfully, the visible vesicular structure in eyeground, several minutes Retina flattens afterwards, and vesicle disappears, if there is the rat of vitreous hemorrhage, lens lesion excludes this experiment.
Embodiment 4
It is overexpressed AAV2/8-GMFB in normal SD rats
3*10^6gc AAV2/8-GMFB are injected in normal rat subretinal space, method is the same as embodiment 3.6w after injection Retina is detached, carries out frozen section, and carry out DAPI dyeing, stratum nucleare thickness measure is carried out using Photoshop.
As a result referring to Fig. 4 a, in virus injection area, outer nuclear layer thickness is obviously thinning, stratum nucleare thickness be zero be optic nerve breast Head.
As a result Fig. 4 b are participated in dye using TUNEL 6 weeks after virus injection, find the apoptosis positive occur in ganglion-cell layer Signal.
Retinal thickness measures:
Frozen section row retinal thickness after DAPI is dyed measures and cell count analysis.Retinal thickness measures It is carried out under the microscope of 400 times of amplifications.Measurement is carried out apart from optic papilla 1mm, regarding nipple both sides, including:(1) extraneous Film-internal limiting membrane (OLM-ILM);(2) external limiting membrane-ganglion-cell layer (OLM-GCL);(3) outer nuclear layer-outer plexiform layer (ONL-OPL); (4) inner nuclear layer (INL);(5) outer nuclear layer (ONL).Each eyeball takes 5 retinal slices, every group of 4 rats.
It is as follows that TUNEL detects key step:
Apoptosis is detected using In Situ Cell Death Detection Kit kits, according in kit The flow of offer carries out experimental implementation.Positive control is in advance to be incubated at room temperature retina Grade I DNase-I 10 minutes, Negative control then only marking liquid, be not added with enzyme solution.Sample is washed 3 times, in fluorescence microscope after 37 DEG C are incubated 1 hour with PBS It is directly observed under (Nikon, Yokohama, Japan), excitation wavelength 450-490nm.
Embodiment 5
GMFB handles influences of the Muller to glutamine synthase;
Rat Muller cell lines are incubated at DMEM- high glucose mediums, containing 10% serum and dual anti-.GMFB dry powder will be recombinated It is dissolved in sterile PBS solution, the DMEM- high glucose mediums of serum-free are added, in different times in GMFB by final concentration 500ug/ml Point collects cell, extracts total protein, the detection of glutamine synthase (GS) is then carried out with ELISA.
As a result shown in Figure 5, GMFB handles Muller cells 8 hours, and GS contents decline, with the extension of processing time It continues to decline, extract proteins used and ELISA method are the same.
Embodiment 6
GMFB processing 661w cells cause autophagy
Mouse photoreceptor cell system is incubated at DMEM- low sugar culture mediums, contains 10% fetal calf serum and dual anti-, RFP-GFP- LC3 adenovirus is purchased from Chinese Hang Seng object.661w first infects 661w with RFP-GFP-LC3 adenovirus (titre 10^10pfu).Infection 1 After it, when handling 661w containing GMFB with serum free medium.Shown in Figure 6, GMFB handles 661w 4 hours, and cell starts Existing red and green fluorescence, it is dotted, it prompts in LC3 indexings to lysosome membrane, prompts autophagy, handle 8 hours, punctate fluorescence Obviously, the red green fluorescence needs of autophagy carry out observation film making under Laser Scanning Confocal Microscope.
The above description of the embodiments is intended to facilitate ordinary skill in the art to understand and use the invention. Person skilled in the art obviously easily can make various modifications to these embodiments, and described herein general Principle is applied in other embodiment without having to go through creative labor.Therefore, the present invention is not limited to the above embodiments, ability Field technique personnel announcement according to the present invention, improvement and modification made without departing from the scope of the present invention all should be the present invention's Within protection domain.

Claims (3)

1.GMFB is as biomarker in the reagent for preparing diabetic retinopathy early diagnosis and disease progression diagnosis In application.
2. GMFB according to claim 1 as biomarker prepare diabetic retinopathy early diagnosis and Application in the reagent of disease progression diagnosis, which is characterized in that before the surrounding of diabetic retinopathy, GMFB is in vitreum Interior content is increased with the continuity of lesion time, after the four weeks of diabetic retinopathy, GMFB investigation of intravitrous levels with The continuity of lesion time and reduce.
3. a kind of GMFB agent interferings are used to prepare improvement or treat the application of the pharmaceutical composition of diabetic retinopathy, special Sign is that the GMFB agent interferings are chemically synthesized shGMFB or the carrier comprising shGMFB, wherein shGMFB is small hair Block GMFB oligonucleotides.
CN201510430391.5A 2015-07-21 2015-07-21 The application of GMFB, the application of GMFB agent interferings and GMFB agent interferings Active CN105154527B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201510430391.5A CN105154527B (en) 2015-07-21 2015-07-21 The application of GMFB, the application of GMFB agent interferings and GMFB agent interferings
PCT/CN2015/085945 WO2017012143A1 (en) 2015-07-21 2015-08-03 Use of gmfb, gmfb interference agent and use of gmfb interference agent

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510430391.5A CN105154527B (en) 2015-07-21 2015-07-21 The application of GMFB, the application of GMFB agent interferings and GMFB agent interferings

Publications (2)

Publication Number Publication Date
CN105154527A CN105154527A (en) 2015-12-16
CN105154527B true CN105154527B (en) 2018-08-24

Family

ID=54795569

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510430391.5A Active CN105154527B (en) 2015-07-21 2015-07-21 The application of GMFB, the application of GMFB agent interferings and GMFB agent interferings

Country Status (2)

Country Link
CN (1) CN105154527B (en)
WO (1) WO2017012143A1 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108939066A (en) * 2018-07-13 2018-12-07 同济大学 GMFB antibody is as the application for preparing diabetic retinopathy therapeutic agent
CN110542758B (en) * 2019-03-26 2021-06-04 同济大学 Application of GMFB (GMFB) as biomarker of diabetic osteoporosis
CN110542759B (en) * 2019-04-04 2021-06-29 同济大学 Application of GMFB (GMFB) as biomarker of diabetic nephropathy
CN112043833A (en) * 2020-08-31 2020-12-08 同济大学 Autophagy and apoptosis inhibitor of retinal pigment cells (RPE) and application thereof
CN112195244B (en) * 2020-09-16 2022-04-19 同济大学 Application of GMFB (GMFB) as hepatocyte liver cancer biomarker
CN113577068A (en) * 2021-07-30 2021-11-02 同济大学 Application of small molecule compound in preparing medicine for treating GMFB mediated disease
CN113759127B (en) * 2021-08-18 2024-03-26 同济大学 Application of GMFB as biomarker for insulin resistance

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040241737A1 (en) * 2003-05-27 2004-12-02 Wyeth Methods for diagnosing mood disorders

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011060182A1 (en) * 2009-11-12 2011-05-19 Alper Biotech, Llc Monoclonal antibodies against gmf-beta antigens, and uses therefor
WO2012154957A2 (en) * 2011-05-11 2012-11-15 Alper Biotech, Llp Diagnosis and prognosis of triple negative breast and ovarian cancer
CN104940954B (en) * 2015-06-23 2017-12-26 同济大学 Applications of the MicroRNA 7 in anticol matter chemical drug thing is prepared

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040241737A1 (en) * 2003-05-27 2004-12-02 Wyeth Methods for diagnosing mood disorders

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
IL-1β Induces IL-6 production in retinal Müller cells predominantly through the activation of P38 MAPK/NF-κB signaling pathway;Xiufen Liu;《Experimental Cell Research》;20140917;第331卷;223-231 *
Role of interleukin-1b in the pathogenesis of diabetic retinopathy;R A Kowluru;《Br J Ophthalmol》;20041231;第88卷;1343-1347 *

Also Published As

Publication number Publication date
CN105154527A (en) 2015-12-16
WO2017012143A1 (en) 2017-01-26

Similar Documents

Publication Publication Date Title
CN105154527B (en) The application of GMFB, the application of GMFB agent interferings and GMFB agent interferings
Barile et al. The RAGE axis in early diabetic retinopathy
López-Luppo et al. Cellular senescence is associated with human retinal microaneurysm formation during aging
Varanasi et al. Manipulating glucose metabolism during different stages of viral pathogenesis can have either detrimental or beneficial effects
CN108939066A (en) GMFB antibody is as the application for preparing diabetic retinopathy therapeutic agent
Birtel et al. Mitochondrial retinopathy
Zhang et al. Targeting long non-coding RNA MALAT1 alleviates retinal neurodegeneration in diabetic mice
CN109022584B (en) A kind of molecular marker of the cancer of the esophagus and application thereof
CN105802907B (en) A kind of cultural method of mesenchymal stem cell
Tsuda et al. Real-time imaging of RGC death with a cell-impermeable nucleic acid dyeing compound after optic nerve crush in a murine model
Mirando et al. Suppression of ocular vascular inflammation through peptide-mediated activation of angiopoietin-Tie2 signaling
CN105188688A (en) Composition and method for inducing EPO-mediated haemoglobin expression and mitochondrial biogenesis in nonhaematopoietic cell
EP3532072B1 (en) Treatment of glaucoma
Laspas et al. Effect of the M 1 muscarinic acetylcholine receptor on retinal neuron number studied with gene-targeted mice
CN104940954B (en) Applications of the MicroRNA 7 in anticol matter chemical drug thing is prepared
Yan et al. VIP induces changes in the F-/G-actin ratio of Schlemm's canal endothelium via LRRK2 transcriptional regulation
CN112043833A (en) Autophagy and apoptosis inhibitor of retinal pigment cells (RPE) and application thereof
Zhou et al. Transcription factor FOXP1 mediates vascular endothelial dysfunction in diabetic retinopathy
Zhang et al. PDGF-D-induced immunoproteasome activation and cell-cell interactions
CN111481555A (en) Application of prostaglandin E2 receptor targeting drug in treatment of diabetic retinopathy
Li et al. Effect of aflibercept combined with triamcinolone acetonide on aqueous humor growth factor and inflammatory mediators in diabetic macular edema
Xu et al. Association between anti‐fibrillin‐2 protein induced retinal degeneration via intravitreous delivery and activated TGF‐β signalling in mice
CN108245528A (en) A kind of drug of optic nerve protection
CN102174658B (en) Method for screening anti-aids drug
Shu et al. MiR-21-5p Promotes RPE Cell Necroptosis by Targeting Peli1 in a Rat Model of AMD

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant