WO2017012143A1 - Use of gmfb, gmfb interference agent and use of gmfb interference agent - Google Patents

Abstract

The present invention relates to the use of GMFB as a biomarker for the early diagnosis and disease course progression of diabetic retinopathy, the use of GMFB as a therapeutic target for diabetic retinopathy, a GMFB interference agent and the use of GMFB interference agent. Compared with the prior art, the present invention confirms that in STZ-induced Type I diabetes (TIDM) rats, the GMFB content in the vitreous body is significantly increased at the early stage of the disease. First confirming that the GMFB content is decreased gradually, with the condition progression of DR which can be dynamically detected; and first confirming that interference to the GMFB expression of a DR rat can protect the visual function. First confirming that the GMFB mechanism mediates retinal degeneration, comprising causing a decrease in glutamine synthetase of Muller cells, leading to the death of ganglion cells, and inducing autophagy of photoreceptor cells toe.

Description

Application of GMFB, application of GMFB interfering agent and GMFB interfering agent Technical field

The invention relates to the use of the cytokine GMFB, in particular to the application of GMFB as a biomarker for early diagnosis of diabetic retinopathy and as a target for therapeutic intervention, the application of GMFB interfering agents and GMFB interfering agents.

Background technique

With the rapid development of China's economy and the acceleration of the aging process, the prevalence of diabetes (diabetes milletus, DM) is rapidly rising, becoming another important chronic disease that seriously endangers people's health after cardiovascular and cerebrovascular diseases and cancer. Non-communicable diseases. The World Health Organization speculates that in 2025 China's diabetes patients will reach 300 million. Diabetic Retinopathy (DR), referred to as glyconet disease, is the most common complication of diabetes. In one third of DM patients, DR occurs, and 1/10 of the diabetic macular edema (Dabetic macular edema) DME) or proliferative diabetic retinopathy (PDR) seriously affects the quality of life of patients. DR has become a significant social burden and social problem worldwide. DR was once thought to be a microvascular lesion of the retina, and microcirculatory damage is a classic hallmark of DR, but there is increasing evidence that neurodegeneration is an early event in the pathogenesis of DR and is involved in the development of microvascular abnormalities. Histologically neuronal apoptosis and reactive gliosis are the most important features of DR neurodegeneration. At present, DM donated eyes have not found any microcirculation abnormalities in ophthalmologic examination, but they have the characteristics of major neurodegeneration. Retinal ganglion cells (RGC) are the first cells to undergo apoptosis in DR; loss of RGC leads to thinning of nerve fiber layer, detected by OCT in DM patients or DM patients with mild DR, without any microangiopathy Patients with DM type I and type II found abnormalities in ERG (electroretinogram). Neuronal apoptosis is accompanied by changes in Muller glial cells. It is unclear which neuronal apoptosis and gliosis are the first events in DR. Studying the mechanisms of DR neurodegeneration and identifying mediators of neurodegeneration are essential for developing new therapeutic strategies. Early identification of neurodegeneration from a clinical perspective is necessary for the application of neuroprotective drugs.

Current status of DR neurodegenerative mechanisms: The main mechanisms that mediate DR neurodegeneration are the accumulation of extracellular excitotoxic glutamate (Glu), increased oxidative stress, decreased protective factor of the retina, and chronic inflammation. Schellin SA et al. found by light and electron microscopy that the early Muller nuclei of DM have occurred. Changes, but retinal vascular endothelial cells, pericytes did not show obvious pathological changes, the ultrastructural and physiological functions of DM early retinal Muller cells have changed, not only affecting neuronal dysfunction in early DM patients (expressed as visual sensitivity and color vision) The sensitivity decreases, the retinal oscillation potential b wave is abnormal, and it affects the progress of the whole DR. In the study of molecules that mediate DR neurodegeneration, we are more concerned with the molecules produced by Muller cells.

Glial cell maturation factor beta (GMFB) and neurodegeneration: GMFB is the first 17kd acidic cytoplasmic protein isolated and purified from bovine brain. It is highly conserved in evolution and is mainly produced by astrocytes in the central nervous system. It plays an important role in the growth, differentiation and regeneration of brain tissue, and its expression is up-regulated during development and is significantly reduced in adulthood. The rat retinal GMFB is expressed only in Muller cells and is expressed from embryonic day 14 to adulthood. Recent studies have shown that GMFB is a pro-inflammatory factor that is closely related to human central nervous system degenerative diseases such as Alzheimer's disease and Parkinson's disease. GMFB knockout mice are resistant to experimental autoimmune encephalitis and the toxicity of MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine).

The cytokines currently used for DR progression include the following four categories: (1) factors that regulate natural immunity: IL-1b, IL-10; (2) factors that regulate lymphocyte activation and differentiation: IL-6 and IL -12; (3) factors related to activation of macrophages: TNFa and TGFb (4) chemokines, such as MCP-1, SDF-1, etc., there is no report on the role of GMFB in DR.

Summary of the invention

The object of the present invention is to provide an application of GMFB, a GMFB interfering agent and a GMFB interfering agent in order to overcome the drawbacks of the prior art described above.

The object of the present invention can be achieved by the following technical solutions:

The present invention found that GMFB is expressed in the ganglion cell layer, the inner nuclear layer, and the retinal pigment epithelial cell layer of the rat retina, and the GMFB content can be detected in the vitreous on the first day of STZ-induced diabetes (DM) elevation of blood glucose. High, lasting until the fourth week, then gradually decreasing, can be used as a biomarker to detect the pathogenesis of DR. GMFB treatment of rat Muller cells (glial cells of the retina) caused a decrease in glutamine synthetase content, resulting in impaired function of Muller cells; treatment of photoreceptor cell line 661w with GMFB induced autophagy; subretinal injection in normal SD rats 3*10^6gc AAV2/8-GMFB virus, 6 weeks after injection, ERG amplitude decreased, the retinal nucleus thinned, photoreceptor cells were lost, and ganglion cells were apoptotic. This finding confirms for the first time that GMFB is up-regulated early in DR and mediates neuroretinal degeneration. On the first day of STZ-induced DR, ERG detection can find a decrease in b-wave amplitude, suggesting visual impairment. It may be related to the damage of the neural retina caused by oxidative stress caused by hyperglycemia. After 4 weeks of subretinal injection of 3*10^6gc AAV2/8-shGMFB, the B wave of ERG was increased compared with the empty virus group, suggesting that visual function was protected.

In a first aspect of the invention, the use of GMFB as a biomarker for early diagnosis and progression of diabetic retinopathy is provided.

The biomarker refers to detecting the content of vitreous GMFB to evaluate the progression of DR.

In a second aspect of the invention, the use of GMFB as a therapeutic target for diabetic retinopathy is provided, and a possible mechanism of GMFB-mediated retinal degeneration is provided, which can down-regulate the expression of GMFB protein in the retina of DR rats by interfering techniques, thereby protecting visual function .

In a third aspect of the present invention, a GMFB interfering agent is provided, wherein the GMFB interfering agent is a substance that interferes with GMFB activity or down-regulates GMFB expression, and the GMFB interfering agent is a chemically synthesized shGMFB, or a vector containing shGMFB, wherein shGMFB is a small hairpin GMFB oligonucleotide (small hairpin GMFB, shGMFB).

In a fourth aspect of the invention, there is provided the use of a GMFB interfering agent for the preparation of a pharmaceutical composition for preventing, ameliorating or treating diabetic retinopathy.

The present invention detects the content of vitreous GMFB in STZ-induced DM rats by ELISA, and finds that GMFB maintains a high level in the early stage of experimental DM rats to a high level until 4 weeks after onset, and then gradually decreases. It was then found that in STZ-induced type 1 diabetes (TIDM) rats, down-regulation of GMFB expression by RNA interference can inhibit glialization, down-regulate GFAP expression (glibative markers), and reduce inflammatory factor secretion. Protect visual function. However, AAV2/8-mediated overexpression of GMFB can cause apoptosis of ganglion cells and impair visual function. Finally, the in vitro GMFB treatment of Muller cells caused the toxic ability of Muller cells to transform glutamate, which was related to the decrease of glutamine synthase. 661w cells were treated with GMFB, causing autophagic death of photoreceptor cells. This indicates that GMFB can be used as a biomarker for the occurrence and development of DR, and GMFB can also be used as a target for early intervention of DR to protect visual function.

The present invention demonstrates for the first time that in STZ-induced type I diabetes mellitus (TIDM) rats, GMFB is significantly elevated in vitreous in the early stage of onset. It was confirmed for the first time that with the progression of DR, the content of GMFB gradually decreased, and DR progression could be detected dynamically. The expression of GMFB in the DR rats was confirmed for the first time, which could protect visual function. The mechanism by which GMFB mediates retinal degeneration is first demonstrated, including a decrease in glutamine synthase in Muller cells, resulting in ganglion cell death and induction of autophagy by photoreceptor cells.

Compared with the prior art, the present invention has the following advantages:

1) In the retina of DR rats, it was found that GMFB was expressed in the ganglion cell layer, the inner nuclear layer and the RPE layer, and the content of GMFB in the vitreous was significantly increased in the early stage of DR (the first day of blood glucose elevation);

2) Overexpression of GMFB in normal SD rats causes retinal degeneration. The mechanism of GMFB-mediated neurodegeneration was first confirmed, including the reduction of glutamine synthase in Muller cells, ganglion cell apoptosis and autophagic death of photoreceptor cells;

3) In the DR retina interferes with GMFB, the gliosis process is inhibited and the visual function is protected.

DRAWINGS

Figure 1: Expression of GMFB in different nuclear layers of DR;

Figure 2: Results of changes in GMFB concentration with the course of DR in the vitreous of STZ-induced TIDM rats;

Figure 3: Results of AAV2/8-shGMFB interference on the visual function of STZ-induced DR;

Figure 3a: shGMFB subretinal injection of DR rats, GMFB and GFAP changes;

Figure 3b: shGMFB subretinal injection of DR rats, B-wave results were detected by ERG at the fourth and sixth weeks after injection;

Figure 3c: shGMFB subretinal injection of DR rats, the expression of GFAP and GMFB were detected at the mRNA level at the fourth week after injection;

Figure 4: GMFB overexpression results;

Figure 4a: Changes in the outer layer of the skin after 6 weeks of AAV2/8-GMFB subretinal injection;

Figure 4b: Apoptosis of ganglion cells 6 weeks after AAV2/8-GMFB subretinal injection;

Figure 5: Effect of GMFB on Muller on glutamine synthase;

Figure 6: GMFB treatment 661w causes autophagy results.

detailed description

The invention will be described in detail below with reference to the drawings and specific embodiments.

In the following examples, 661w was purchased from ATCC and the medium was low sugar DMEM. The rMC-1 cell line was prepared in a laboratory with high glucose DMEM containing 10% serum and 1% P/S. The culture environment was 37 ° C, 5% CO ₂ and 95% air. The overexpression of GMFB was mediated by AAV2/8 as a vector, and the vector AAV2/8-GMFB was recorded. The interference vector mediated by AAV2/8 as a vector was recorded as AAV2/8-shGMFB. AAV2/8-shGMFB and AAV2/8-GMFB are commercially packaged viruses, purchased from Wuhan Vinos Biotechnology Co., Ltd., titer 10^9gc/ml, LC3 virus purchased from Hanheng Bio, rat GMFB ELISA The kit was purchased from elabscience.

Example 1

Expression of GMFB in different nuclear layers of diabetic retina

1. Preparation of diabetic rats: Male SD rats, 160-180 g, were used to starve the rats for 24 hours before the experiment. STZ (60mg/kg body weight) was injected intraperitoneally to induce DM. The normal control group was intraperitoneally injected with an equal volume of citric acid solution. After 24 hours, blood was taken from the tail and the blood glucose was lower than 250mg/dL. STZ. Blood glucose was measured for 3 consecutive days. Rats whose blood glucose exceeded 250 mg/dL for 3 consecutive days were identified as DM rats (rats with blood glucose below 250 mg/dL will be excluded). Although the preparation of DM rats, in the examination of ocular changes, at least two weeks, it has been detected that changes in the nerve retina, RPE, vascular endothelial cells, BRB, ERG, etc. support the retina has developed lesions, can be used as a DR model .

2. Real-time quantitative PCR detection of GMFB expression by laser microdissection samples:

Freshly obtained retinas at different time points were prepared, frozen sections were prepared, and the sections were directly attached to a laser-cut film and prepared according to the Leica laser-cut sample preparation method (Leica Laser microdissection (LMD) 6500). The slice thickness was 8 μm, and three sections of the inner nuclear layer, the outer nuclear layer, the ganglion cell layer, and the retinal pigment epithelial cell layer were collected in 0.5 ml of Trizol to extract total RNA. After reverse transcription and real-time quantitative PCR analysis, semi-quantitative methods were used.

The main steps are as follows:

1. Tissue obtained by laser cutting was collected in 0.5 ml Trizol lysate.

2. Then transfer to a 1.5 mL centrifuge tube, add one-fifth of the volume of chloroform, mix vigorously, and centrifuge at 12000 rpm for 15 minutes at 4 °C.

3. After centrifugation, transfer the supernatant to a new centrifuge tube, taking care not to take the intermediate protein layer, add an equal volume of isopropanol, add 1 ul of 20 ug/ml glycogen as the nucleic acid carrier, and ice bath for 20 minutes.

Centrifuge at 4.12000 rpm for 4 minutes at 4 ° C, discard the supernatant, and wash the pellet 1-2 times with 75% ethanol.

5. After the precipitate was dried at room temperature, it was dissolved in an appropriate amount of 8 ul of DEPC water.

RNA reverse transcription, the first strand of cDNA was obtained by Promega's M-MLV reverse transcriptase. The main steps are as follows:

1. First, 8 ul of RNA was mixed with 2 μL of Takara's reverse transcription reagent supermix, and then reverse transcription was performed at 37 degrees for 15 minutes and at 85 degrees for 5 seconds.

Primers are shown in Table 1 below.

Table 1 primers for detecting genes

Name	Forward	Reverse
			qRo-GAPDH	CCCCTTCATTGACCTCAACTACA	TCCCATTCTCAGCCTTGACTGT
qRo-GFAP	CCTTGACCTGCGACCTTGAG	CCTGTTCGCGCATTTGC
			qRo_GMFB	GATGATGTACGCTGGGAGTAAGAAC	GGTCTTCGGTGTTTCTTATTTCAAA

The reverse transcription system is shown in Table 2:

Table 2 reverse transcription system

Reagent	Dosage (μL)	Final concentration
			5×supermix	2	1×
Total RNA	8	50-100ng

Reverse transcription procedure: 15 minutes at 37 ° C, 5 seconds at 85 ° C, and then stored in a refrigerator at -20 ° C for later use.

Quantitative PCR

The first strand of cDNA obtained by reverse transcription of RNA was used as a template, and primers were designed as shown in Table 1. The SYBR Green real-time PCR assay kit from Tiangen was used to detect the expression of the target gene. The PCR amplification conditions were as follows: denaturation at 94 ° C for 10 minutes, entering a cycle (95 ° C for 5 sec, 60 ° C for 60 sec) for a total of 40 cycles, and collecting the dissolution profile.

The experimental results are shown in Figure 1, in which GCL, ganglion cell layer cell layer; INL, inner cell layer, inner layer; ONL, outer nuclear layer; RPE, retinal pigment epithelia, retinal pigment epithelial cells. It can be seen from Fig. 1 that in the normal control rat retina, GMFB expression is mainly in the ganglion cell layer, and on the first day of elevated blood glucose, the expression of the ganglion cell layer and the RPE cell layer is up-regulated, and during the onset of DM, GMFB is in the ganglion cell. The expression of layer and RPE cell layer was up-regulated, and the expression in the inner nuclear layer began to be up-regulated. At 2 weeks after DM onset, the expression of GMFB was down-regulated in the ganglion cell layer and RPE layer, and the expression in the inner and outer nuclear layers was gradually up-regulated, which was higher than that of DM. The expression of GMFB in the kernel layer.

Example 2

Changes in GMFB concentration in the vitreous of STZ-induced TIDM rats with DR course

The type I diabetes model was prepared by STZ. The method was as follows. The vitreous of diabetic rats was collected at different time points. 6-8 samples were collected at each time point and collected separately. 1000g was centrifuged at 4 degrees for 20 minutes and then transferred to supernatant. Standby, perform ELISA test, the results are shown in Figure 2, Figure 2, Cont is normal control, PI After injection for postinjection, DM is diabetes. As can be seen from Figure 2, on the first day of blood glucose elevation, GMFB was found to increase significantly, then decreased slightly, and remained at a high level, gradually decreasing from the fourth week, in DM. In the eighth week of onset, it fell to a level close to the normal camera. The elisa kit for rat GMFB was purchased from Elabscience (catalogue number E-EL-Ro419C) according to the kit instructions. The main steps include:

1. Sample collection: The rat vitreous was collected and centrifuged at 1000×g for 20 minutes, and the supernatant was taken for detection.

2. Preparation before testing:

(1) Remove the kit from the refrigerator 20 minutes in advance and equilibrate to room temperature. The concentrated washings were diluted with double distilled water (1:25).

(2) Standard preparation: Centrifuge at 10000×g for 1 minute, add 1.0 mL of standard & sample dilution to the lyophilized standard, tighten the tube cover, let stand for 10 minutes, and invert it upside down several times until it is fully dissolved. After that, gently mix it with a pipette (concentration: 1000 ng/mL). Then dilute the dilution as needed (Note: Do not directly dilute in the well). It is recommended to prepare the following concentrations: 1000, 500, 250, 125, 62.5, 31.25, 15.625, 0 ng/mL, and the standard & sample dilutions are directly used as blank wells of 0 ng/mL. For example, prepare 500ng/mL standard product: Take 0.5mL 1000ng/mL of the above standard product into EP tube containing 0.5mL standard & sample dilution solution, mix well, and the other concentrations are similar.

(3) Biotinylated antibody working solution: Calculate the amount required for the next experiment (in 100 μL/well) before the experiment, and prepare 100-200 μL in the actual preparation. Concentrated biotinylated antibody (1:100) was diluted to a working concentration with biotinylated antibody dilution 15 minutes prior to use. Used on the same day.

(4) Enzyme conjugate working solution: Calculate the amount required for the next experiment (in 100 μL/well) before the experiment, and prepare 100-200 μL in the actual preparation. The concentrated HRP enzyme conjugate (1:100) was diluted to the working concentration with the enzyme conjugate dilution 15 minutes before use. Used on the same day.

3. Operation steps:

Before the start of the experiment, each reagent should be equilibrated to room temperature; when preparing the reagent or sample, mix thoroughly and avoid foaming as much as possible.

1. Loading: Set blank holes, standard holes, and sample holes to be tested. Add 100 μL of standard wells and sample dilution solution to the blank wells, add 100 μL of standard or sample to be tested, and take care not to have air bubbles. Add the sample to the bottom of the plate when adding the sample, try not to touch the hole wall, and gently shake the mixture. uniform. The plate was plated and incubated at 37 ° C for 90 minutes. To ensure the validity of the results, use a new standard solution for each experiment.

2. Discard the liquid, dry it, and do not wash it. 100 μL of biotinylated antibody working solution (prepared within 15 minutes before use) was added to each well, and the plate was coated with a membrane and incubated at 37 ° C for 1 hour.

3. Discard the liquid in the well, dry it, wash the plate 3 times, soak for 1-2 minutes each time, about 350 μL/well, dry and pat dry on the absorbent paper to pat dry the liquid in the well.

4. Add 100 μL of each well to the enzyme conjugate working solution (prepared within 15 minutes before use), add the membrane, and incubate at 37 ° C for 30 minutes.

5. Discard the liquid in the well, dry it, and wash the plate 5 times. The method is the same as step 3.

6. Add 90 μL of substrate solution (TMB) per well, incubate the plate and incubate at 37 °C for 15 minutes in the dark (depending on the actual coloration, shorten or extend as appropriate, but not more than 30 minutes. When the standard hole appears obvious When the gradient is over, it can be terminated).

7. Add 50 μL of stop solution to each well to stop the reaction, at which time the blue color turns yellow. The order of addition of the stop solution should be as close as possible to the order in which the substrate solution is added.

8. Immediately measure the optical density (OD value) of each well at a wavelength of 450 nm using a microplate reader. The microplate reader should be turned on in advance, preheat the instrument, and set up the test procedure.

Example 3

Interfering with GMFB improves visual function in DR rats

1. A rat model of type I diabetes was prepared in the same manner as in Example 1.

On the day of STZ-TIDM rat disease (the first day after the rat's blood glucose concentration exceeded 250 mg/dL for 3 consecutive days), AAV2/8-shGMFB3ul was injected into the subretinal space, and GFAP immunofluorescence was detected 4 weeks after the injection, suggesting that the gel was applied. Qualification is inhibited. The effect of AAV2/8-shGMFB interference on the visual function of STZ-induced DR is shown in Figure 3.

Results See Figure 3a, in which the retinal interference of GMFB in DR rats decreased the expression of glial fibrillary acidic protein (GFAP). 4',6-diamidino-2-phenylindole (DAPI) is a fat-soluble fluorescent dye that stains the nucleus; Zsgreen is a green label, RPE is a retinal pigment epithelial cell, and ONL is the outer nuclear layer. INL is the inner nuclear layer, GCL is the ganglion cell layer, and merge is overlapping, overlapping green fluorescence, red fluorescence and blue fluorescence.

The results are shown in Figure 3b. ERG detection showed an increase in b-waves 4 weeks after interference with GMFB virus after injection, suggesting quantitative statistics of visual function improvement.

The results are shown in Figure 3c. Four weeks after the interference with GMFB virus after injection, the expression of GFAP and GMFB was significantly decreased by quantitative PCR at the mRNA level, which was statistically different.

The RNA is extracted by the method of Trizol cleavage. The main steps are as follows:

1. Wash the cells 1-2 times with PBS buffer and add Trizol lysate in proportion (eg six-well plate) One well corresponds to 1 mL of lysate).

2. After the cells were off the wall, transfer to a 1.5 mL centrifuge tube, add one-fifth of the volume of chloroform, mix vigorously, and centrifuge at 12000 rpm for 15 minutes at 4 °C.

3. After centrifugation, transfer the supernatant to a new centrifuge tube, taking care not to take the intermediate protein layer, add an equal volume of isopropanol, and ice bath for 20 minutes.

Centrifuge at 4.12000 rpm for 4 minutes at 4 ° C, discard the supernatant, and wash the pellet 1-2 times with 75% ethanol.

5. After drying the precipitate at room temperature, dissolve it with an appropriate amount of DEPC water. Measure the concentration.

RNA reverse transcription, the first strand of cDNA was obtained by Promega's M-MLV reverse transcriptase. The main steps are as follows:

1. First, 1-2 μg of RNA was mixed with 2 μL of oligo d (T), placed in a 72 ° C water bath for 5 minutes, and immediately ice bathed for 2 minutes, then oligo d (T) was combined with the poly-A tail of RNA, slightly centrifuged. .

2. Add 1.25 μL of dNTP (10 μM), 1 μL of M-MLV reverse transcriptase and 0.5 μL of RNase inhibitor, and adjust the reaction volume to 25 μL with DEPC water. Leave in a 42 ° C water bath for 1 hour.

The reverse transcriptase was inactivated by placing at 70 ° C for 10 minutes. The obtained cDNA was single-stranded in a refrigerator at -20 °C.

The reverse transcription system is shown in Table 3:

Table 3 reverse transcription system

Reagent	Dosage (μL)	Final concentration
			5×M-MLV buffer	4	1×
dNTP (10μM)	0.75	0.375mM
			miRNA RT primer (1μM)	1.2	60nM
M-MLV	0.2	20U
			RNA	1	0.2-200ng
H 2 O	12.85

Reverse transcription procedure: 30 minutes at 16 ° C, 30 minutes at 42 ° C, and immediately after 5 minutes at 85 ° C for 5 minutes on ice. It can then be stored in a refrigerator at -20 ° C for use.

Quantitative PCR

The first strand of cDNA obtained by reverse transcription of RNA was used as a template, and primers were designed as in Table 1 of Example 1. Using Tiangen's SYBR Green real-time fluorescent quantitative PCR detection kit to detect the target gene Amount. The PCR amplification conditions were as follows: denaturation at 94 ° C for 10 minutes, entering a cycle (95 ° C for 5 sec, 60 ° C for 60 sec) for a total of 40 cycles, and collecting the dissolution profile.

ERG method: APS automatic visual electrophysiological tester (APS-2000) was purchased from Chongqing Kanghua Technology Co., Ltd. One day before the visual electrophysiological function test, the DM rats were transferred to a dark room for dark adaptation. I started doing it the next day. Rat preparation: Rats were intraperitoneally injected with 2% sodium pentobarbital (1 mL/500 g body weight) for anesthesia, 1×Shen Mianxin (0.1 ml/200 g) for eyeballs, and then a drop of 0.5% tropicamide Wuxi Shanhe Group (Jiangsu, China), a drop of 0.4% oxybuprocaine hydrochloride surface anesthesia (Eisai Co Ltd, Tokyo, Japan), each eye with a little conductive paste. Insert the electrode: the ground wire is connected to the tail of the rat, the negative electrode is connected between the two ears of the rat, and the positive electrode is connected to the cornea of both eyes. Be careful not to touch the eyelids and the sclera. Open the software "Visual Electrophysiological Map", click "FERG", then point 1, 2 channels, one for the left eye channel, the other for the right eye channel, the point "set", the stimulation frequency is 2 times, the stimulation frequency is 0.05Hz ; click stimulus intensity (1) - 0.0006325 (cd * s / m), (5) - 0.006325 (cd * s / m), (9) - 0.06325 (cd * s / m), each interval at least 2 min . Click “Oscilloscope”. When the baseline of the wave is stable, click “Acquisition”. After you hear the “嘀” sound, the acquisition is completed and click “Save”. Then click "Settings", modify the document number and stimulus intensity, and so on. After all the strengths have been done, replace one of the rats. After all the rats have finished, open the “File”, calibrate, double-click the curve, the curve turns white, click “Calibration”. After calibrating the a wave, press the space bar to calibrate the b wave. After all the calibrations are completed, click "Print" and save as .PDF format. Click the button in the lower left corner to exit the software, turn off the computer, and turn off the amplifier.

The results showed that the AAV2/8-shGMFB virus was tested for ERG in the subretinal injection of the virus at 4 and 6 weeks, and there was a significant difference 4 weeks after the injection, but there was no statistical difference at 6 weeks after the injection (Fig. 3b). It is suggested that GMFB interference can protect the visual function.

Intraocular injection:

Rats were anesthetized by intraperitoneal injection of 2% sodium pentobarbital (1 mL/400 g body weight) before injection, followed by a drop of 0.5% tropicamide (Wuxi Shanhe Group, Jiangsu, China), a drop of 0.4% opiate hydrochloride Due to topical anesthesia (Eisai Co Ltd, Tokyo, Japan).

In the subretinal injection, a 30-gauge needle was used to make a channel 2 mm behind the temporal sclera, then a 33-gauge needle (Lot #440602, Hamilton, Reno, NV) and a 5 μL microsyringe (P/ N:7634-01/00, Hamilton, Reno, NV) AAV2-CMV-hEPO was injected. If the injection is successful, a small vesicular structure can be seen on the fundus. After a few minutes, the retina becomes flat and the vesicles disappear. If the vitreous hemorrhage or crystal damage is excluded, the experiment is excluded.

Example 4

Overexpression of AAV2/8-GMFB in normal SD rats

3*10^6gc AAV2/8-GMFB was injected into the subretinal space of normal rats in the same manner as in Example 3. The retina was separated 6 h after injection, frozen sections were taken, and DAPI staining was performed, and the thickness of the nuclear layer was measured by Photoshop.

As a result, referring to Fig. 4a, the thickness of the nuclear layer was significantly thinner outside the virus injection zone, and the thickness of the nuclear layer was zero, which was the optic nerve head.

Results In Figure 4b, TUNEL staining was performed 6 weeks after virus injection and a positive apoptosis signal was found in the ganglion cell layer.

Retinal thickness measurement:

Frozen sections were subjected to DAPI staining for retinal thickness measurement and cell count analysis. Retinal thickness measurements were performed under a microscope at 400 magnification. The measurement was performed at a distance of 1 mm from the optic nerve head and on both sides of the optic papilla, including: (1) outer membrane-internal membrane (OLM-ILM); (2) outer membrane-arc cell layer (OLM-GCL); (3) outer nucleus Layer-outer mesh layer (ONL-OPL); (4) kernel layer (INL); (5) outer core layer (ONL). Five retinal sections were taken from each eyeball, with 4 rats in each group.

The main steps of the TUNEL test are as follows:

Apoptosis was detected using the In Situ Cell Death Detection Kit and the assay was performed according to the protocol provided in the kit. The positive control was performed by incubating the retina with Grade I DNase-I for 10 minutes at room temperature, and the negative control was only labeled with no enzyme solution. The sample was incubated at 37 ° C for 1 hour, washed 3 times with PBS, and directly observed under a fluorescence microscope (Nikon, Yokohama, Japan) with an excitation wavelength of 450-490 nm.

Example 5

GMFB treatment of Muller's effect on glutamine synthase;

The rat Muller cell line was cultured in DMEM-high glucose medium containing 10% serum and double antibody. The recombinant GMFB dry powder was dissolved in sterile PBS solution to a final concentration of 500 ug/ml. GMFB was added to serum-free DMEM-high glucose medium, cells were collected at different time points, total protein was extracted, and glutamine was extracted by ELISA. Detection of synthase (GS).

The results are shown in Figure 5. GMFB treated Muller cells for 8 hours, and the GS content decreased, and continued to decrease with the prolongation of treatment time. The extracted protein and ELISA method were the same as before.

Example 6

GMFB treatment of 661w cells causes autophagy

The mouse photoreceptor cell line was cultured in DMEM-low sugar medium containing 10% fetal bovine serum and double antibody, and RFP-GFP-LC3 adenovirus was purchased from Hanheng organism. 661w first infected with 661w with RFP-GFP-LC3 adenovirus (titer 10^10 pfu). One day after infection, 661 w was treated with serum-free medium containing GMFB. Referring to Figure 6, GMFB treatment for 661w4 hours, the cells began to appear red and green fluorescence, spotted, suggesting that LC3 translocated to the lysosomal membrane, suggesting autophagy, treatment for 8 hours, punctate fluorescence, autophagy Red-green fluorescence needs to be observed under a confocal microscope.

The above description of the embodiments is intended to facilitate the understanding and use of the invention by those skilled in the art. It will be apparent to those skilled in the art that various modifications can be readily made to these embodiments and the general principles described herein can be applied to other embodiments without the inventive work. Therefore, the present invention is not limited to the embodiments described above, and those skilled in the art should be able to make modifications and changes within the scope of the invention without departing from the scope of the invention.

Claims (9)

1. GMFB is used as a biomarker for early diagnosis and progression of diabetic retinopathy.
2. The use of GMFB according to claim 1 as a biomarker for early diagnosis and progression of diabetic retinopathy, characterized in that the content of GMFB in the vitreous increases with the continuation of the lesion time four weeks before the diabetic retinopathy. After four weeks of diabetic retinopathy, the content of GMFB in the vitreous decreased with the continuation of the lesion time.
3. The application of GMFB as a therapeutic target for diabetic retinopathy.
4. The use of GMFB according to claim 3 as a therapeutic target for diabetic retinopathy, characterized in that the mechanism by which GMFB mediates retinal degeneration is to cause a decrease in glutamine synthase in Muller cells.
5. The use of GMFB according to claim 3 as a therapeutic target for diabetic retinopathy, characterized in that the mechanism by which GMFB mediates retinal degeneration is caused by ganglion cell death.
6. The use of GMFB according to claim 3 as a therapeutic target for diabetic retinopathy, characterized in that the mechanism by which GMFB mediates retinal degeneration is to induce photoreceptor cells to cause autophagy.
7. A GMFB interfering agent, characterized in that the GMFB interfering agent is a substance that interferes with GMFB activity or down-regulates GMFB expression.
8. The GMFB interfering agent according to claim 7, wherein the GMFB interfering agent is a chemically synthesized shGMFB or a vector comprising shGMFB, wherein the shGMFB is a small hairpin GMFB oligonucleotide.
9. A use of a GMFB interfering agent for the preparation of a pharmaceutical composition for preventing, ameliorating or treating diabetic retinopathy.

Images