CN112195244A - Application of GMFB (GMFB) as hepatocyte liver cancer biomarker - Google Patents
Application of GMFB (GMFB) as hepatocyte liver cancer biomarker Download PDFInfo
- Publication number
- CN112195244A CN112195244A CN202011089719.9A CN202011089719A CN112195244A CN 112195244 A CN112195244 A CN 112195244A CN 202011089719 A CN202011089719 A CN 202011089719A CN 112195244 A CN112195244 A CN 112195244A
- Authority
- CN
- China
- Prior art keywords
- gmfb
- liver cancer
- reagent
- expression level
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57438—Specifically defined cancers of liver, pancreas or kidney
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/56—Staging of a disease; Further complications associated with the disease
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Urology & Nephrology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Pathology (AREA)
- Hematology (AREA)
- Analytical Chemistry (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Oncology (AREA)
- Cell Biology (AREA)
- Hospice & Palliative Care (AREA)
- General Physics & Mathematics (AREA)
- Wood Science & Technology (AREA)
- Pharmacology & Pharmacy (AREA)
- Genetics & Genomics (AREA)
- Veterinary Medicine (AREA)
- Zoology (AREA)
- Food Science & Technology (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Biophysics (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
Abstract
The invention provides application of GMFB as a hepatocyte liver cancer biomarker, belonging to the technical field of cancer diagnosis and treatment. According to the invention, a large amount of sequencing data and clinical data in a TCGA database are taken as research objects, and the expression quantity of GMFB in a liver cell liver cancer patient population is subjected to statistical analysis, so that the GMFB is a liver cell liver cancer HCC significant differential expression gene, the GMFB is related to the onset of HCC, the GMFB is clearly related to the onset of HCC, and has stronger correlation with HCC grading and grading, and is also significantly related to the prognosis of HCC patients, especially male patients. The reagent for detecting the expression quantity of the GMFB is applied to the preparation of a kit for early diagnosis, grading and/or staging of the hepatocellular carcinoma or evaluation of prognosis of the hepatocellular carcinoma. The inhibition of the liver cell liver cancer cell transfer is realized by inhibiting the expression of GMFB, so the GMFB can be applied to the preparation of the medicines for preventing and/or treating liver cell cancer.
Description
Technical Field
The invention belongs to the technical field of diagnosis and treatment of cancers, and particularly relates to application of GMFB (GMFB) as a hepatocyte liver cancer biomarker.
Background
Primary liver cancer is one of the most common malignant tumors in the world and has the characteristics of rapid growth and strong invasiveness. Wherein the hepatocellular carcinoma (HCC, LIHC) accounts for 75-90% of the primary hepatocellular carcinoma. Hepatocellular carcinoma is often secondary to chronic diseases, including chronic hepatocellular carcinoma such as hepatitis B, and systemic diseases such as obesity and metabolic syndrome. The high morbidity and mortality of the liver cell cancer brings huge financial and social burden to China.
Hepatocellular carcinoma is often associated with poor prognosis due to lack of sensitive early detection methods, with a 5-year survival rate of less than 5%. At present, according to the monitoring guidelines for early diagnosis of HCC, serum alpha-fetoprotein (AFP) is mainly used clinically for early diagnosis of HCC. However, AFP is not ideal for HCC specificity or sensitivity. Approximately 40% of HCC patients have normal AFP levels, and especially for early HCC, the AFP detection is not sensitive enough. It has also been found that the AFP level is also elevated in some patients with chronic hepatitis and cirrhosis in the clinic, and the specificity of AFP detection is not ideal enough. Therefore, there is an urgent need to find one or more markers to aid in the early diagnosis of HCC.
GMFB (collagen differentiation factor beta) is a colloid cell maturation factor with actin depolymerizing factor homology (ADF-H). The genes for this GMFB are highly conserved from yeast to mammals during evolution. Meanwhile, the protein is generally expressed, but is mainly enriched in brain tissues and participates in various biological activities such as chemotaxis, endocytosis, cell adhesion and the like of cells. At present, the research on GMFB and liver cell cancer is not available.
Disclosure of Invention
In view of the above, the present invention aims to provide a new application of GMFB protein as a hepatocyte liver cancer biomarker.
The invention provides application of a reagent for detecting the expression quantity of a hepatocyte liver cancer biomarker in preparing a kit for early diagnosis of hepatocyte liver cancer, wherein the hepatocyte liver cancer biomarker is GMFB.
Preferably, the reagent for detecting the expression level of the hepatocyte liver cancer biomarker comprises a reagent for detecting the RNA expression level of GMFB and/or a reagent for detecting the protein expression level of GMFB;
when the RNA expression level of GMFB was measured, a TPM value (Transcripts Per Million mapping reads Per kilobase transcription) of GMFB higher than 12.07 indicates that the patient is at risk for hepatocellular carcinoma.
The invention provides application of a reagent for detecting the expression quantity of a hepatocyte liver cancer biomarker in preparation of a kit for grading and/or staging hepatocyte liver cancer, wherein the hepatocyte liver cancer biomarker is GMFB.
Preferably, the reagent for detecting the expression level of the hepatocyte liver cancer biomarker comprises a reagent for detecting the RNA expression level of GMFB and/or a reagent for detecting the protein expression level of GMFB.
Preferably, when the reagent for detecting the RNA expression level of GMFB is used for the liver cancer stage of the liver cells, the median of the TPM value of the GMFB in the sample at the first stage is 11.056; the median of the TPM value of GMFB in the second stage sample is 11.233; the median of the TPM value of GMFB in the sample of the third stage is 12.515.
Preferably, the reagent for detecting the RNA expression level of GMFB is used in the classification of liver cancer of liver cells, and the median of the TPM value of GMFB in the sample of the first grade is 10.824; the median of the TPM value of GMFB in the sample of the second stage is 11.684; the median of the TPM value of GMFB in the sample of the third stage is 13.588.
The invention provides application of a reagent for detecting the expression quantity of a hepatocyte liver cancer biomarker in preparing a kit for evaluating prognosis of hepatocyte liver cancer, wherein the hepatocyte liver cancer biomarker is GMFB.
Preferably, the evaluation subject of the prognosis of the hepatocellular carcinoma comprises a male patient;
the reagent for detecting the expression level of the hepatocyte liver cancer biomarker comprises a reagent for detecting the RNA expression level of GMFB and/or a reagent for detecting the protein expression level of GMFB.
The invention provides application of a reagent for inhibiting the expression of a hepatocyte liver cancer biomarker in preparing a medicament for preventing and/or treating hepatocyte liver cancer, wherein the hepatocyte liver cancer biomarker is GMFB.
The invention provides application of a reagent for inhibiting the expression of a hepatocyte liver cancer biomarker in preparing a medicament for inhibiting the invasion capacity of hepatocyte liver cancer cells, wherein the hepatocyte liver cancer biomarker is GMFB.
The reagent for detecting the expression level of the hepatocyte liver cancer biomarker is applied to the preparation of a kit for early diagnosis of hepatocyte liver cancer, and the hepatocyte liver cancer biomarker is GMFB. According to the invention, a large amount of sequencing data and clinical data in a TCGA database are taken as research objects, and the expression quantity of GMFB in HCC patient groups is counted, and the result shows that GMFB is a significant differential expression gene of hepatocellular carcinoma, and the GMFB is related to the onset of HCC, so that the GMFB can be used for assisting the early diagnosis of the hepatocellular carcinoma. Meanwhile, since the TCGA database contains information on thirty kinds of tumors and detailed data of tens of thousands of samples, a large number of samples increase the reliability of analysis results.
Furthermore, the invention also specifically limits the RNA expression level of the GMFB to be used as a marker molecule for diagnosing the liver cancer of the liver cells. The statistical result shows that once the TPM of the GMFB in the liver tissue is higher than 12.07, the patient is very likely to suffer from the hepatocellular carcinoma, so that the early hepatocellular carcinoma can be jointly targeted to the morbidity of the hepatocellular carcinoma by combining other diagnostic means.
The invention provides application of a reagent for detecting the expression level of a hepatocyte liver cancer biomarker in preparation of a kit for grading and/or staging hepatocyte liver cancer, wherein the hepatocyte liver cancer biomarker is GMFB. By analyzing the expression quantity of GMFB in different grades and stages of HCC in the TCGA database, the invention makes clear that GMFB not only is relevant to the morbidity of HCC, but also has stronger relevance to the grades and stages of HCC. Meanwhile, since the TCGA database contains information on thirty kinds of tumors and detailed data of tens of thousands of samples, a large number of samples increase the reliability of analysis results.
Furthermore, the invention specifically defines the judgment standard of grading and staging of the liver cell and the liver cancer, the grading and staging of GMFB and HCC show obvious positive correlation, and the grading and staging of patients can be judged clinically according to the median: in the course of staging of hepatocellular carcinoma, samples from 50 normal populations, 168 stage 1, 84 stage 2, 82 stage3 and six stage4 were used, with median GMFB TPM 6.04, 11.056, 11.233, 12.515 and 12.812, respectively. In the process of grading liver cancer, samples of 50 normal people, samples of 54 grade 1, samples of 173 grade 2, samples of 118 grade 3 and samples of 12 grade 4 are used, and the median of GMFB TPM is 6.04, 10.824, 11.684, 13.588 and 9.358 respectively. Of these, stage4 and grade 4 were not statistically significantly different because the number of cases was small as the patients entered the terminal stage.
The invention provides application of a reagent for detecting the expression quantity of a hepatocyte liver cancer biomarker in preparing a kit for evaluating prognosis of hepatocyte liver cancer, wherein the hepatocyte liver cancer biomarker is GMFB. The invention analyzes the prognosis of different expression levels of GMFB of HCC patients in a TCGA database, and the result shows that the expression level of the GMFB is obviously related to the prognosis of the HCC patients. Meanwhile, since the TCGA database contains information on thirty kinds of tumors and detailed data of tens of thousands of samples, a large number of samples increase the reliability of analysis results.
Furthermore, the invention particularly defines that the prognosis evaluation about the liver cell liver cancer is more applicable to male patients. The range of probe expression in the data was 434-5082, and the CUTOFF value used in the assay was 1481. Median survival in low expressing patients was 82.9 months and median survival in high expressing patients was 46.2 months, the difference was statistically significant (P ═ 0.0042). Analysis of 246 male patients showed that the expression level of GMFB was significantly correlated with the prognosis of male patients. The range of probe expression in the data was 434-5082, and the CUTOFF value used in the assay was 1958. Median survival for low expressing patients was 84.7 months and median survival for high expressing patients was 36.3 months, with the difference statistically significant (P ═ 0.00014). Therefore, the GMFB has great application value to the liver cell cancer, especially in male patients.
The invention provides application of a reagent for inhibiting the expression of a hepatocyte liver cancer biomarker in preparing a medicament for preventing and/or treating hepatocyte liver cancer or inhibiting the invasion capacity of hepatocyte liver cancer cells, wherein the hepatocyte liver cancer biomarker is GMFB protein. The results of Transwell experiments prove that the invasion capacity of hepatoma cells can be obviously reduced by knocking down GMFB. Therefore, GMFB is a potential therapeutic target for use in the prevention and/or treatment of hepatocellular carcinoma.
Drawings
FIG. 1 shows the result of high expression of GMFB in various cancers including hepatocellular carcinoma;
fig. 2 shows that both median survival and overall survival of GMFB highly expressed hepatocellular carcinoma patients are significantly lower than those of GMFB lowly expressed hepatocellular carcinoma patients, and have statistical significance (P ═ 0.00017);
FIG. 3 shows the significant correlation between GMFB and the prognosis of a patient with hepatocellular carcinoma in men; in the male liver cell cancer patient, the median survival month number of GMFB low expression is 84.7, and the median survival month number in the high expression group is 36.3;
FIG. 4 shows the results of significant correlation between GMFB expression level and hepatocellular carcinoma grading;
FIG. 5 shows the significant correlation between the expression level of GMFB and the clinical stage of hepatocellular carcinoma;
FIG. 6 shows the results of a Transwell Invasion experiment, wherein FIG. 6A shows the result of knocking down GMFB at the RNA level and FIG. 6B shows the result of knocking down GMFB at the protein level; FIG. 6C shows the crystal violet staining results, and FIG. 6D shows the statistical analysis of the crystal violet staining results of Si-scramble and Si-GMFB.
Detailed Description
The invention provides application of a reagent for detecting the expression quantity of a hepatocyte liver cancer biomarker in preparing a kit for early diagnosis of hepatocyte liver cancer, wherein the hepatocyte liver cancer biomarker is GMFB.
In the present invention, the reagent for detecting the expression level of the hepatocyte liver cancer biomarker preferably comprises a reagent for detecting the RNA expression level of GMFB and/or a reagent for detecting the protein expression level of GMFB. When the RNA expression level of the GMFB is detected, the TPM value of the GMFB is higher than 12.07, or the expression level is higher than the value of two times of a normal patient, the patient is indicated to have the risk of liver cell cancer. Means for RNA expression level of liver cancer tissue preferably include RT-qPCR or RNA sequencing (e.g., commercialized products such as Illumina HiSeq 2000). The reagent for the RT-qPCR method detection is not particularly limited, and a primer is designed by taking cDNA which is known in the field and aims at GMFB as a template, for example, qhGMFB-Fw: CGCCGTGCCATTCTTAAAG (SEQ ID NO:3), qhGMFB-Rv: CGAAACTTTCTCAGCTTTTCCAC (SEQ ID NO: 4). The RNA sequencing is preferably carried out by using a commercial product such as Illumina HiSeq 2000.
The invention provides application of a reagent for detecting the expression quantity of a hepatocyte liver cancer biomarker in preparation of a kit for grading and/or staging hepatocyte liver cancer, wherein the hepatocyte liver cancer biomarker is GMFB.
In the present invention, the reagent for detecting the expression level of the hepatocyte liver cancer biomarker preferably comprises a reagent for detecting the RNA expression level of GMFB and/or a reagent for detecting the protein expression level of GMFB. The reagent for detecting the RNA expression level of the GMFB is preferably used for the liver cancer stage of the liver cells, and the median of the TPM value of the GMFB in the sample at the first stage is 11.056; the median of the TPM value of GMFB in the second stage sample is 11.233; the median of the TPM value of GMFB in the sample of phase three is 12.515; the median of the TPM value of GMFB in the sample of the fourth stage is 12.812. When the reagent for detecting the RNA expression level of the GMFB is preferably used in the classification of the hepatocellular carcinoma, the median of the TPM value of the GMFB in the sample of the first grade is 10.824; the median of the TPM value of GMFB in the sample of the second stage is 11.684; the median of the TPM value of GMFB in the sample of the third stage is 13.588; the median of the TPM value of GMFB in the fourth level sample is 9.358. Of these, stage4 and grade 4 were not statistically significantly different because the number of cases was small as the patients entered the terminal stage.
The invention provides application of a reagent for detecting the expression quantity of a hepatocyte liver cancer biomarker in preparing a kit for evaluating prognosis of hepatocyte liver cancer, wherein the hepatocyte liver cancer biomarker is GMFB.
In the present invention, the subject to be evaluated for the prognosis of hepatocellular carcinoma preferably includes a male patient. The statistical analysis is carried out on all the samples of the male patients, and the result shows that the lower the GMFB expression level is, the longer the median survival time and the final survival time of the patients are, and the difference is very obvious. The reagent for detecting the expression level of the hepatocyte liver cancer biomarker comprises a reagent for detecting the RNA expression level of GMFB and/or a reagent for detecting the protein expression level of GMFB.
The invention provides application of a reagent for inhibiting the expression of a hepatocyte liver cancer biomarker in preparing a medicament for preventing and/or treating hepatocyte liver cancer or inhibiting the invasion capacity of hepatocyte liver cancer cells, wherein the hepatocyte liver cancer biomarker is GMFB. According to the invention, the invasion capacity of the HEP3B cell can be obviously reduced after the GMFB is knocked down, which indicates that the GMFB can be used as a treatment target spot of the liver cell cancer, and the liver cell cancer cell metastasis is inhibited, thereby achieving the purpose of treating the liver cell cancer. The agent for inhibiting the expression of the hepatocyte liver cancer biomarker preferably comprises an agent for inhibiting the RNA expression level of GMFB and/or an agent for inhibiting the protein expression level of GMFB. The means for inhibiting the expression of the hepatocyte liver cancer biomarker comprises an RNA interference method. The reagent for inhibiting the expression of the hepatocyte liver cancer biomarker comprises a reagent capable of interfering the RNA transcription of GMFB or the protein translation thereof, such as interfering RNA or a substrate competitive inhibitor and the like.
The application of GMFB as a hepatocyte liver cancer biomarker is described in detail with reference to the following examples, but they should not be construed as limiting the scope of the present invention.
Example 1
GMFB TPM (Transcripts Per Million) analysis was performed on RNA-seq data of hepatocellular carcinoma tissues of 50 normal persons and 371 patients with whole hepatocellular carcinoma in the TCGA database using the UALCAN website (http:// UALCAN. path. uab. edu/index. html.) [ see documents 1,2,3 ].
The result shows that the GMFB is highly expressed in the liver cell and liver cancer tissue. The GMFB TPM median of the normal population is 6.04, the upper quartile is 8.012, and the lower quartile is 5.021. The GMFB TPM group of the hepatoma patients has a median of 12.07, an upper quartile of 17.524 and a lower quartile of 8.123. The Student's t test shows that the difference is statistically significant (P1.62436730732907E-12), so the RNA expression level of the GMFB can be used as a marker molecule for diagnosing the hepatocellular carcinoma, and once the TPM of the GMFB in liver tissues is higher than 12.07, the patient is very likely to suffer from the hepatocellular carcinoma.
FIG. 1 shows that GMFB is highly expressed in various cancers including hepatocellular carcinoma, so the RNA expression level of GMFB can be used as a marker molecule for diagnosis of hepatocellular carcinoma.
Example 2
The prognosis of different expression levels of GMFB from 364 patients with hepatocellular carcinoma in the TCGA database was analyzed using Kaplan-Meier Plotter (https:// kmplot. com/analysis /) [ see reference 4 ].
The amount of GMFB expression was significantly correlated with the prognosis of HCC patients. The expression range of the probes in the data was 434-5082, and the CUTOFF value used in the analysis was 1481. Median survival in low expressing patients was 82.9 months and median survival in high expressing patients was 46.2 months, the difference was statistically significant (P ═ 0.0042). Then, 246 male patients were analyzed. The expression level of GMFB was found to have a more significant correlation with the prognosis of male patients. The expression range of the probes in the data was 434-5082, and the CUTOFF value used in the analysis was 1958. Median survival for low expressing patients was 84.7 months and median survival for high expressing patients was 36.3 months, with the difference statistically significant (P ═ 0.00014). Therefore, the GMFB has great application value to the liver cell cancer, especially in male patients.
Fig. 2 shows that both median survival and overall survival of GMFB-highly expressed hepatocellular carcinoma patients are significantly lower than those of GMFB-lowly expressed hepatocellular carcinoma patients, and have statistical significance (P ═ 0.0042), so that GMFB is significantly correlated with prognosis of hepatocellular carcinoma patients, and can be used as a marker factor for hepatocellular carcinoma prognosis.
The result of fig. 3 shows that GMFB is significantly correlated with the prognosis of the patient with the male hepatocellular carcinoma and can be used as a marker factor for the prognosis of the male hepatocellular carcinoma. In the male liver cell cancer patient, the median survival month number of the GMFB low expression is 84.7, and the survival month number of the GMFB high expression group is 36.3.
Example 3
TPM analysis of GMFB in different grades and stages of hepatocellular carcinoma in TCGA database was performed using UALCAN website (http:// UALCAN. path. uab. edu/index. html).
In the process of analyzing the stage of the hepatocellular carcinoma, samples of 50 normal people, 168 stage 1, 84 stage 2, 82 stage3 and six stage4 are randomly selected, and the median of GMFB TPM is 6.04, 11.056, 11.233, 12.515 and 12.812 respectively. In the process of grading and analyzing the hepatocellular carcinoma, a sample of 50 normal people, a sample of 54 grade 1, a sample of 173 grade 2, a sample of 118 grade 3 and a sample of 12 grade 4 are randomly selected, and the median of GMFB TPM is 6.04, 10.824, 11.684, 13.588 and 9.358 respectively. Of these, stage4 and grade 4 were not statistically significantly different because the number of cases was small as the patients entered the terminal stage.
Fig. 4 and fig. 5 show that the expression level of GMFB is significantly related to the grade and clinical stage of hepatocellular carcinoma, i.e., GMFB can be used as a marker molecule for clinical grade and stage of hepatocellular carcinoma patients. The invention makes clear that GMFB is not only relevant to the onset of HCC, but also shows obvious positive correlation with the grading and the stage of HCC, and the grading and the stage of a patient can be judged according to median in clinic.
Example 4
HEP3B cells knocked-down for GMFB expression (purchased from ATCC,
HB-8064TM) TRANSWELL experiments are used for verifying the influence of GMFB on the invasion capacity of hepatoma cells. The specific procedure was carried out at 37 ℃ with 5% CO2And culture environment of 95% air the culture of HEP3B cells was performed on high-glucose DMEM medium containing 10% serum. Designing primers of si-GMFB, wherein the forward sequence: GCCGAAGAUUAGUGGAAAdTdT (SEQ ID NO: 1); reverse sequence: UUCCACUUAAAUCUUCGGCTdT (SEQ ID NO: 2). Knockdown efficiency was measured using LIPO2000 routine transfection 48 hours after transfection using RT-qPCR and western blot, respectively [ see references 5,6]. Matrigel gel was dissolved overnight in a 4 ℃ freezer and diluted with serum-free high-sugar DMEM stored in a 4 ℃ freezer. 100 μ l was dropped into the upper chamber of a 24-well transwell and incubated at 37 ℃ for 6 h. The gel was gently rinsed with serum free high sugar medium using a 200 μ l pipette. Cells from the control group (scrambletransfection for 24h) and the experimental group (HEP 3B transfection for 24h from Si-GMFB) were discarded in culture medium, washed 3 times with PBS, cell suspension was obtained by trypsinization, centrifuged and resuspended in serum-free high-sugar DMEM. Cell number was determined using COUNTSTAR at 5X 105cells/ml 200. mu.l of cell suspension was added to TRANSWELL in the upper chamber. The lower chamber of TRANWELL was charged with 1ml of high glucose DMEM containing 10% serum. The culture was returned to the incubator and continued for 24 hours. The remaining non-invasive cells on the upper chamber were gently wiped off with a cotton swab. Take out tCells were fixed with-20 ℃ pre-chilled methanol for 10min in ranswells, washed three times with PBS, 1ml of 0.1% crystal violet solution was added to each well, the chamber was placed in it, removed after 10min, and rinsed three times with PBS. 4 visual fields of upper, lower, left and right sides are taken for photographing and analysis.
Figure 6A demonstrates the knockdown of GMFB at the RNA level and figure 6B demonstrates the knockdown of GMFB at the protein level. In HEP3B cells, the knockdown of GMFB remarkably reduces the invasion capacity of the cells, and the GMFB is proved to be a potential target point for treating liver cancer of liver cells.
From the above examples, it can be seen that GMFB has high expression level of RNA and protein level in patients with hepatocellular carcinoma, and the expression level thereof has a positive correlation with the disease classification and staging. In addition, the prognosis of the liver cancer patient with low GMFB expression is obviously better than that of the patient with high GMFB expression, and the difference is especially obvious in male patients. Meanwhile, the invention also verifies that the invasion capacity of cancer cells can be obviously inhibited by reducing the expression quantity of the GMFB gene of the hepatocellular carcinoma, so that the GMFB can be used as a potential target spot for treating the hepatocellular carcinoma.
Reference to the literature
1.Zubair,H.,et al.,Proteomic Analysis of MYB-Regulated Secretome Identifies Functional Pathways and Biomarkers:Potential Pathobiological and Clinical Implications.J Proteome Res,2020.19(2):p.794-804.
2.Zhang,X.,et al.,Peroxiredoxins and Immune Infiltrations in Colon Adenocarcinoma:Their Negative Correlations and Clinical Significances,an In Silico Analysis.J Cancer,2020.11(11):p.3124-3143.
3.Zhou,Z.,et al.,High SET Domain Bifurcated 1(SETDB1)Expression Predicts Poor Prognosis in Breast Carcinoma.Med Sci Monit,2020.26:p.e922982.
4.Zhao,S.F.,et al.,Biglycan as a potential diagnostic andprognostic biomarker in multiple human cancers.Oncol Lett,2020.19(3):p.1673-1682.
5.Wong,M.L.and J.F.Medrano,Real-time PCR for mRNA quantitation.Biotechniques,2005.39(1):p.75-85.
6.Taylor,S.C.and A.Posch,The design of a quantitative western blot experiment.Biomed Res Int,2014.2014:p.361590.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> university of Tongji
Application of <120> GMFB as hepatocyte liver cancer biomarker
<150> 202010971718.0
<151> 2020-09-16
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gccgaagauu uaguggaaat t 21
<210> 2
<211> 21
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
uuuccacuaa aucuucggct t 21
<210> 3
<211> 19
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cgccgtgcca ttcttaaag 19
<210> 4
<211> 23
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cgaaactttc tcagcttttc cac 23
Claims (10)
1. The application of a reagent for detecting the expression level of a hepatocyte liver cancer biomarker in preparing a kit for early diagnosis of hepatocyte liver cancer, wherein the hepatocyte liver cancer biomarker is GMFB.
2. The use of claim 1, wherein the reagent for detecting the expression level of the hepatocyte liver cancer biomarker comprises a reagent for detecting the RNA expression level of GMFB and/or a reagent for detecting the protein expression level of GMFB;
when the RNA expression level of GMFB is detected, the TPM value of the GMFB is higher than 12.07, which indicates that the patient is at risk of suffering from hepatocellular carcinoma.
3. The application of a reagent for detecting the expression level of a hepatocyte liver cancer biomarker in preparing a kit for grading and/or staging hepatocyte liver cancer, wherein the hepatocyte liver cancer biomarker is GMFB.
4. The use of claim 3, wherein the reagent for detecting the expression level of the hepatocyte liver cancer biomarker comprises a reagent for detecting the RNA expression level of GMFB and/or a reagent for detecting the protein expression level of GMFB.
5. The use according to claim 4, wherein the agent for detecting the RNA expression level of GMFB has a median TPM value of 11.056 in the sample of the first stage when it is used in the hepatocellular carcinoma stage; the median of the TPM value of GMFB in the second stage sample is 11.233; the median of the TPM value of GMFB in the sample of the third stage is 12.515.
6. The use according to claim 4, wherein the agent for detecting the RNA expression level of GMFB is used in the grading of hepatocellular carcinoma, the median TPM value of GMFB in the sample of the first stage is 10.824; the median of the TPM value of GMFB in the sample of the second stage is 11.684; the median of the TPM value of GMFB in the sample of the third stage is 13.588.
7. The application of a reagent for detecting the expression level of a hepatocyte liver cancer biomarker in the preparation of a kit for evaluating the prognosis of hepatocyte liver cancer, wherein the hepatocyte liver cancer biomarker is GMFB.
8. The use according to claim 7, wherein the subject to be evaluated for the prognosis of hepatocellular carcinoma comprises a male patient;
the reagent for detecting the expression level of the hepatocyte liver cancer biomarker comprises a reagent for detecting the RNA expression level of GMFB and/or a reagent for detecting the protein expression level of GMFB.
9. The application of a reagent for inhibiting the expression of a hepatocyte liver cancer biomarker in the preparation of a medicament for preventing and/or treating hepatocyte liver cancer, wherein the hepatocyte liver cancer biomarker is GMFB.
10. The application of the reagent for inhibiting the expression of the hepatocyte liver cancer biomarker in the preparation of the medicine for inhibiting the invasion capacity of the hepatocyte liver cancer cells, wherein the hepatocyte liver cancer biomarker is GMFB.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2020109717180 | 2020-09-16 | ||
| CN202010971718 | 2020-09-16 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112195244A true CN112195244A (en) | 2021-01-08 |
| CN112195244B CN112195244B (en) | 2022-04-19 |
Family
ID=74010009
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011089719.9A Active CN112195244B (en) | 2020-09-16 | 2020-10-13 | Application of GMFB (GMFB) as hepatocyte liver cancer biomarker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112195244B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113759127A (en) * | 2021-08-18 | 2021-12-07 | 同济大学 | Application of GMFB (GMFB) as biomarker of insulin resistance |
| CN113917157A (en) * | 2021-09-30 | 2022-01-11 | 同济大学 | Application of GMFB in intervention of liver cirrhosis treatment targeting |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140087400A1 (en) * | 2011-05-11 | 2014-03-27 | Alper Biotech, Llp. | Diagnosis and prognosis of triple negative breast and ovarian cancer |
| CN105154527A (en) * | 2015-07-21 | 2015-12-16 | 同济大学 | Application of GMFB (glia maturation factor beta), GMFB disrupter and application of GMFB disrupter |
-
2020
- 2020-10-13 CN CN202011089719.9A patent/CN112195244B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140087400A1 (en) * | 2011-05-11 | 2014-03-27 | Alper Biotech, Llp. | Diagnosis and prognosis of triple negative breast and ovarian cancer |
| CN105154527A (en) * | 2015-07-21 | 2015-12-16 | 同济大学 | Application of GMFB (glia maturation factor beta), GMFB disrupter and application of GMFB disrupter |
Non-Patent Citations (1)
| Title |
|---|
| 陈新等: "胶质细胞成熟因子β在肝细胞癌中的表达及其临床意义", 《中国普通外科杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113759127A (en) * | 2021-08-18 | 2021-12-07 | 同济大学 | Application of GMFB (GMFB) as biomarker of insulin resistance |
| CN113759127B (en) * | 2021-08-18 | 2024-03-26 | 同济大学 | Application of GMFB as biomarker for insulin resistance |
| CN113917157A (en) * | 2021-09-30 | 2022-01-11 | 同济大学 | Application of GMFB in intervention of liver cirrhosis treatment targeting |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112195244B (en) | 2022-04-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210130905A1 (en) | Micro-rna biomarkers and methods of using same | |
| EP4218773A1 (en) | Human functional corneal endothelial cell and application thereof | |
| CN112195244B (en) | Application of GMFB (GMFB) as hepatocyte liver cancer biomarker | |
| CN111826466B (en) | Hepatitis B infected patient or carrier exosome miRNA molecular marker combination and screening kit | |
| Jiang et al. | Circulating UCA1 is highly expressed in patients with systemic lupus erythematosus and promotes the progression through the AKT pathway. | |
| CN107475386A (en) | Long-chain non-coding RNA mark for diagnosis and treatment osteosarcoma | |
| CN107312865A (en) | Purposes of the LOC100130111 in osteosarcoma diagnostic products, medicine is prepared | |
| CN108660211A (en) | A kind of and the relevant biomarker LINC01549 of hepatocellular carcinoma and its application | |
| Kleeberger et al. | microRNA-206 correlates with left ventricular function after transcatheter aortic valve implantation | |
| CN111154863B (en) | Application of lncRNA in preparation of product for diagnosing and/or treating osteoarthritis | |
| Wang et al. | MicroRNA-124 expression in Kupffer cells modulates liver injury by targeting IL-6/STAT3 signaling | |
| CN106974929A (en) | Purposes of the miR 647 in the medicine for preparing treatment stomach cancer | |
| CN108165546A (en) | A kind of miRNA biomarker, composition and application thereof | |
| CN113403390B (en) | Application of lncRNA in diagnosis and treatment of children myocarditis | |
| CN116240283B (en) | Application of OMA1 in reversing acute lymphoblastic leukemia drug resistance | |
| CN107365859A (en) | Molecular markers of the LncRNA as diagnosis and treatment osteosarcoma | |
| CN108728542A (en) | Detect the preparation and its application process of long-chain non-coding RNA BC200 | |
| CN116855608B (en) | Application of CITED1 in lung cancer diagnosis, treatment and prognosis prediction | |
| CN111235263B (en) | Target gene for diagnosis and treatment of osteoarthritis | |
| Zhu et al. | Exosome-derived circITGB1 regulates dendritic cell maturation and cardiac inflammation via miR-342-3p/NFAM1 | |
| CN111471767A (en) | L INC02154 and its application in preparing products for diagnosing lung cancer | |
| CN117025773A (en) | Marker for platinum drug resistance diagnosis of small cell lung cancer and application thereof | |
| CN112680525A (en) | Application of CA8 gene or protein as melanoma diagnosis marker | |
| CN117487913A (en) | Application of STOX1-A in diagnosis and treatment of liver cancer | |
| CN116622846A (en) | Peripheral blood circRNA biomarker for diffuse large B cell lymphoma diagnosis and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |