CN1051198A

CN1051198A - Recombinant growth factors

Info

Publication number: CN1051198A
Application number: CN90108420A
Authority: CN
Inventors: 罗伯特·约翰·穆尔
Original assignee: Pitman Moore Australia Ltd
Current assignee: Pitman Moore Australia Ltd
Priority date: 1989-10-11
Filing date: 1990-10-11
Publication date: 1991-05-08
Also published as: ZA908042B; WO1991005863A1

Abstract

The invention provides coding and have Urogastron or the bioactive proteic recombinant DNA of transforming growth factor, described recombinant DNA comprises the order of main order and at least one coding somatomedin.

Description

Recombinant growth factors

The present invention relates to recombinant growth factors and synthetic method thereof, relate in particular to and have the bioactive recombinant molecule of Urogastron.

Various polypeptide growth factor obtain by separating in the different mammals, and have broad spectrum of activity, and wherein Urogastron (EGF) and transforming growth factor (TGF α) have carried out research extensively and profoundly.

Urogastron relates to various active, and comprise promoting the intestines maturation, thereby stimulate the growth of young animal, and the healing of wound.

Moore and colleagues thereof (1982a, b; 1983) have found that Urogastron is a kind of wool agent of taking off very likely.

Behind the sheep injection M-EGF (mEGF), can make wool fiber become very soft, therefore be easy to the promptly manual whole wools (Moore etc., 1983) of removing.Adopt the labour cost of required costliness in the sheepshearing method that this method can expect to avoid traditional and the danger of injury sheep.But the amount of the Urogastron that purifying obtains from the mouse salivary gland is very limited, and expense is also too high.

In intestinal bacteria, produced the success of the method for M-EGF afterwards, promoted in the sheep body, to carry out a large amount of research (Allen etc., 1985 by recombinant means; 1987).

This method for preparing the M-EGF of recombinating is subjected to many restrictions.At first, in order to obtain the high-caliber expression of product in the stable cell, M-EGF need be prepared into the big fusion rotein of a part, because this product only contains 15% M-EGF approximately, all the other are non-Urogastron carrier proteins.Therefore, need to express the fusion rotein that non-M-EGF partly reduces.Controlling tac promotor-operon and having under the condition of TrpE ribosome bind site, prepare the Met Urogastron and surpass Urogastron 6 or the structures of 7 N ends, but detect less than expression, this is because the cause (Allen, private communication) that protein decomposes rapidly in the host bacteria.Secondly, fusion rotein must give cracking with special enzyme or chemical process.Although done all conscientious effort, to be attached to the order (Allen of contiguous Urogastron to the order of various cracking agent sensitivities, private communication), this enough effective and special technology is to use the Methionin specific proteases, but M-EGF itself can not changed chemically, this proof is very difficult, and enzyme can not be supplied with reliably.

Proved already that the fusion of TrpE-Urogastron had lost biological activity (consulting this specification sheets table 3), this explanation fusion rotein needs cracking.The work of having delivered proves that relevant somatomedin TGF α produces in vivo, and this is a kind of big precursor molecule.Its size is about 3 times of TGF α 1.Yet TGF α biological activity only is the 1-2% of free growth factor activity.This illustrates that similar big fusion may also lose biological activity (Brachmann etc., 1989) relatively.

With regard to taking off the wool method, the expense that the expense that adopts this method to produce M-EGF (rec-mEGF) reorganization or plasmid derivative is allowed far above the developing target market commodity.Other many research workers have also studied the method for producing the recombinant chou Urogastron (Oka etc. for example, 1985; Smith etc., 1982; Urdea etc., 1983; Sumi etc., 1985).Yet the expense of these methods is also all very high, and the price that is suitable for production per unit Urogastron in general can show and be higher than those products that take off the Urogastron that wool uses.

A known above-mentioned exception is a Japanese Patent 6240924, its claimed high-caliber expression, but in the document of obvious similar content (Oka etc. 1985), but reported low-level expression.Therefore, it seems that the method for this patent may only obtain the success of part.

The application of Urogastron is not limited to remove above-mentioned sheep's wool, also can be applicable to the depilation of other animals, for example can be used for gathering in the crops the hair of goat and rabbit, the hair of camellid is (as alpaca, no peak camel or vigone), and mane or other furs of before butchering, removing ox, deer and pig.

With transferring to children Mammals in age in the milk of Urogastron by parent, can play the effect that promotes the intestines physiological maturity.Young animal is used Urogastron can quicken its maturation, therefore can quicken early growth of piggy and other animals and wean ahead of time.Medically, the human epidermal growth factor can promote the healing of stomach ulcer, also can be used for the wound healing of skin and eyes.Aspect treatment of animals, also can similarly use, for example bite and after excising excessive loose skin the ulcer of the healing of the wound that can quicken to cause thus, especially horse or dog and the healing of wound for fear of greenbottle between sheep two legs.Somatomedin also can be used in the synthetic or semisynthetic medium of cell and tissue, is particularly useful for containing a small amount of serum or does not contain in the substratum of serum.

Molecule provided by the invention relates to Urogastron, but different with it on the structure, has similar biological activity basically, produces on a large scale but be easy to low cost.These features make this quasi-molecule be specially adapted to the treatment of some animal, can be extensive use of, but unit cost are very low.In addition, the present invention also provides the method that overcomes the problem that existed in the known in the past synthetic method, and can produce in a large number in recombinant host cell continuously.

Though the present invention highlights Urogastron, the homology of order explanation between Urogastron (EGF) and the transforming growth factor (TGF), the present invention also can be applicable to TGF, is interpreted as this and also belongs to scope of the present invention.

We have found that unexpectedly Urogastron can repeat the molecule generation to be connected, and this product biologically active, does not need crack fusion protein or discharges natural Urogastron.In addition, this product can also produce with inclusion body in intestinal bacteria.

One of task of the present invention, be to provide recombinant DNA molecules, its order can be encoded and be had the bioactive albumen of auxon (somatomedin order), described auxon is selected from Urogastron (EGF) and transforming growth factor (TGF α), and described recombinant DNA comprises the order of main order and at least one coding somatomedin.

TGF α is similar to EGF on 26S Proteasome Structure and Function, and is the same with EGF, and TGF α has 3 intrachain disulfide bonds (Marguardt et al, 1983 ﹠amp; 1984; Massague, 1983a; Smith et al., 1985; Lee et al., 1985).By some stripped analyses, illustrate that TGF α can replace (Pike et al., 1983 mutually with EGF on function; Massague, 1983b; Derynck et al., 1984; Tam et al., 1984).Term TGF also should be regarded as TGF α in this article.

When the order of coding somatomedin during more than, these interconnect in proper order.Somatomedin preferably comes from Mammals, is good to come from sheep, mouse, people or pig especially.

The suitable number of coding somatomedin order is 1-30, and 1-10 better, and 1-5 better, is the best with 1-2 especially.

Main order can be obtained by various sources, for example can come from plasmid or other organisms, also can synthesize.The suitable length of main order is a 1-50 amino acid, and 12-50 amino acid is better, and 15-30 amino better, is the best with 21 amino acid especially.

" somatomedin order " described in the present specification means coding and has the bioactive proteic DNA sequence of mouse, other Mammalss or birds somatomedin, and this order can be natural, also can be synthetic.That somatomedin is understood to include is homotopic, sudden change, that shorten, prolong or other various forms.Ordinary method in employing this area all can obtain the somatomedin of all kinds of forms, for example adopts the site mutagenic compound, restriction enzyme, ligase enzyme, oligonucleotide synthesis method.Example is seen the book (1982) that Maniatis etc. is compiling.

Two of task of the present invention is to provide the plasmid that contains above-mentioned recombinant DNA molecules.Plasmid is good with the following pCW9-RI that will describe in detail especially.

Three of task of the present invention is to provide the plasmid transformed host cells by containing above-mentioned recombinant DNA molecules.Host cell can be prokaryotic cell prokaryocyte or eukaryotic cell, but better with bacterium, yeast, mammalian cell or insect cell, and intestinal bacteria are then better, and unexpected best host cell is the lac I ^σThe intestinal bacteria of-(-) strain, for example BL21, HB101 and N5151.Proved already that some bacterial strain was unfavorable, SG936 for example, DH5.One of skill in the art can be easy to determine suitable host cells by the screening method of routine.

Four of task of the present invention, be to provide the synthetic bioactive proteic method of the auxon that is selected from EGF and TGF that has, comprise that the microorganism that will contain above-mentioned recombinant DNA or clone cultivates in assimilable nutritive substance, the somatomedin that separation is produced by microorganism or clone, and recovery has active somatomedin.

Five of task of the present invention is to provide the synthetic method of above-mentioned plasmid, and this method comprises the following steps:

(a) contain the DNA sequence (somatomedin order) that coding has the order that is selected from EGF and TGF α auxon biological activity protein with the retriction endonuclease cracking, cut off described somatomedin order;

(b) with same retriction endonuclease cracking expression plasmid;

(c) with dna ligase at least one somatomedin is inserted cracked expression plasmid in proper order;

(d) reclaim recombinant plasmid.

Preferably a kind of plasmid of DNA sequence in the step (a) is best especially with pEGF3.

Method comprises the following steps: preferably

(a) contain the plasmid of the DNA sequence of coding EGF or TGF α with retriction endonuclease digestion, the order or its bioactive fragment that cut off coding EGF or TGF α;

(b) with same retriction endonuclease digestion expression plasmid;

(c) purification step (a) and product (b);

(d) described product is mixed and is connected;

(e) transform microorganism with the mixture that connects;

(f) identification code EGF or the TGF α order transformant on the tram whether;

(g) contain the plasmid of the DNA sequence of coding EGF or TGF α with retriction endonuclease digestion, cut off coding EGF or TGF α order or its bioactive fragment;

(h) with the product of same retriction endonuclease digestion step (d);

(i) step (g) and product (h) are mixed, be connected to form linking copy or its bioactive fragment of one or more EGF of coding or TGF α by the both sides of short outer order on N end and/or the C end;

(j) reclaim the plasmid that forms thus.

Preferably the plasmid in the step (a) is pEGF3, plasmid in the step (b) is pUC19, the product of step (a) and (b) is connected with dna ligase in step (d), and the microorganism in the step (c) is intestinal bacteria, and the plasmid in the step (g) is pWRL525.

In a particularly preferred embodiment, the plasmid synthetic method comprises the following steps:

(a) plasmid pEGF3 is digested with retriction endonuclease, cut off the EGF encode fragment;

(b) plasmid pUC19 is digested with same retriction endonuclease;

(c) the described EGF encode fragment of purifying and through digestion 5 '-phosphoric acid salt cracked pUC19;

(d) mix purified product, and it is connected with dna ligase;

(e) transform host microorganism with the mixture that connects;

(f) identify to have the segmental recombinant plasmid of EGF whether on correct position (pUC19-EGF);

(g) plasmid pWRL525 is digested with retriction endonuclease, and the consequent EGF fragment of purifying;

(h) pUC19-EGF is used the retriction endonuclease digestion identical with step (g), and the consequent fragment of purifying;

(i) mix EGF fragment and pUC19-EGF, and connect, produce plasmid PCW9 with the T4 dna ligase;

(j) reclaim plasmid pCW9.

Step (a) and (b) in retriction endonuclease EcoR I preferably.

Step (g) and (h) in retriction endonuclease BstE II preferably.

Digestion in the step (b) also can be used alkaline phosphatase treatment, prevents to connect again.

Six of task of the present invention is to provide the fur of removing on the animal body, and the step of this method comprises to described animal uses the new above-mentioned unhairing reorganization EGF of significant quantity or by EGF that it produced.

For convenience's sake, will highlight M-EGF (mEGF) below, but should be interpreted as clearly that the present invention equally also is applicable to other EGF and TGF α.

In brief, the mEGF that is produced is a kind of linking dimer, wherein before 2 mEGF order be 1 by the short order of bacteria plasmid DNA amino acids coding.With opposite by many other short fusion rotein gained results, this product produces in intestinal bacteria effectively, and highly stable.In addition, it mainly is made up of the mEGF order, thereby few product goes out of use.Unexpectedly as mEGF, this product almost molecule to the level of molecule on biologically active, make the cracking of Fused dimer mEGF not need to discharge natural mEGF.It should be noted that the conventional fusion rotein that contains EGF there is no biological activity.In biological assay, proved that TrpE-EGF and glutathione-S-transferase-EGF do not have activity (consulting table 3 and 6 respectively).At last, find that also this product almost is undissolved inclusion body in bacterial cell.This just can collect effectively and carry out purifying in early days.

The discovery that mEGF is connected dimer promptly above-described " albumen-pCW9 " is unexpected.In order to produce the non-long fusion rotein that merges mEGF, other the short fusion polypeptide that contains mEGF and contain the multiple linking copy of mEGF, carried out a series of test, between different products, expression level difference in the intestinal bacteria is very big, but any method does not relate to molecular weight or mEGF copy number.According to the corresponding to high level expression of lower molecular weight, selected preferable product " albumen pCW9 ", and need not to carry out any cracking but biologically active.

Now just with reference to following non-limiting example and description of drawings the present invention, description of drawings is as follows:

Fig. 1 represents to make up plasmid pCW9-RI by pWRL525 and pEGF3;

Fig. 2 explanation is used for the structure of the plasmid pWRL500 of pWRL525 starting raw material;

Fig. 3 represents the structure of plasmid pWRL525;

Fig. 4 represents the structure of plasmid pET3b-1 and pET3b-2;

Embodiment 1: prepare plasmid pCW9 by plasmid pEGF3 and pWRL525

Initial genetic material is the plasmid pEGF3, the pWRL500 that are obtained by Wellcome Biotechnology Ltd. and pWRL525 and the plasmid pUC19(Yanisch-Perron that obtained by Pharmacia South Seas Pty.Ltd. etc., 1985).

Every other raw material comprises that restriction enzyme and other enzymes obtain by commercial sources, and analytical grade reagent is the available reagent that is obtained by any approach.

Genetic manipulation method is undertaken by (1982) described methods such as Maniatis substantially.

PEGF3 presses (J.Biote chnology 5(1987) 93-114 such as G.Allen by Wellcome Biotechnology Ltd., p.102) described method preparation.PEGF3 is except that a base difference, and other are all identical with pEGF6.The codon TGC of coding Cys 42 has changed TGT in pEGF3 in pEGF6.Do not have any change changing the coded amino acid produced thus.

PWRL500 presses (J.Cell Sci.Suppl.3(1985) 29-38 such as G.Allen by Wellcome Biotechnology Ltd.) described method preparation.Designing this plasmid is to be used to express TrpE-lys-EGF fusion rotein (consulting Fig. 2).

All above-mentioned starting raw materials all can obtain by commercial sources, also fully can be by the described method preparation of the reference that this paper quotes.

PWRL525 is prepared by pWRL500 by shown in Figure 3; this plasmid is essentially the synthetic oligonucleotide, when itself and the BstE II of pWRL500/when EcoR I fragment is connected, formed the order of the C end parts of coding EGF; terminal by Lys53 replacement Arg53, be thereafter the N end nubbin of EGF order.This connects by BstE II restriction site in proper order, is labeled as B-E-B(EGF), be inserted among the pWRL500 that cuts by the BstE II by the 1-4 copy again.Final structure contains the linking copy of 1-5 EGF, and wherein 1 is (Arg53) and nubbin (Lys53).About this 5 copy structure, we are referred to as pWRL525.

PCW9 is (the consulting Fig. 1) that the raw material by the Wellcome gained prepares as follows:

1. downcut purifying EGF fragment with EcoR I digestion pEGF3, and via the agarose electrophoresis gel, use Geneclean then ^TMHandle;

2. cut pUC19 with the EcoR I, and use the Roll alkaline phosphatase treatment, remove 5 ' terminal phosphate group, thereby prevent to connect again, press with the quadrat method purifying;

3. 2 fragments are mixed, and connect with the T4DNA ligase enzyme, the mixture after the connection is used for transformed into escherichia coli strain JM101;

4. be standard with the restriction site that is obtained by pUC19 in the multi-link subarea, the site plan in Sph I and BstE II site in drawing is identified and is contained the segmental recombinant plasmid of the EGF that is inserted on the tram (pUC19-EGF);

5. cut pWRL525 with the BstE II, and purifying B-E-B(EGF) fragment;

6. with BstE II cutting pUC19-EGF, and by carrying out purifying with quadrat method;

7. 2 fragments are mixed, and connect, produce plasmid pCW9-R I with the T4DNA ligase enzyme.

Standard normal method and condition (consult Maniatis, see the reference that this paper quotes) that all above-mentioned steps all adopt this area professional to be familiar with are carried out.

Embodiment 2: the preparation of albumen pCW9

Plasmid pCW9-R I is transferred among e. coli strains JM101, JM109 or the XL-lBlue.

Use by the pUC19 deutero-and by adding isopropyl ss-D-sulfo-galactopyranoside (IPTG) inductive lac promotor and produce expression.

Can also use other e. coli strains that structurally can express: BL21, BL21(DE3), BL21(DE3) plysE, BL21(DE3) plysS and DHS.

All these e. coli strains all are easy to obtain for the ability professional.

Embodiment 3: the cultivation of transform bacteria

The e. coli strains JM109(JM109(pCW9-R I that will transform by plasmid pCW9-R I)) cultivate in the fermentor tank of appropriate media is housed (example sees Table 1).Dissolved oxygen remains in the saturated air more than 25%, adds 2M NaOH on demand, and pH is remained on 6.8.Press the basic need amount and add glucose (5%).

In collection preceding 5 hours, it was 0.2mM that IPTG is added to ultimate density, promoted that pCW9's is synthetic.The protein that is produced is difficult to dissolving, forms with inclusion body almost completely to be controlled in the cell.Collecting cell after 24 hours.(8g/L NaCl, 0.8g/L KCl, 1.15g/L Na in the 0.03M of pH7.2 phosphate buffered saline (PBS) ₂HPO ₄, 0.2g/L KH ₂PO ₄) homogenizing, resuspending is in water.Urea is added in the suspension, and ultimate density is 8M.

Suspension is centrifugal, drain fragment, supernatant liquor is coated on the Q-agarose column (Pharmacia), again with the NaCl(0-2.0M of this post with 8M urea) elute soln, be buffered to pH6.0 with 20mM Tris-HCl, the part that contains pCW9 albumen (through SDS-PAGE) is coated on the Sephadex G-75 post (Pharmacia) that the damping fluid balance of 8M urea is crossed after centrifugal.With each partly merging of peak value, slowly remove urea by diafiltration.

Embodiment 4: the other method of extraction and purifying protein pCW9

By the whole bag of tricks known in the art, collect and smudge cells, comprise and use mechanical homogenizer or ball mill, or interior the giving birth to of N,O-Diacetylmuramidase produced.

According to used method of cell disruption, need to handle the attenuating viscosity with the DNA enzyme.Under 37 ℃, use 2mM MgCl ₂With 0.2 μ g/ml DNA enzyme to homogenate incubation 2-3 hour.

Contain the cytoplasm of inclusion body by centrifugal collection, and with buffer B (10mMDETA, the 0.2M NaH of 2 volumes ₂PO ₄, pH7.5) washed cell slurry, then it being dissolved in weight is the damping fluid C(6M urea of 40 times of inclusions, the 5mM halfcystine, the 25mM sodium bicarbonate, 21mM yellow soda ash, pH9.8) in.The inclusion fragment fully disperses with mechanical stamp mill.

At room temperature, solution was slowly stirred 3 hours, use the damping fluid CB(25mM sodium bicarbonate of 1/2 volume then, 21mM yellow soda ash, pH9.8) dilution.At room temperature slowly stirred 24 hours, with protein oxidation.

Add pH and be 9.0 20mM thanomin damping fluid (identical) and further dilute this solution with damping fluid C volume, continue successively end (NMWC) strainer by 100000 nominal molecular weight and 10000 NMWC strainers filter.

Semipurified concentrated pCW9 albumen also can be further purified by the chromatography method of various routines, for example uses ion exchange chromatography.

For the purpose of the present invention, should be understood that clearly also that be used to extract and the not strict restriction of the method for purifying pCW9, many methods that may obtain result of the present invention all can be used in this area.

One of the advantage that can carry out the albumen pCW9 of purifying is that its solubleness in host cell is very low, is substantially limited within the inclusion body.

Embodiment 5: the proteic biological activity of pCW9 exsomatizes

With albumen pCW9 and ree-m EGF(Wellcome Biotechnology Ltd.) biological activity compare.

Various materials in the test are all left standstill its hormesis in stimulation DNA is synthetic of mensuration in the fibrocyte maker (national serological labororatory) at Switzerland Albino 3T3.

In the tissue culture cave, its substratum is the improved 3ml Eagles substratum (DMEM) that contains 10% foetal calf serum of process Dulbecco with the cell cultured continuously.After 24 hours, with fresh DMEM diluted medium, the final serum-concentration that obtains is 1%.Cultivate after 3 days, add substances, measure its speed in conjunction with DNA.The proteic effect of pCW9 at least should be identical with the EGF in stimulating the thymidine combination.Thymidine is in conjunction with being suppressed (Steinert, 1969) by hydroxyurea fully, and this combination is to measure DNA synthetic method.The results are shown in table 2-5.

Embodiment 6:pCW9 egg is in the intravital activity of mouse

EGF can induce the physiologic response of young mouse.Be apparent that most and quicken teething and eyes open, change big and common putative be the change of fur.Scurf on the skin, fur curl and fur growth reduction all is the feature that shows.All these effects all cause by albumen pCW9, and open eyes and long teeth in advance, are quite analogous to those features that caused by rec-m EGF.The results are shown in table 6 and 7.

EGF derivative and Methocel A-15 carrier are mixed with preparaton, are applied to sheep.This standard vector prepares as follows:

1. 18.375 g Methocel A-15 are dispersed in the 120ml hot water (80-90 ℃);

2. add 240ml cold water, this solution is cooled to 5 ℃;

3. add mixing behind the 10ml benzylalcohol;

4. add water and be mixed to 500ml.

(for example pCW9) is added in the standard vector with freeze dried EGF derived protein, and the ultimate density that obtains is 1-10mg/ml.Handled 3 minutes through the super homogenizer of Turrax, make its dispersion.

Embodiment 7: albumen pCW9 is in the intravital biological activity of sheep

Press same quadrat method and dosage range with rec-mEGF, pCW9 is applied to sheep with albumen, when using with the same dosage of rec-m EGF, can see the effect that all are identical, that is: the of short duration minimizing of food soakage, the rareness of wool fiber reaches top in a week, therefore is easy to manual unhairing.

The results are shown in table 8 and 9.

The diverse purification process preparation of albumen pCW9 preparation in processing 1 to 8, except that preparation 7, the activity of all preparations is all very high.It should be noted that preparation 7 produces serious precipitation when preparation.

According in the body and external biological assay, reorganization EGF of the present invention fully can be comparable with the rec-m EGF of prior art aspect active, but also can be comparable with natural EGF.

The preparation of embodiment 8:met EGF and met EGF dimeric structure

Albumen pCW9 is good at expression in escherichia coli, and than short analogue, for example contains 3 amino acid whose protein of the plasmid pUC18 that is connected with the EGF of 2 linking copies, expresses very poor.In addition, previous attempt fails with tac promoter systems expression met EGF.Yet unexpectedly as a part of the present invention, have been found that a kind of method, can in intestinal bacteria, express the albumen (" met EGF dimer ") that contains the methionine(Met) that is connected with the EGF of 2 linking copies very effectively.

Successful result is by obtaining in 2 isolating factors.The first, promotor is selected role.Use T7 expression system (Rosenberg, A.H. etc., 1987) that met EGF is expressed in intestinal bacteria significantly.The second, in identical system, to be significantly higher than the horizontal expression met EGF dimer of met EGF.

Initial genetic material pEGF3 and pUC19 introduced in embodiment 1, and pUC18 is identical with the source of pUC19.

The pUC19 carrier is modified by the clone in synthetic small pieces segment DNA, and pUC19 DNA with EcoR I and the digestion of Sac I, carries out electrophoresis earlier then on sepharose.Downcut big fragment from gel, and use Geneclean ^TMPurifying.Synthetic DNA has following order:

5′CCATGGCTAGCCATATG?3′

3′TCGAGGTACCGATCGGTATACTTAA?5′

After the mixing, under suitable condition with the pUC19 carrier segments (Maniatis consult reference that this paper quote) of T4DNA ligase enzyme connection through cutting.Reclaim the transformant among the e. coli strains JM101.The plasmid pUC19-L that forms digests with the EcoR I, and will be cloned by the EcoR I fragment among the pEGF3 that contains the EGF gene.Analyze the DNA in the transformant, and select the EGF fragment to be inserted in the clone (pUC19-2-1) who expresses required tram in the pUC19 Lac promotor.

In pUC18, similarly make up.EGF EcoR I fragment is inserted in the required tram of expression in the pUC18 Lac promotor, obtains plasmid pUC18-8b.

With Eco 0109 I and BstE II digestion pUC19-1-1 and pUC18-8b, the small segment of pUC18-8b is connected with the big fragment of pUC19-L-1, obtain plasmid pUC19-L-1-2.Downcut from pUC19-L-1-2 with enzyme Nde I and BamH I and to contain the fragment of EGF gene, and be connected to and among the plasmid pET3b by same enzymic digestion.Connect and produced the plasmid pET3b-1 that can express met-EGF.By with Bst E II and the BstE II fragment that is connected the pWRL525 that contains the EGF gene, the plasmid of construction expression met-EGF dimer (pET3b-2) (as the structure of pCW9-R I among the embodiment 1).The structure explanation of plasmid pET3b-1 and pET3b-2 is shown in Fig. 4.

The dimeric expression of embodiment 9:met-EGF and met-EGF, extraction and purifying

In pET3b-I and pET3b-2, the dimeric expression of met-EGF and met-EGF is carried out under the promotor control by the T7 rna polymerase transcribe respectively.Therefore, for the needs expressed proteins, plasmid is applied to can produce in the host cell of T7 RNA polymerase.We select the host who uses is BL21(DE3) (Rosenberg etc., 1987, consult the reference that this paper quotes).In this bacterial strain, when adding IPTG induces the T7 RNA polymerase to express, the expression that produces the T7 promotor.

Dimeric extraction of met-EGF and met-EGF and purifying adopt and the same method (consulting embodiment 4) of purifying protein pCW9.Bioactive mensuration of met-EGF such as embodiment 7, and have been found that its activity can be comparable with albumen pCW9.

Embodiment 10

In order to express dimeric EGF analogue and unexpected biological activity thereof effectively, make up and study having a large amount of other analogues of EGF linking multiple.

Expression is equivalent to the albumen of albumen pCW9 but has the plasmid of the EGF of 3,4 and 5 copy numbers, can make up by being similar to the method that makes up plasmid pCW9-R I (embodiment 1).Its difference only is to carry out part and digests, rather than with Bst E II with the pWRL525 complete digestion.Adopt this method, can be separated to the fragments of the EGF gene that contains 2,3 and 4 linking copies, and it is cloned in Bst E II cracked pUC19-EGF, obtain having the plasmid (pUC19-11-4, pUC19-11-5 and pUC19-11-6) of 3,4 and 5 copy EGF genes.

The EGF-trimer protein of being expressed by pUC19-11-4 extracts and purifying by the method (consulting embodiment 4) same with albumen pCW9 basically.This albumen also has activity in the sheep body.

Obviously one of skill in the art adopts the method that various reorganization and synthetic DNA make up, can both prepare recombinant growth factors of the present invention, and according to the repeat number of somatomedin and the length and the character of N end additional (mainly) order, the recombinant growth factors that is produced can have various amino-acid sequences.

Though we can't give any prediction to accurate repeat number or the length of main order or the biological activity of character, can measure any specific amino-acid sequence very simply and whether can produce and have active somatomedin.For example the amount of desirable proteins can be measured with method of immunity, and its biological activity can be measured with bioassay method, and the simplest this rapid assay methods is exactly the cell mitogen assay method, for example the foregoing description 5 method therefors.

Stratum's sieve method can be used for measuring:

(a) expression amount;

(b) external activity;

(c) activity in vivo.

Other suitable methods also are that this area professional is known, and they need not undue experimentation can identify the order with " activity ".

Should understand common meaning of the present invention clearly, and be not limited to above-mentioned specific details.

Behind the document row that this paper quoted.

Table 1: the substratum that is suitable for the e. coli strains JM109 growth of expressing protein pCW9

per L

（NE ₄） ₂SO ₄20g

KH ₂PO ₄3g

The blue sodium 0.5g of citric acid

Add

Trace element solution * 2ml

50% MgSO ₄7H ₂O 3ml

50% glucose 20ml

0.2g/ml penbritin 1ml

* trace element solution (g/L)

CaCl ₂·6H ₂O 20

FeCl· ₂6H ₂O 25

CaCl ₂·6H ₂O 2.5

MnSO ₄·nH ₂O 5

ZnSO ₄·7H ₂O 5

（NH ₄） ₆MO ₇O ₂₄·4H ₂O 2.5

AlCl ₃·6H ₂O 5

CuSO ₄·4H ₂O 1

H ₃BO ₃0.5

Table 2: albumen pCW9 is to the biological activity of isolated cells

(Swiss Albino 3T3 clone, DMEM+1% foetal calf serum)

The combination of 3H-thymidine

(total amount cpm) stimulation index P

Handle (mensuration of Lord scope)

Contrast

1. do not add 13,966 1.00-

2. urea contrast 13,936 1.00-

rec-m EGF

1.10 ng/ml 24，059 1.72 ＜0.05

Albumen pCW9

1. pure preparation 26,353 1.89＜0.01 not

Table 3: the bioactive disappearance of albumen TrpE-EGF in isolated cells

(Swiss Albino 3T3 clone, DMEM+1% foetal calf serum)

The combination of 3H-thymidine (total amount cpm) stimulation index

Handle

Contrast 12,632-

EGF（10ng） 34，495 2.73

TrpE-EGF（10ng） 12，228 -

TrpE-EGF（100ng） 13，317 -

Table 4: the biological activity of albumen pCW9 in isolated cells

(Swiss Albino 3T3 clone, DMEM+1% foetal calf serum)

The combination of 3H-thymidine

Stimulation index

Handle (being subjected to the inhibition of hydroxyurea)

Contrast

1. do not add 6,938 (1.00)

2. contrast bacterial product (a) 4,046 0.58

3. contrast bacterial product (b) 4,044 0.58

rec-m EGF

1.10 ng/ml 12，417 1.79

2.1000 ng/ml 5，690 0.82

Albumen pCW9

1.250 ng/ml 15，754 2.27

(a) contain beta-galactosidase enzymes and ox tick albumen fusion rotein in proper order.

(b) reorganization beta-galactosidase enzymes.

Table 5: the biological activity of albumen pCW9 in isolated cells

(Swiss Albino 3T3 clone in DMEM+0.25% foetal calf serum)

The combination of 3H-thymidine

Stimulation index

Handle (being subjected to the inhibition of hydroxyurea)

Contrast

With damping fluid 1,850 1.00

rec-m EGF

1 ng/ml 3，667 1.98

0.3 ng/ml 3，430 1.85

0.1 ng/ml 2，343 1.27

Albumen pCW9

Number of times 14

1 ng/ml 3，004 1.62

0.3 ng/ml 3，609 1.95

0.1 ng/ml 3，439 1.86

Number of times 2,28/5

1 ng/ml 4，465 2.4

0.3 ng/ml 2.685 1.45

0.1 ng/ml 1，725 0.93

Table 6: the biological activity of albumen pCW9 in newborn rat

Group (n-3)

1

Other dosage of nest teething fates fate of opening one's eyes

3 contrast-are untreated 10 13/14

1 pCW9-a 12 μg x 4 9 10/11

3,4,5,6 day age 2 pCW9-b, 12 μ g x 49 10/11

3 pCW9-c 12 μg x 4 9 9/10

Dosage 4 pCW9-d 12 μ g x 49 10

15 contrasts ₁-be untreated 11,/12 14/16

11 β-a tilactase 10,/12 14/16

3,4,5,6 day age 21 big EGF fusion-a ²11 14/16

31 big EGF fusion-b 11,/12 14/16

The big contrasts of merging of dosage 4 ³11,/12 14/16

21 contrast-are untreated 10 14

1,2,3,4 day age rec-mEGF 12 μ g x 47 9/10

Dosage

1. only measure (not pure preparation)

PCW9-a ,-b ,-c ,-d are the albumen pCW9 of different number of times.

In bacterium, produce beta-galactosidase enzymes with pUR288.

2. big EGF fusion-a, b is the fusion rotein δ that contains the glutathione-S-transferase that merges with the EGF order.

3. big fusion contrast is the fusion rotein that contains the glutathione-S-transferase that merges in proper order with ox tick albumen.

Table 9: albumen pCW9 is in the intravital biological activity of sheep

The processing * unhairing efficient (mean values of 5 readings) of sheep ^N/ktex

No. dosage fate, dosage

μg/kg -4 0 +6 +10 +14 121

650 1-120,8.81 11.78 2.01 2.19 0.85 0.37 unhairings

647 1-150 7.67 9.52 3.57 2.72 1.99 0.63

669 1-300,10.85 13.62 4.38 2.16 0.75 0.21 unhairings

666 2-150 7.38 7.21 2.02 0.93 0.39 0.72

646 3-120,6.86 6.29 1.88 0.68 0.31 unhairings

645 3-150,7.68 7.95 1.72 1.79 1.38 1.06 unhairings

659 3-300,7.52 8.77 1.97 1.66 0.88 unhairings

658 4-120,6.29 7.92 0.91 0.20 unhairings

677 4-150,14.79 13.51 2.08 1.01 0.24 unhairings

668 4-300 6.31 6.40 1.70 0.97 0.63 0.61

679 5-150 11.86 15.95 4.83 1.73 1.31 2.09

663 6-136,11.19 10.56 0.55 0.70 unhairings

674 7-120 14.54 15.88 14.17 21.33 16.59 20.61

654 7-150 7.94 6.70 7.20 6.96 8.09 8.68

657 7-300 7.49 7.06 5.89 6.02 5.32 6.00

676 8-120,7.47 8.62 1.68 0.81 unhairings

665 8-150 6.86 6.89 2.85 1.48 0.77 0.31

667 8-300,9.94 11.29 2.21 1.51 0.53 unhairings

* the preceding numeral (1-8) of hyphen "-" is represented used albumen pCW9 preparation (consulting specification sheets).

Reference

Allen G.，et al.（1985）J.Cell Sci.Suppl.3 29-39.

Allen G.，et al.（1987）J.Biotechnol.5 93-114

Brachmann，R.et al（1989）Cell 56 691-700

Derynck R.，et al（1984）Cell 38 287-297

Kishimoto F.，et al.（1986）Gene 45 311-6

Lee D.C.，et al（1985）Nature 313 489-491

Maniatis T.，et al.（1982）Molecular Cloning，A Laboratory

Manual（Cold Spring Harbor Laboratory），

Marquardt H.，et al（1983）Proc.Natl.Acad.Sci.USA 80 4684-4688

Marquardt H.，et al（1984）Science 223 1079-1082

Massague J.，（1983）J.Biol.Chem.258 13606-13613

Massague J.，（1983b）J.Biol.Chem.258 13614-13620

Moore G.P.M.，et al.（1982a）Aust.J.Biol.Sci.35 163-72.

Moore G.P.M.，et al.（1982b）Proc.2nd Nat.Conf.Wool

Harvesting Research and Development（Hudson PRW ed.）57-65.

Moore G.P.M.，et al.（1983）Outlook for Australia′s Natural

Fibres Symp.Aust.Acad.Technol.Sci.1983 85-96.

Oka T.，et al.（1985）Proc.Natl.Acad.Sci.USA 82 7212-6.

Rosenberg，A.H.，et al.（1987）Gene 56 125-135.

Smith J.，et al.（1982）Nucleic Acids Research 10 4467-82.

Smith J.M.，et al（1985）Nature 315 515-516

Steinert M.，（1969）FEBS Letters 5 291.

Sumi S.I.，et al.（1985）J.Biotechnol.2 59-74.

Tam J.P.，et al（1984）Nature 309 376-378

Urdea M.S.，et al.（1983）Proc.Natl.Acad.Sci.USA 80 7461-5.

Yanisch-Perron C.，et al.（1985）Gene 33 103-119.

Claims

1, a kind of recombinant DNA molecules, its sequence coding has the bioactive albumen of auxon (somatomedin order) that is selected from Urogastron (EGF) and transforming growth factor (TGF α), and described recombinant DNA comprises the order of main order and at least one coding somatomedin.

2, by the recombinant DNA molecules of claim 1, comprise the order of 2 or a plurality of coding growth factor proteins, described order is interconnective.

3,, comprise 1 to 30 somatomedin order by the recombinant DNA molecules of claim 1 or 2.

4, by each recombinant DNA molecules of claim 1 to 3, wherein main order has 1 to 50 amino acid long.

5, by each recombinant DNA molecules of claim 1 to 4, wherein somatomedin derives from Mammals.

6, by each recombinant DNA molecules of claim 1 to 5, wherein somatomedin is EGF.

7, the interior or stripped dna replication dna independent unit of body comprises each the described recombinant DNA molecules by claim 1 to 6.

8, by the dna replication dna independent unit of claim 7, be selected from plasmid, cosmids, expression vector and virus.

9, a kind of plasmid contains each recombinant DNA molecules of claim 1 to 6.

10, as the plasmid pCW9-RI defined in the literary composition.

11, a kind of dna replication dna independent unit or the protokaryon that transforms of the plasmid of claim 9 or 10 or host cell of eucaryon by claim 8.

12, by the host cell of claim 11, it is a bacterial cell, yeast cell, mammalian cell or insect cell.

13, by the host cell of claim 11, it is intestinal bacteria (Escherichiacoli).

14, by the host cell of claim 12, it is the lac I ^σThe intestinal bacteria of-(-) strain.

15, synthetic have the EGF of being selected from or a bioactive proteic method of TGF auxon, be included in the microorganism or the clone of cultivating the recombinant DNA that each limited that contains claim 1 to 6 in the assimilable nutritive substance, separation has active somatomedin by somatomedin and the recovery that this microorganism or clone produce.

16, press the somatomedin of the method generation of claim 15.

17, by the somatomedin of claim 16, it is EGF.

18, by the somatomedin of claim 16, it is TGF α.

19, remove the method for animal wool, fur or mane, comprise to described animal and use the claim 16 of removal wool, fur or mane effective dose or 17 EGF or consequent EGF.

20, by the method for claim 19, wherein said animal is selected from goat, sheep, rabbit, ox, deer and pig.

21, by the method for claim 19, wherein animal is selected from alpaca, no peak camel and vigone.

22, promote the method for wound, ulcer or wound healing, comprise each somatomedin to the claim 16 to 18 of the administration significant quantity of this treatment of needs.

23, promote the sophisticated method of young animal intestines, comprise to the claim 17 of described administration significant quantity or 18 somatomedin.

24, the method for the plasmid of synthetic claim 8 qualification, this method comprises the following steps:

(b) with same retriction endonuclease cracking expression plasmid;

(d) reclaim recombinant plasmid.

25, by the method for claim 24, this method comprises the following steps:

(b) with same retriction endonuclease digestion expression plasmid;

(c) purification step (a) and product (b);

(d) described product is mixed and is connected;

(e) transform microorganism with the mixture that connects;

(h) with the product of same retriction endonuclease digestion step (d);

(j) reclaim the plasmid that forms thus.

26, press the plasmid of the method generation of claim 24 or 25.

27, a kind of pharmaceutical composition comprises each somatomedin and pharmaceutically acceptable thinner, carrier or vehicle of claim 16 to 18.

28, a kind of synthetic or semi-synthetic cell or tissue substratum comprises each somatomedin and avirulent diluent or carrier of claim 16 to 18.

29, a kind of composition of removing wool, fur or mane comprises the EGF of claim 16 or 17 and veterinarily acceptable carrier, thinner or vehicle.