CN1020923C - Method for producing inhibin using dan recombinant technique using dan) - Google Patents

Abstract

The present invention comprises a DNA method characterized in a coded inhibin and a probe for identifying the DNA. The present invention also protects recombinant DNA which comprises complete or partial sequences of a cloning vector and the coded inhibin, structural analogs of the inhibin, congener or precursor DNA, or DNA coding a protein with similar immunological or biological activity, cells transformed by the recombinant DNA and capable of expressing polypeptides and an expression method. The method also protects medicine compositions containing the polypeptides. The function of the sexual gland and antibodies resisting the polypeptides in vertebrates are used for a similar purpose.

Description

Method for producing inhibin using DAN recombinant technique using DAN)

Present invention is specifically related to the foundation of cloning vector, contain the complete or part of coding in these carriers and be called thymus nucleic acid (DNA) sequence of the hormone of statin, specially refer to the host cell that contains these carriers such as the foundation of bacterial strain, also specially refer to and to produce complete, part statin or the host cell of its precursor such as the foundation of bacterial strain.In addition, the present invention relates to the generation and the utilization of the expression product of described carrier and bacterial strain, also relate to the segmental generation and the utilization of expression product and carrier, no matter they are natural or synthetic in itself.

Had the people to propose in 1932, sexual gland produces a kind of on-steroidal factor that is called statin, 19～20 pages of its relevant with the feedback regulation of pituitary function (McCullagh, D.R.(1932) Science(science) 76 volumes).Since then, verified before hypophysis produce two kinds of gonad-stimulating hormone at least, follitropin (FSH) or be follitropin and interstitialcellstimulating hormone (ICSH) (LH) or be Lutropin, they regulate the growth and the function of sexual gland jointly.Utilize the very high radioimmunoassay detection technology of sensitivity, people can carry out independently precise monitoring to every kind of hormone, and have confirmed the feedback regulation effect of these gonadal hormones.As if the feedback regulation of LH is mainly undertaken by steroid substances, and the feedback regulation of FSH is also undertaken by the protein or the glycoprotein factor that are called statin except steroid.

Now, we can be defined as statin albumen or glycoprotein hormones, and it is by the sertoli's cell secretion of the granulosa cell or the testis of ovary.It is as for the reaction of FSH and excretory, and it acts on hypophysis with the synthetic and excretory feedback inhibition agent of FSH, but does not influence the synthetic and secretion in basis of LH basically.Whether the mRNA of statin or precursor form in other cell and tissue, and people also do not understand at present.

The seventies is since the initial stage, people have made some effort, hope is the purifying statin from the sexual gland of multiple animal, comprise testis and ovary, but 1～10 page of the result that obtains of institute and inconsistent (de Jong.F.H.(1979) Mol.Cell.Endocrinol.13 volume), this part is owing to their used biological testing system difference, in these systems, any inhibition for FSH in stripped or the live body pituicyte, may be because when the non-single-minded toxic effect of the test material of surveying, do not guarantee to be simultaneously the test (Baker of statin and contrast, H.W.G. wait people (1981), see Franchimont, p. and Channing, C.P. editor's " the interior sexual gland of reproduction is regulated " is the 193rd～228 page, and London Science Press publishes; Baker, 329～342 pages of H.W.G. etc. (1982) Ann.New York Acad.Sci.383 volumes).

Recently, from ox liquor folliculi (bFF) purifying obtained the statin (International Patent Application PCT/AU85/00119 of homogeneous; Robertson, D.M. etc. (1985), Biochem.Biophys.Res.Commun.(biological chemistry and biophysical research communication) 220～226 pages of 126 volumes).This is by means of utilizing the strict mouse pituicyte method of testing (Scott that cultivates, R.S. etc. (1980), the Endocrinol.(incretology) 107 volumes are 1536～1542 pages) finish, this method comprises a kind of means (Robertson that tests the cytotoxic effect of the material of surveying, D.M. etc. (1982), 119～127 pages of Mol.Cell.Endocrinol.26 volumes), therefore, reduce the non-single-minded toxic effect of the cell FSH content of surveying and then can from the statin effect, distinguish out separately.Used standard is an ox liquor folliculi prepared product, it has the statin activity of 20 units per ml, and this unit is based on the described sheep testicle lymph of forefathers standard, and the active standard of promptly subjective definition is 1 unit/milligram (Scott, R.S. etc. (1980), 1536～1542 pages of Endocrinol.107 volumes).

Statin from bFF is purified about 3,500 times, until reaching 200 than living, 000 unit/milligram albumen, it is the albumen of a 58KD, is made up of two subunits with interchain disulfide bond, i.e. subunit A and subunit B, prove that by the polyacrylamide gel electrophoresis (SDS-PAGE) that has sodium laurylsulfonate to exist they are respectively about 43KD and 15KD.Each subunit NH ₂The aminoacid sequence of one end after measured.To have be those physiological properties of statin definition to this purifying substance originally external, promptly suppresses the synthetic of the endogenous FSH of mouse pituicyte and discharge, and do not influence the synthetic of LH such as prolactin and Triiodothyronine and discharge.

In the female ovulation mode of decision and speed and male spermatogenesis, FSH plays an important role, therefore, the important application that potentiality to be exploited is arranged of statin, its analog or homologue or anti-statin antibody, to be the gonad function that suppresses or promote the mankind or domestic animal, and use as the diagnostic tool that gonad function is analyzed.Utilize the sexual gland extract or the secretory product of crude extract or initial gross separation to finish many experiments made on the living, in the hope of analyzing the physiological effect of statin.In these experiments, that the effect that results from statin or anti-statin antibody comprises is following-

1. suppress gonad function (Moudgal, N.R. etc. (1985) see Sairam, M.R. and Atkinson, L.E. compile " sexual gland albumen and polypeptide and biological significance thereof " the 21st～37 page, Singapore, the publication of World Science publishing company).

2. improve ovulation speed (O ' Shea, T etc. (1982), 85 pages of Proc.Aust.Soc.Rep.Biol.14 volumes; O ' Shea, T. etc. (1983), 22 pages of Proc.Aust.Rep.Biol.15 volumes; Henderson, K.M. etc. (1984), 305～309 pages of J.Endocrinol.102 volumes).

3. shift to an earlier date hebetic beginning (Al-Obaidi, F.A.R. etc. (1983), 80 pages of Proc.Aust.Soc.Rep.Biol.15 volumes).

The exploitation of the commercial applications of these character and the further research in living animal physiology all need statin or its fragment or the statin stimulant and the antagonist of large-scale purification, and natural or synthetic can.Because starting material possibilities limited (as the hFF) therefore, only rely on present purification process and can not satisfy this demand, and, if a typical leaching process can only produce 5～10 microgram purifying substances since 50 milliliters of bFF.

The present invention has explored the method that overcomes these restrictions especially, the present invention to the gene of coding statin in addition discriminated union find out its feature, thereby the complete or portion gene of the statin of will encoding is cloned in a kind of host such as the intestinal bacteria, and, gene clone by operating these complete or parts is to produce the host, as bacterial strain, this host can synthesize and comprise the complete of subunit or part statin molecule or its precursor.

The first step embodiment of the present invention provides a kind of first dna sequence dna, the aminoacid sequence of its coding complete or part statin or its precursor, or the dna sequence dna of a kind of and described first dna sequence dna hybridization, no matter described sequence from which kind of source all can obtain, comprise natural, synthetic or semisynthetic, described sequence comprises because sudden change, single or multiple base substitutions, disappearance, insert, inversion etc. and relevant sequence, complete or the partial sequence or its precursor that also comprise the peptide species of encoding, the dna sequence dna of homologue and analog, described polypeptide are statin or immunology that shows similar statin or biologic activity.

Among the present invention preferably sequence be that coding is corresponding to ox and human inhibin hormone 43KD and 15KD(A and B) sequence of subunit polypeptide, these subunits have more detailed description in this paper aft section, also they have been done to describe in investing Fig. 5 of this paper, 6,7 and 8.

At another preferably in the embodiment, the statin 20KD(Ac that dna encoding will illustrate in the back) subunit.

The dna sequence dna that the present invention includes can therefrom extract all DNA earlier from for example preparing the vertebrate cells, separates required sequence by routine techniques again.This DNA also can pass through synthesis method or biological synthesis process prepared ex vivo, for example uses mRNA as template.

And, also comprise the method for selecting DNA or RNA sequence in the scope of the present invention, complete, the partial sequence of described DNA or RNA sequence encoding one peptide species or its precursor, this polypeptide is statin or has similar statin immunology or biologic activity.This method comprises provides one or more DNA or RNA sequence, and determine in the described sequence which can with encoding part or complete DNA with this active polypeptide or its precursor or RNA hybridization, a kind of antiserum(antisera) of statin perhaps is provided, or the antiserum(antisera) of part statin, and differentiate the combination that to express the host-vector of statin partial or completely.

Above-mentioned sequence can be natural origin, can be RNA sequence, composition sequence, from the dna sequence dna of DNA recombinant molecule and the combination of this sequence.

One of the present invention preferably in the scheme, be used to differentiate and identify the method for the proteic DNA of a part of statin that encodes at least, comprise and from the cell that generates statin, extract the mRNA molecule, they are changed into double-stranded DNA (complementary DNA or cDNA), and with in a kind of factor that can duplicate automatically of they insertions, as plasmid.Transform a kind of host cell such as bacterial strain with this factor then, reach the library that is produced with the screening of synthetic dna probe, these probes are complementary to the mRNA or the dna sequence dna of similar statin, therefore, they can detect those clones who contains the DNA of the statin of encoding, and repel the DNA of any other cell protein of coding.

Therefore, another kind of scheme of the present invention provides the synthetic polynucleotide probes, and with mRNA or the DNA that differentiates similar statin, these probes comprise a kind of polynucleotide and a kind of mark, and described polynucleotide have a kind of sequence that chooses from following:

T G

Probe 15 ' C CAT AANCCNCC 3 '

G A

A A T A

Probe 25 ' CCGAT TC TT AA 3 '

T G C G

Probe 35 ' ACGCCTGACTCCAGGA 3 '

Probe 45 ' CCTCCCAGTTTCATCT 3 '

C C

Probe 55 ' ATGTT ACCTT CCGTC 3 '

G G

Probe 65 ' CTTTGAGATTTCCAAAGAAGGC 3 '

Mark preferably is incorporated into 5 ' one ends ³²PO ₄Group, or other mark.

In the further embodiment of the present invention, providing to have the slotting section of DNA is the DNA recombinant molecule of feature, they comprise the complete or part statin of a kind of coding, or first dna sequence dna of the aminoacid sequence of its precursor, or with the dna sequence dna of described first sequence hybridization, described sequence can result from any source, comprise natural, synthetic, biosynthetic or semisynthetic source, these sequences comprise those because sudden change, single or multiple base substitutions, disappearance, insert, inversion etc. and relevant sequence, complete or the partial sequence that also comprises the peptide species of encoding, or the precursor of this polypeptide, the sequence of analog or homologue, this polypeptide are statin or immunology that shows similar statin or biologic activity.

Among the present invention preferably the DNA recombinant molecule comprise the sequence that a control is expressed, it is inserted with described DNA and section connects together effectively.Preferably in the scheme, described DNA inserts section and is connected in colibacillary beta-galactosidase gene effectively one of the present invention.Other preferably Controlling System comprise the left-hand promotor (P of tryptophane (Trp) operon system, lambda particles phage _L) and the long section of the end of a hybrid promoters such as tac or viral promotors such as Moloney leukemia virus multiple promotor.

Among the present invention one preferably the DNA recombinant molecule be a kind of plasmid that above-mentioned DNA inserts section that contains.Among the present invention preferably plasmid will be described in detail later, they comprise p ^BTA22, p ^BTA23, p ^BTA28, p ^BTA29, p ^BTA30, p ^BTA290And p ^BTA292-p ^BTA305, p ^BTA306-p ^BTA310, p ^BTA472, p ^BTA415-p ^BTA418

And described DNA recombinant molecule may comprise that the described DNA that is connected in suitable phage DNA inserts section, as lambda particles phage, or is connected in the viral DNA that can duplicate in exsomatize eukaryotic cell or whole organism.

The present invention also provides a kind of fusion gene, it comprises a promotor, a signal and one first dna sequence dna that startup is translated, this dna sequence dna corresponding to, what this DNA encoded for it in other words is the complete or partial amino-acid series of a peptide species, or the aminoacid sequence of this polypeptide precursor, this polypeptide is statin or immunology with similar statin or biologic activity, or it is also comprise the dna sequence dna of a kind of and described first sequence hybridization, or a kind of because sudden change, single or multiple base substitutions, disappearance, insert and inversion etc. and with the relevant dna sequence dna of described first dna sequence dna.

Among the present invention preferably the DNA recombinant molecule comprise a kind of plasmid, wherein be inserted with the dna sequence dna of the DNA that comprises the present invention.Suitable plasmid comprises p ^BR322, p ^UR290, p ^UR291Or p ^UR292Or p ^BTA286, p ^UC7, p ^UC8Or p ^UC9Or p ^UC13Or p ^Trp ^L1Or p ^WT111, p ^WT121Or p ^WT131And their derivative.Also comprise virus vector such as p ^{ZIP Neo}SV(X) 1, vaccinia virus, [virus (baculoviruses) and their derivative.

The present invention also comprises a kind of method of the DNA of production recombinant molecule, this method comprises provides a kind of DNA that comprises first dna sequence dna to insert section, this first dna sequence dna corresponding to, what it was encoded for it in other words is the complete or partial amino-acid series of a peptide species, or the analog of this polypeptide, the aminoacid sequence of homologue or precursor, this polypeptide is statin or immunology with similar statin or biologic activity, or comprise a kind of and described first sequence hybridization dna sequence dna or because the sudden change, single or multiple base substitutions, disappearance, insert and inversion etc. and with described first dna sequence dna or the relevant sequence of hybridization sequences, this method also comprises inserts described DNA in a kind of cloning vector of section importing.

Preferably described dna sequence dna is imported the tram and complete the reading in the code system of cloning vector sequence, and the while expression control sequenc.

In further embodiment of the present invention, provide a kind of DNA recombinant molecule host transformed of using a kind of the present invention at least, its can expression inhibiting plain polypeptide or have the immunology of similar statin or complete, the part of biologic activity or manifold polypeptide or their precursor.

Appropriate host comprises bacterial cell, phage, yeast, other fungi, vertebrate cells or insect cell, vegetable cell, comprises that people's cell, people organize the transplanted cells or the whole most eukaryotes of long-pending cell.

Suitable host bacterium comprises intestinal bacteria and other enteron aisle biology, pseudomonas (pesudomonas) and bacillus (Bacillus).The culture of host preferably that identifies is as follows: intestinal bacteria BTA545, BTA634, BTA637, BTA647 and BTA652, and the host-vector combination is ATCC67054-ATCC67059 and BTA1361 preferably.

Also comprise a kind of host's of conversion method in the scope of the invention, this method comprises: a kind of appropriate host is provided, the present invention's DNA recombinant molecule is imported described host's correct reading in the code position.

The present invention further provides the present invention's conversion host's expression product, this product comprises the complete or partial sequence of a peptide species or the precursor of this polypeptide, and this polypeptide is statin or a kind of polypeptide with similar statin immunology or biological property.These expression products preferably provide with the form of basic purifying.

In a preferred embodiment of the invention, it is second peptide sequence of precursor, analog or the homologue sequence of the complete or partial sequence of a peptide species or this polypeptide that these expression products comprise with host's homologous first peptide sequence and its aminoacid sequence, and described polypeptide is statin or immunology with similar statin or biological property.

In a preferred embodiment of the invention, first aminoacid sequence is partial or complete beta-galactosidase enzymes, and host cell is intestinal bacteria.Further preferably in the embodiment, this first sequence is the NH of expression product one of the present invention ₂-end sequence.

In further embodiment of the present invention, the method of utilizing the synthetic peptide species of biological process is provided, this polypeptide comprises statin or statin precursor or a kind of polypeptide with similar statin immunology or biologic activity complete or part, this method comprises: the DNA recombinant molecule with the present invention transforms a kind of appropriate host, make it can express a kind of protein product, this product comprises complete or the statin polypeptide of part or polypeptide or a kind of polypeptide with similar biology or immunologic competence of statin precursor; Cultivate described host and obtain described expression product; Collect described polypeptide.

The expression product of formation is insoluble inclusion body preferably in the scheme at one, by centrifugal make it with cell in soluble protein separate, thereby its purifying from cell extract is come out.Purification process comprises adding protease inhibitors and microbial film cracking agent and carries out density gradient centrifugation preferably.If desired, can make the inclusion body dissolving of purifying, by for example selective enzyme restriction and/or by being further purified release albumen further be handled, so that remove unwanted proteic substance.

Further, the present invention will produce a kind of albumen of similar statin, and it is by using plasmid p ^BTA28, p ^BTA29, p ^BTA292And p ^BTA296-p ^BTA305, p ^BTA296-p ^BTA310, p ^BTA472And p ^BTA415Deng the bacterial expression that transforms.

In a further embodiment, the invention provides a kind of pharmaceutical composition, as pharmaceutically acceptable form, it comprises one or more expression products or synthetic equivalent among the present invention.

In a further scheme, the present invention includes some synthetic polypeptide, they are part statin, also can be stimulant, the antagonists of statin or can cause antigen-reactive and can be used to influence FSH level or reproductive physiology.

Composition comprises the composition that is suitable for oral or injection form, preferably comprises a kind of pharmaceutically acceptable auxiliary.Also comprise in the pharmaceutical composition of the present invention those lasting medicine, especially be suitable in the implantation vertebra animal and the composition forms of long term maintenance drug effect.Influencing its gonad function, and after reaching required effect, it is taken away in the implantable vertebrates of the composition of this form.

In a further scheme, the invention provides a kind of vaccine, it comprises that one or more are as pharmaceutically acceptable expressing protein.

The present invention also comprises a kind of method that influences the vertebrates gonad function, and this method comprises the method for described vertebrates being used the pharmaceutical composition of the present invention of significant quantity.

In a further scheme, the present invention includes antibody preparations, these antibody prepare after a kind of vertebrates being used one or more expression products of the present invention or pharmaceutical composition of the present invention, cause immune response in its body.This antibody preparations comprises polyclone or Monoclonal Antibody thing.

Noun " statin " right and wrong of using in the whole text in this specification sheets and claims are species specific, so it comprises relevant kind statin such as the statin of ox, people, sheep, pig, Ji Heyu, especially people and Niu.This noun also comprises nonglycosylated and glycosylated statin.

The kind that noun " vertebrates " comprises has fish, batrachians, reptiles, birds and comprises human mammals.

As this specification sheets was indicated in the whole text, the statin that is secreted in the liquor folliculi was the albumen of a 58KD, and it comprises two subunits, the subunit of 43KD and 15KD-be called A and B.The subunit of A or 43KD is a kind of other homologous protein of certain interspecific difference that has, and therefore when the statin of a kind was administered to another kind, it may play antigenic effect in this kind.We think that in view of the above statin not of the same race can be used to produce the antibody of anti-statin, and this point will be discussed in the back.

Comparatively speaking, the aminoacid sequence of subunit B or 15KD subunit all is a basically identical between many kind, as between people and Niu.

In some cases, whole albumen is cut into the form of 31KD, and it comprises that molecular weight is two subunits-be called Ac and the B of 20KD and 15KD.The form of 31KD shows the statin activity and forms a part of the present invention.When the form of 58KD is cut into the form of 31KD, discharges one and be called A _NSegmental polypeptide fragment, itself have important effect in the adjusting of gonad function, and also are parts of the present invention therefore.

Although such scheme falls within the major programme scope of the present invention, we will further describe scheme preferably of the present invention, and following system experimentation method of reference and accompanying drawing:

Fig. 1 has described the synthetic strategy that contains the recombinant plasmid of ox granulosa cell cDNA.

Fig. 2 is the polymine cellulose thin-layer chromatography from ox granulosa cell messenger RNA(mRNA) synthetic cDNA product.

Fig. 3 has described 43KD(A) subunit and 15KD(B) sequence of subunit probe.

Fig. 4 has described the collection of illustrative plates of a kind of Restriction Enzyme (PstI) and the strategy of seven kinds of statin cDNA sequential analysis.

Fig. 5 has described the nucleotide sequence of ox statin subunit A cDNA and the aminoacid sequence of prediction thereof.The restriction enzyme site of selecting is shown on the dna sequence dna.

Fig. 6 has described the nucleotide sequence of ox statin subunit BcDNA and the aminoacid sequence of prediction thereof.The restriction enzyme site of selecting is shown on the dna sequence dna.

Fig. 7 has described the nucleotide sequence of human inhibin hormone's subunit A DNA and the aminoacid sequence of prediction thereof.

Fig. 8 has described the nucleotide sequence of human inhibin hormone's subunit B DNA and the aminoacid sequence of prediction thereof.

Fig. 9 shows 58KD statin (I) and 31KD statin (II) and molecular weight standard (S on the SDS-PAGE gel; The size of representing with KD) structure of comparing (A) and the natural statin of 58KD of ox change into the statin of 31KD form after the incubated overnight in calf serum (SS) and human postclimacteric serum (PMS), determine (B) by the radioactivity of measuring undiluted SDS-PAGE gel film.

Figure 10 has described to obtain the strategy of the global cDNA of subunit A.

The connector that Figure 11 has described to be used to make the cDNA of subunit A and B to express.

Figure 12 shows the collection of illustrative plates of plasmid pBTA302, pBTA303 and pBTA304.

Figure 13 shows the expression of statin subunit fusion rotein and beta-galactosidase enzymes in the coli strain.

Figure 14 shows the strategy of the global cDNA that builds up former preceding subunit A.

Figure 15 shows with the FSH level in the serum of the rabbit of synthetic peptide immunity.Arrow is indicated inoculation time.

Use following abbreviation herein.

The ATP adenosine triphosphate

The bFF bovine follicular fluid

The bp base-pair

The cDNA complementary DNA

The CG human chorionic gonadtropin

Ci Curie

D dalton

DATP 2 '-deoxyadenosine triphosphate

DCTP 2 '-deoxycytidine triphosphate

DGTP 2 '-deoxyguanosine triphosphate

The DNA DNA

The DTT dithiothreitol (DTT)

DTTP 2 '-deoxythymidine triphosphate

The EDTA ethylenediamine tetra-acetic acid

The immunosorbent assay that the ELISA enzyme connects

The FSH follicle-stimulating hormone

* g gravitation multiple

The g gram

The HPLC high pressure liquid chromatography (HPLC)

K (prefix) thousand

L (prefix) rises

The M molar concentration

M (prefix) in the least

The mol mole

The mRNA mRNA

P (prefix) is slight

N (prefix) millimicro

The PAGE polyacrylamide gel electrophoresis

The PCMB parachloromercuribenzoic acid

The human postclimacteric serum of PMS

PMSF phenyl methyl sulfuryl fluoride

The priatin of PMSG pregnancy period mare

The RIA radio-immunity detects

RNA ribonucleic acid

The RP-HPLC reversed-phase HPLC

The SDS dodecyl sodium sulfate

The SS calf serum

The Tris trishydroxymethylaminomethane

μ (prefix) is little

In addition, the following noun that defines herein and use can exchange, no matter its origin or glycosylation situation are how:

Big subunit=amino acid His1 to Ile300(Fig. 5 of subunit A=43KD subunit=58KD inhibin)=amino acid His1 to Ile306(Fig. 7).

Big subunit=the amino acid of subunit Ac=20KD subunit=31KD inhibin Ser167 to Ile300(Fig. 5)=amino acid Ser172 to Ile306(Fig. 7).

A _NThe NH of fragment=subunit A₂-end portion=amino acid His1 to Arg166(Fig. 5)=amino acid His1 to Arg171(Fig. 7).

Small subunit=amino acid Gly1 to Ser116(Fig. 6 and Fig. 8 of subunit B=15KD subunit=58KD and 31KD inhibin).

The application that phrase " has similar immunocompetence " refers to comprise a kind of albumen, it suppresses to have enough homologys with inhibin or part, to such an extent as to the immune system of (1) acceptor to its reaction with the same of native protein or (2) are used the antibody that this albumen produces and can identify endogenous inhibin.

Will be understood that also noun " part inhibin " comprises the subunit of inhibin.

The method and the product of this work have been described in detail in detail below, have will be understood that, for those skilled in the art, also exist the different methods that can be put to use, but these methods have all fallen into major programme of the present invention.

Example 1

From the ox granulosa cell, separate messenger RNA(mRNA) (mRNA)

Whole testis and ovary or isolating sertoli's cell and granulosa cell all can be used as statin mRNA source.Use isolating granulosa cell in this example.

Granulosa cell be collected in nearby slaughterhouse, utilize pin and syringe, from the large follicle on fresh bovine ovary surface, collect the ox liquor folliculi (bFF) that contains granulosa cell.After getting back to the laboratory, the liquor folliculi stored frozen that will just collect immediately.Cell among 70～100 milliliters of bFF centrifugal 5 minutes with 500xg takes out supernatant liquor as the purifying natural statin.RNA in the cell such as following method are extracted.

2.RNA extraction and after purifying collects granulosa cell, the different sulphur cyanogen of 4.2M, 120mM mercaptoethanol, the 5%(volume/volume that add 24 milliliters immediately) sacrosyl, 10mM Tris-Hcl pH7.4 make its dissolving (Chirgwin, J.M. etc. (1979), 5294～5299 pages of Biochemistry 18 volumes).With solute in Sorvall Omnimix type refiner with the 4th grade of 30 seconds of speed homogenate, then with 20, centrifugal 15 minutes of 000xg is to remove cell debris.In per 2.5 milliliters of supernatant liquors, add 1 gram CsCl.This mixture placed on 9 milliliters the liner of 5.7M CsCl, 10mM EDTA, 50mM Tris-HCl pH7.8 15 ℃ with 122, centrifugal 65 hours of 000xg.

RNA is deposited in 5 milliliters 70% ethanol, 30%TE(1mMEDTA, 10mM Tris-HCl pH7.5) the middle washing several times to remove CsCl.At last, 3M sodium-acetate and 6 milliliters of ethanol of adding 0.3 milliliter of pH7.5 in 3 milliliters of TE make its precipitation, are iced to-70 ℃ and with 20 then, centrifugal 10 minutes of 000xg.Before taking, be dissolved in RNA precipitation among 1 milliliter of TE and be kept at-70 ℃.

3.mRNA the chromatography of separation by on oligomerization dT Mierocrystalline cellulose, mRNA is extracted from total RNA (Aviv.H. and Leder, P.(1972), Proc.Natl

1408～1412 pages of Acad.Sci.USA 69 volumes).RNA is mixed with the solution of 1M NaCl, 1mM EDTA, 20mM Tris-HCl pH7.5, is heated to 70 ℃ and kept 2 minutes, the cellulosic post of oligomerization dT (a bed dry weight is 0.5 gram) (BRL company product) on the rapid freezing back in frozen water.During with upper prop cross the heating of post solution, freezing after upper prop again, repeat twice.Wash post with 5 milliliters of column-loading buffers, then with 5 milliliters of same buffer solution elution that contain 0.5MNaCl.MRNA is gone among the TE at 60 ℃ of wash-outs.Fraction collection (0.25 milliliter) elutriant makes the mRNA precipitation that contains in the elutriant with sodium-acetate and ethanol (referring to top), makes precipitation vacuum-drying then.MRNA is dissolved among 0.1 milliliter of TE again, is divided into 25 microlitres-70 ℃ of following stored frozen.

From extract by these and general collection part of the RNA elutriant that purification step obtains take out 1～2 microgram sample, electrophoresis detects (Locker, J.(1979), Anal.Biochem.98 rolls up 353～367 pages) on agarose-urea gel.Especially, with the RNA sample among the 10 microlitre TE be heated to 70 ℃ two minutes, also contain 5M urea and 0.01%(weight/volume among this TE) tetrabromophenol sulfonphthalein and the swimming lane dyestuff of one of xylene cyanol FF, electrophoresis in 1.5% sepharose contains 5.6M urea, 14mM acetic acid iodine, 1mM EDTA, 36mM NaH in this gel then ₂PO ₄, 40mM Tris-HCl pH7.4.When the tetrabromophenol sulfonphthalein dyestuff arrives the gel bottom, stop electrophoresis, under UV-light, observe RNA with bromination 3.8-diamino-5-ethyl-6-phenylphenanthridineand dyeing back.

By determination of light absorption its concentration of RNA at 260 millimicrons of places, when using 1 centimetre light path, the A of every milliliter 40 microgram RNA ₂₆₀Reading is 1.0.For typical operation, 60～100 milliliters of bFF will produce the granulosa cell precipitation of 1～3 gram weight in wet base, therefrom can extract total RNA of 600～900 micrograms and 20～60 microgram mRNA.

Contain single-minded mRNA in statin, statin subunit or similar statin polypeptide among this a part of mRNA, but will be appreciated that, this part mRNA is the mixture of the different mRNA that differ of a large amount of content, and the major part in this mixture all is unwanted.

CDNA below synthesizes and connects in the step of tail, the process of each cDNA experience is all similar to single-minded mRNA in statin, statin subunit or similar statin polypeptide, their existence causes a large amount of unwanted clones' generation the most at last, therefore a screening process must be arranged to differentiate required clone, promptly those contain the clone of the cDNA sequence of encoding part statin, statin subunit or complete statin.

Prepare cDNA and the strategy that this cDNA incorporates carrier pBR322 into is shown in Fig. 1 from mRNA, and in example 2 and 3 more detailed description is arranged, but only limit to illustrate.

Example 2

Copy (cDNA) from the mRNA synthetic DNA

1. a cDNA chain synthetic set up a kind of dATP content measured response mixture, therefrom take out sub-fraction with monitoring by α- ³²The combination of PdATP and the degree of synthetic cDNA.Add excessive dATP then in the main body reaction mixture, it is all synthetic that first chain is able to.Especially, the sample (2 microgram) of a mRNA prepared product is made into the aqueous solution of 27 microlitres, 70 ℃ of heating two minutes, freezing in frozen water rapidly then.Reaction starts by adding 23.5 microlitre mixtures, contains 500 nanogram(ng) oligomerization dT in this mixture _10-17Primer (Boeh-ringer company product), dCTP, dTTP and dGTP respectively are the DTT of 50 nanomoles, 5 nanomole dATP, 100 nanomoles, the AMV ThermoScript II of 20 units (Life Sciences product), 2 micromole KCl, 400 nanomole MgCl ₂With 2.5 micromolar Tris-HCl pH8.5.

Set up analytical reaction liquid after the stirring immediately, get 2 microlitre samples and put into another test tube, wherein contain 0.5 microlitre α- ³²P dATP(1800 residence/nanomole; 5 microcuries/microlitre), in reactive agent, add the dATP of 0.5 microlitre 60mM then, be placed on 42 ℃ and kept 60 minutes.From analytical reaction liquid, take out 0.5 microlitre, freezing rapidly with as zero time control in ethanol one the dry ice bath.Residual reaction liquid places 42 ℃ to keep 60 minutes, and then takes out 0.5 microlitre and be used for analyzing.

With the sample of each part tool radioactivity at the 0.75M of pH3.5 KH ₂PO ₄Carry out polymine (PEI) Mierocrystalline cellulose (Merck company product) thin-layer chromatography in the damping fluid.Autoradiographic the results are shown among Fig. 2.In this way, unconjugated Nucleotide is removed from new synthetic first chain (DNA RNA hybrid), and first chain rests on the chromatography initial point.Downcut independently spot after the radioautograph, measure the radioactivity that is incorporated into, to provide the estimated value of joint efficiency.We think, 10% combination (the highest estimated value of bonded is 33%) or bigger ratio of grand total will help carrying out the synthetic of cDNA second chain.Remaining radioactivity material is with 2M ammonium acetate, 67% ethanol sedimentation twice, and carries out agarose-urea gel electrophoresis after seething with excitement two minutes in column-loading buffer (seeing above-mentioned), with isolation of RNA and DNA chain.Make gel radioautograph on the RX of Fuji type x-ray film then.This program provides the estimated value of cDNA product size, the cDNA scope that typical operation is produced from more than 1000 bases to being less than 200 bases.

By other program that this area professional knows, also can carry out the synthetic of first chain.In this example, have a mRNA synthetic cDNA chain in polyadenous glycosides zone as primer from all with oligomerization dT.Also can arbitrarily use other primer from the synthetic cDNA of mRNA.In addition, the primer that has with some part complementary sequence of statin mRNA also can be used for synthetic single-minded in the cDNA of statin.Has the primer that can be used as synthetic first chain with the oligomerization dT of some part complementary sequence of statin mRNA or other primer.

2. the synthetic strategy of utilizing a similar synthetic cDNA chain of second chain obtains main body and analytical reaction liquid from the reaction mixture of initial shortage dATP.

Particularly, the 3M ammonium acetate and the 200 microlitre ethanol that add 50 microlitre pH7.5 in the cDNA-RNA hybrid molecule of the first chain main body reaction solution make it precipitation, are refrigerated to-70 ℃ then, with 15, and centrifugal 5 minutes of 000xg.Precipitation is suspended among the 50 microlitre TE, and precipitates once more, carries out drying then, is dissolved at last among the 50 microlitre TE.

Add 350 microlitre solution therein, this solution contains each 16 nanomole of dCTP, dTTP and dGTP, 1 nanomole dATP, 3.5 RNA of unit enzyme H(BRL company products), 92 unit dna polymerase is (Boehringer company product), 40 microgram BSA, 6 nanomole β-NAD, 400 nanomole (NH ₄) ₂SO ₄, 4 micromole KCl, 200 nanomole MgCl ₂With 800 nanomole Tris-HCl pH7.5(Gubler, U. and Hoffman, B.J.(1983), 263～269 pages of Gene 25 volumes).

Set up analytical reaction liquid after the stirring immediately, got 2 microlitre samples and put into another test tube, wherein contain 0.5 microlitre α- ³²P dATP(1800 Curie/nanomole; 5 microcuries/microlitre), in the main body reaction solution, add 2 microlitre 10mMdATP then, be placed on 15 ℃ and kept 60 minutes, kept 60 minutes at 22 ℃ then.Zero the time, when 1 hour and 2 hours, from analytical reaction liquid, take out 0.5 microlitre sample, freezing rapidly in ethanol-the dry ice bath, as first chain synthetic described in method carry out thin layer chromatography analysis (Fig. 2).At least 5% combination in the grand total (estimating that maximum value is 8%) is considered to the good sign of the second chain synthetic effect.

By other program that this area professional knows, also may carry out the synthetic of second chain.Slightly lift the explanation of a few example below.

In this example, with archaeal dna polymerase, utilize single-minded in the DNA/RNA crossbred RNA enzyme (being RNA enzyme H) of RNA.Spendable different methods has, and the RNA from the synthetic first chain gained DNA/RNA crossbred may suffer destruction chemistry or zymetology, or separates with DNA, thereby makes DNA oneself become primer.Then, the synthetic archaeal dna polymerase or the ThermoScript II utilized of second chain carried out, and the hairpin loop that stays is by single-minded releasing hormone degraded in strand, as the Sl nuclease.

The third method comprises to be removed or degraded mRNA, then 3 of a DNA chain product '-end adds the tail of oligonucleotide (as oligomerization dC).Make a complementary oligonucleotide (as oligomerization dG) and this tail annealing with it, and as the primer that carries out second chain reaction by archaeal dna polymerase or ThermoScript II.Have the strand or the double-stranded DNA of the sequence consistent or similar, be used for the clone after also may obtaining by chemosynthesis with statin cDNA complementation.

Example 3

The foundation in ox granulosa cell cDNA library in the intestinal bacteria

1.cDNA the tail that connects make its precipitation with annealing from the sodium-acetate and the 800 microlitre ethanol that add 40 microlitre pH7.5,3M among the double-stranded cDNA of the second synthetic chain, be refrigerated to-70 ℃ and then, centrifugal 5 minutes of 000xg with 20.Deposit seeds is dissolved among the 50 microlitre TE again, with isopyknic phenol (earlier with the TE pre-equilibration) extracting twice, use the Anaesthetie Ether (earlier with the TE pre-equilibration) of 100 microlitres to extract again three times, the ammonium acetate and the 200 microlitre ethanol that add 50 microlitre 4M then make its precipitation, and that continues is refrigerated to-70 ℃.Different with the precipitation process of front, allow frozen mixture be back to room temperature earlier, then with 15, centrifugal 5 minutes of 000xg.This process assists in removing unconjugated Nucleotide.Deposit seeds is dissolved among the 50 microlitre TE, precipitates with ammonium acetate and ethanol again.Resuspending is in the TE of 30 microlitres after the vacuum-drying of deposit seeds process.

In 15 microlitre cDNA, add the damping fluid of same volume, contain 30 nanomole CoCl in this damping fluid ₂, 3 nanomole DTT, PH7.2 terminal enzyme (DNA) (BRL product) mixture of 1.5 micromole's cacodylic acid potassium, 5 microgram bovine serum albumin(BSA)s, 30 nanomole dCTP and 17 units freezing in ethanol-the dry ice bath after 3～5 minutes 37 ℃ of insulations, be heated to 65 ℃ then and kept 5 minutes.Before taking, the DNA that takes over tail is kept under-20 ℃.By being called the annealed method, this cDNA is attached in the commercially available pBR322 plasmid molecule that obtains removes (seeing Fig. 1 and table 2), this plasmid in restriction endonuclease PstI(BRL products catalogue No. 5355) action site outstanding 3 '-end contains about 24 dG residues.In this annealing process, the stable crossbred of the single urogenesis of dG of single tail of the dC of cDNA and plasmid.Because the PstI site is arranged in the beta-lactam enzyme gene of pBR322, therefore resulting plasmid is to the ampicillin sensitivity, but tsiklomitsin is had resistance.

The annealed method is, 2.5 microlitres had dC connect the cDNA of tail and about 0.5 microgram and have pBR322 that dG connects tail and be heated to 65 ℃ kept 5 minutes in containing the 50 microlitre TE of 0.1MNaCl, then 57 ℃ of insulations 2 hours.Then this solution was slowly cooled to room temperature in 1 hour, before further using, it is kept in the ice or freezing down at-20 ℃.

For those skilled in the art, the method that also has other will be gone in this cDNA insertion carrier molecule.For example, utilize the reaction be called the terminal enzyme (DNA) that connects the tail effect, any Nucleotide can be added to 3 of dna molecular '-end.Then, can and have the dna vector molecule annealing that complementary sequence connects tail with these molecules.Also can on the cDNA molecule, add the synthetic connector by the effect of dna ligase, this connector by the Restriction Enzyme effect after, can be the clone suitable dna sequence dna be provided.Also available constraints enzyme or DNA enzyme directly cut cDNA, and it is directly used in the clone.The dna molecular of blunt end directly can also be cloned in the carrier and go, such carrier comprises plasmid, Ke Shi plasmid (Cosmids), phage and other virus.

2. utilize D.Hanahan(1983 with recombinant plasmid transformed intestinal bacteria ED8654; J.Mol.Biol.(molecular biology magazine) method, 557～580 pages of 160 volumes) makes intestinal bacteria ED8654 be in competence, gets 0.2 milliliter competent cell and moves back the cDNA-pBR322 crossbred that overdoes with 10 microlitres and transform.After the conversion, cell is cultivated 2 hours in 2 milliliters of SOC nutrient solutions (the SOC nutrient solution is formed: 5 grams per liter yeast extracts, 20 grams per liter Tryptoness, 10mM NaCl, 25mM KCl, 20mM MgCl ₂, 20mM MgSO ₄, 20mM glucose), then with 2, centrifugal 5 minutes of 000Xg, again with cell suspension in 0.5 milliliter 0.85% Nacl solution, in order therefrom to select the cell of being crossed by pBR322 or recombinant plasmid transformed, with whole suspension distribution in every liter 5 gram of 280 millimeters LB(that contain 10 mcg/ml tsiklomitsin-hydrochloric acid yeast extract, 10 gram Tryptoness, 5 gram NaCl) on agar (the every liter 15 gram agar) flat board.Be incubated 48 hours down at 37 ℃.By this method, a typical conversion process can produce about 5 * 10 from every microgram pBR322 recombinant chou ³To 5 * 10 ⁴Individual clone, or produce about 10 from every microgram cDNA ⁴To 10 ⁵Individual clone.Show that for the random screening that the clone did the transformant that contains recombinant plasmid is generally more than 78% from 14 tetracycline resistances.

3. the preservation of transformant is drawn together the clone on each flat board among 10 milliliters the LB.To combine in a place by about 2,000 independent cells that obtain that transform, with 1, centrifugal 5 minutes of 500Xg is resuspended among 5 milliliters of LB (volume/volume), wherein adds 0.5 milliliter methyl-sulphoxide.Before using, be divided into 0.4 milliliter every part freezing in liquid nitrogen and be kept at-70 ℃.Aforesaid method can build up 5 such collection parts.

Because each initial conversion cell contains the dna molecular of a reorganization, and the dna molecular of these reorganization results from the complete or incomplete copy to the some mRNA molecules that exist in mRNA collection part, and the collection body of then such transformant or collection part are called as the library.In the example here, the library of ox granulosa cell cDNA is set up in intestinal bacteria.An eukaryotic cell approximately can synthesize 1 * 10 ⁴To 2 * 10 ⁴Plant different albumen, so, 10 ⁴The collection body of individual independently transformant should contain the composition that results from more various mRNA molecule.Obviously, the cDNA that most cells contain in these libraries does not have direct use, has only a few cell to contain the complete or incomplete copy of statin mRNA molecule, and the design of following method is exactly in order to differentiate these clones and to separate.

Example 4

Screening statin clone from the library

1. the preparation library that is used for screening is with the freezing cell fusing of a test tube, dilution 5 * 10 ⁵Doubly, get 0.5 milliliter then and be distributed in 280 millimeters LB agar plate surface that contain 10 mcg/ml tsiklomitsin-hydrochloric acid, 37 ℃ of following incubated overnight.Each flat board approximately can produce 10 ⁴Individual clone, each transformant in the therefore initial library has increased 1～5 times.The repeat replication thing is transferred on soluble cotton (the Schleider and Schuell company product) filter, with the agar of the needle-penetration filter that dips in prepared Chinese ink with as telltale mark.Former flat board was kept under 4 ℃ before using, and replica filter then opposite closes and contains the fresh LB agar plate of 10 mcg/ml tsiklomitsin-hydrochloric acid and be incubated 8 hours.Then they are transferred on the LB agar plate that contains 50 mcg/ml paraxin, incubated overnight, with the copy number (Clewell, D.B.(1972) J.Bacteriol.(bacteriology magazine) that improves recombinant plasmid in each cell, 667～676 pages of 110 volumes; Hanahan, D. and Meselson, M.(1980) Gene(gene), 63～67 pages of 10 volumes).According to the Grunstein that revised, M. and Hogness, the method (1975 of D.S.; Proc.Natl.Acad.The Sci.USA(Proc. Natl. Acad. Sci.USA), 72 volumes are 3961～3965 pages) filter is handled.The filter opposite was layered on 0.5MNaoH and 1.5MNaCl saturated last 15 minute of Whatman 3MM type filter paper (Whatman 3MMPaper) sheet, with the dissolving of promotion cell and the form of single stranded DNA, in 15 minutes, change the saturated filter paper of Tris-HCl of twice usefulness 1.5MNacl and 0.5MpH7.5 then, make it be back to neutrality.Through after the dry air, they are layered on the B also with 20 milliliters of CHCl ₃Saturated, the filtration of bleeding again.Then filter is placed vacuum oven to toast 2 hours down at 80 ℃.

2. strategy has been used oligomerization dezyribonucleoside (oligonucleotide) probe of radioactivity mark in order to differentiate that those contain the clone of the cDNA gene of whole or a part of statin.When designing these probes, make they and the complementation of part mRNA sequence, i.e. NH of those coding 43KD and 15KD subunit ₂The mRNA(probe 1 and 5 of-terminal amino acid sequence, Fig. 3).The NH of 43KD and 15KD subunit ₂-terminal sequence results from the complete statin of 58KD and separates the determined amino acid sequence of subunit, and 16 aminoacid sequences of each subunit front are found in International Patent Application PCT/AU85/00119.Then, (determine by from the complete statin sequence of 58KD, removing the 43KD subunit by the cDNA sequential analysis among pBTA22 and the pBTA23, referring to embodiment 6 the 1st joint) aminoacid sequence, the initial analysis of 15KD subunit is expanded and precision, as shown in table 1.This Accurate Analysis has pointed out to can be used for preparing another section of oligonucleotide probe, i.e. from 20 to 24 amino acid section.Fig. 3 has shown prepared oligonucleotide probe (probe 2).It is 14 polymers of the degeneracy of one 24 folding, and is used to separate pBTA293 and pBTA294.Be its coded DNA password because each amino acid (except that methionine(Met) and tryptophane) all has more than one, therefore be necessary in probe, to comprise into all possible codon combination.Like this, be the Most amino-acids sequence that the big subunit of statin chooses, have 64 kinds possible for its coded DNA sequence (probe 1, Fig. 3), the dna sequence dna that is encoded to the Most amino-acids sequence that the statin small subunit selects have 24 kinds may (probe 2, Fig. 3).In order to obtain the representative molecule in these sequences most possibly, probe 1 be with four independently synthetics merge and obtain, they from 5 '-2 and 6 of terminal number have dG and dA or dT and dA or dG and dG or dT and dG respectively.2 of probes are by disposable synthetic obtaining.

3. the synthetic and purifying oligonucleotide probe of oligonucleotide is by means of automatic dna synthesizer (Applied Biosystems Inc.(Applied Biosystems, Inc.), 380A type) synthetic.According at first by Matteucci, M.D. and Caruthers, M.H. the method (1981 that finds out, J.Amer.Chem.Soc.(U.S. chemical institute magazine), 3185～3191 pages of 103 volumes), this machine can sequencing ground with N, N '-di-isopropyl imino-phosphoric acid ester dezyribonucleoside derivative is coupled on the arm of deriving of the micropore glass upholder under the control continuously.

The schedule of operation that we have used Applied Biosystems, Inc. to recommend.By replacing imino-phosphoric acid ester dezyribonucleoside mixture, on the single matrix of deriving, produced the oligonucleotide of degeneracy.By containing the 20%(weight/volume) acrylamide, 1.0%(weight/volume) N, N '-diacrylamine, 1mM EDTA and 50mM transfer to pH with solid boric acid the preparative gel electrophoresis (1.5 centimetres of 20 cm x, 20 cm x) of 8.3 Tris, and oligonucleotide purifying from too early terminated oligonucleotide is come out.Electrophoresis carried out 1.5 hours under 500 volts of voltages, then gel was placed the KieselgelF254(Merck product) chromatographic sheet on, under UV-light, observe oligonucleotide.Oligonucleotide presents the black band shape.They are separated to be placed in 0.8 ml sterile water spend the night, oligonucleotide is eluted from gel.The photoabsorption of measuring oligonucleotides at 260 millimicrons of wavelength to be estimating its wash-out concentration, when utilizing 1 centimetre light path, and the A of every milliliter 35 microgram single stranded DNA ₂₆₀Reading is 1.0

4.5 ' one end labeled reactant in the oligonucleotide of purifying to its 5 '-end adds ³²The bound phosphate groups of P-mark can make them have radioactivity.

Especially, make the oligonucleotide of 40 pmols and the γ of 40 pmols- ³²PATP(2000 Curie/milli rubs; 5 microcuries/microlitre) freeze-drying under low pressure is dissolved in 20 microlitres then and contains 4 T of unit ₄Polynucleotide kinase, 10mMMgCl ₂, 10mM DTT, 1mM spermidine and pH7.5 the damping fluid of 50mMTris-HCl in, and 37 ℃ of insulations 90 minutes down.

With the oligonucleotide purifying of aforesaid method, its radioautograph on the RX of company of Fuji type x-ray film is observed after 5 minutes with the tool radioactivity.In 0.8 ml sterile water, spend the night and carry out wash-out.The common probe 1(that forms is referring to example 1 the 2nd joint) 4 collection part of oligonucleotide, each part is all handled respectively after this step its merging.

The statin of 58KD is cut off and alkylation, and the subunit of cut-out separates by electroelution from the SDS-PAGE gel.Statin (80 pmol), subunit A(17 pmol with 58KD) and subunit B(6 pmol) in gas phase sequentor, carry out Edman degraded.

(Xaa)=from the definite amino acid of cDNA sequence.

Xaa ^*=from the double-stranded sequence of 58KD statin, remove the amino acid of differentiating after the subunit A sequence.Show as the following ledger line in the zone of design oligonucleotide probe.

5. utilize probe screening library the probe of each tackling radioactivity to be inserted (20 * SSC is the trisodium citrate of 3M Nacl, 0.3M pH7.0 in the solution of 40 milliliters of 5 * SSC, 10 * Denhardt; The solution of 50 * Denhardt is the 1%(weight/volume) Ficoll, 1%(weight/volume) polyvinylpyrrolidone, 1%(weight/volume) bovine serum albumin(BSA)), each filter of representing each library is immersed in solution, under slight the stirring, spending the night.

With 1 * SSC, 0.1%SDS(sodium laurylsulfonate) solution washing nozzle repeatedly at room temperature, use the RX type x-ray film of company of Fuji and Dupont Cronex Hi Plus intensifying screen-70 ℃ of following radioautograph 3～5 hours then.With film development, filter under 37 ℃, wash in 1 * SSC, 0.1%SDS, spends the night then and carries out radioautograph again.

At room temperature after the washing, any than the thicker close zone of background, perhaps in 37 ℃ of following visible zones still after the washing, and, all be considered to potential statin clone corresponding to the zone of bacterium colony position on the original flat board.

Previous examples has been described certain methods and a strategic plan, according to this strategic plan, can obtain to contain the cell of the dna sequence dna of statin or similar statin, but this and do not mean that method or the strategic plan of getting rid of other.For example, might utilize genomic dna, therefore can not need synthetic (referring to the example 8) of cDNA as initiate dna.And cloning vector can be the carrier that the dna fragmentation of wherein being cloned obtains expressing, and screening procedure is based on antiserum(antisera) (seeing example 10) that utilizes anti-statin or the biological activity that directly detects statin or similar statin.These methods are well-known to one skilled in the art.

Example 5

Suppose clone's feature

1. potential statin clone's purifying will take off corresponding to the zone of black splotch on the self-developing film, and it is streak culture to carry out single bacterium colony on the LB flat board that contains 10 mcg/ml tsiklomitsin-hydrochloric acid, 37 ℃ of insulations 16 hours down.Before using, these flat boards are repeated to be kept at 4 ℃.Filter placed on the LB agar that has tsiklomitsin-hydrochloric acid 3～6 hours, and be transferred to last 16 hour of LB agar of containing 50 mcg/ml paraxin then, then as described above with the bacterium colony dissolving, the oligonucleotide probe of apparatus radioactivity screening once more.Will corresponding on the self-developing film the most single bacterium colony of dark spot take off from these filters, carry out streak culture once more and analyzed.

2. the restriction map of plasmid DNA utilizes excision and the Degradation of restriction endonuclease PstI, has analyzed the plasmid DNA content in the statin clone and separate thing of at least one supposition.This enzyme discharges cDNA and inserts section from plasmid, can also it be cut off the arbitrary PstI action site on cDNA.The extraction of plasmid DNA is based on the method (1979 of Birnboim and Doly; Nucl.Acids Res.(nucleic acids research), 7 volumes are 1513～1523 pages).The culturing cell that spends the night in 3 milliliters of LB is centrifugal with cultivating, and is resuspended in 0.2 milliliter of dissolving damping fluid (50mM glucose, 10mM EDTA, 0.2% N,O-Diacetylmuramidase, 25mMTris-HclpH8.0), is incubated 10 minutes down at 0 ℃.Add 0.4 milliliter of alkaline SDS(0.2MNaoH1%(weight/volume therein) SDS), after 10 minutes, add the 3M sodium-acetate of 0.3 milliliter of pH4.8 again 0 ℃ of insulation.After under 0 ℃ 15～30 minutes, with centrifugal the removing of white precipitate that produces.In 0.8 milliliter of supernatant liquor, add 0.7 milliliter of Virahol, make plasmid precipitation wherein, be refrigerated to-70 ℃ after with 15,000 * g centrifugal 5 minutes.Centrifugal gained precipitation is dissolved among 0.4 milliliter of TE, and sodium-acetate and 0.8 milliliter of ethanol of adding the 3M of 40 microlitre pH7.5 make it precipitation, and as above-mentioned freezing and centrifugal.Be dissolved among 0.2 milliliter of TE after making final throw out vacuum-drying.Take out the sample of 20 microlitres, PstI(Boehringer company product with 20 units) be 37 ℃ of degradeds 60 minutes down in the TA damping fluid (66mM Potassium ethanoate, 10mM magnesium acetate, 0.5mMDTT, 0.1 mg/ml BSA, 33mM Tris-acetate pH7.9) of 40 microlitres at final volume, wherein also contain 10 mcg/ml RNA enzyme A, in tbe buffer liquid (2.5mMEDTA, 133mM Tris, 89mM boric acid), carry out polyacrylamide gel electrophoresis (high to 10% acrylamide, 0.27% diacrylamine) then.With AluI(Boehringer company product) sample of the pBR322 of degraded is as the standard of molecular size.The initial clone who differentiates lists in table 2.

3. sequencing is strategic with the suitable limited enzymatic hydrolysis fragment of polyacrylamide gel electrophoresis purifying (producing with the one or more enzymes in Pst I, Pvu II, Sau3A I or the Sma I), in 0.5M ammonium acetate, 10mM magnesium acetate, 0.1M EDTA, 0.1%SDS, under 37 ℃, spend the night its wash-out from gel, then with ethanol sedimentation and be dissolved among the TE, according to Sanger F.Dideoxy chain termination (1977 Deng the people; 5463～5467 pages of Proc.Natl.Acad.Sci.USA.74 volumes), utilize universal primer (17 polymers, 1211 or No. 1212, NewEngland Biolabs product) or with the complementary oligonucleotide primer of cDNA own, with its subclone in the replication form of bacteriophage M13mp8 and M13mp9 to treat sequencing.For the cDNA that separates overlapping, from the cDNA expansion known array of overlapping or from the sequencing of dG/dC tail end, very useful with the complementary oligonucleotide primer of cDNA own to the cDNA centre.

(see example 10) in all sequencings, subclone and expression work, Restriction Enzyme all is to use T in TA damping fluid (example 5 the 2nd joint) ₄Ligase enzyme (Boehringer company product) uses according to the producer's explanation.

(1) number at .Biotechnology Australia Pty.Ltd. culture collection center.

(2). size (if providing) is the base pair of roughly measuring by polyacrylamide gel electrophoresis, with the pBR322 of AluI degraded as standard.These numerical value and determined dna sequence gained actual size are slightly variant.

(3) .Murray, N.K. etc. (1977).Mol.Gen.Genet.(gene molecule genetics), 150 volumes are 53～61 pages.

(4) .Bolivar, F. etc. (1977), Gene, 95～113 pages of 2 volumes.

(5) .BTA647=e. coli k12, hsdR _K, supE44, supF58, lac Y1, galT22, galK2, trpR55/FlacI ^q, △ (LacZ) M15, LacY ⁺A ⁺, ProA ⁺B ⁺, tra ⁺

(6) .Ruther, U. and Muller-Hill, B.(1983) EMBOJ.(EMBO magazine), 1791～1794 pages of 2 volumes.

(7) .BTA634=e. coli k12 △ (lac, pro), supE(glnV), thi, lon-1, Zaj::Tn5/F ' proA ⁺B ⁺, lacI ^q, △ (lacZ) M15, lacY ⁺A ⁺, traD36.

(8) .pBTA286 is the derivative of pUR291, and wherein, the HpaI-AvaIDNA fragment of 2355 base pairs is excised from the encoding sequence of acZ gene, and encoding sequence is still stayed in the password.

(9) .BTA652=e. coli k12 △ (lac, pro), thi ^-, supE(glnV) 44, hsdR _K17endA1, gyrA96, relAl/F ' proA ⁺B ⁺, lacI ^q, △ (lacZ) M15, lacY ⁺A ⁺TraD36.

(10) .Viera, J. and Messing, J.(1982) the Gene19 volume is 259～268 pages.

(11) .BTA545=e. coli k12 thi ^-, △ (lac, argF), U169 △ (lon) 100, hf1150, Zjelzjf::Tn10, rpsL, hsdR _K/ F ' lacI ^q, △ (lacZ) M15, lacY ⁺A ⁺, proA ⁺B ⁺, tra ⁺

（12）.BTA637＝BTA652、Lon ^-1、zaj：：Tn5。

Example 6

The clone of statin

1. clone subunit A(43KD) at first uses probe 1(Fig. 3) obtain two plasmids into part 43KD subunit coding, i.e. pBTA22 and pBTA23.Their sequential analysis shows that its cDNA length is incomplete, so, prepared special oligonucleotide probe, to separate from pBTA22(probe 3) 5 ' one ends and from pBTA23(probe 4) the cDNA of 3 ' one ends expansion.PBTA290 separates with probe 3 and obtains, and pBTA30 separates with probe 4 with pBTA295 and obtains.

Fig. 4 has provided the collection of illustrative plates of PstI and has measured the strategy that plasmid cDNA inserts the section sequence, and Fig. 5 has shown the compound nucleotide sequence for subunit A coding.This sequence is completely contained among the cDNA of plasmid pBTA290 and pBTA295.The fragment of 410 base pairs of pBTA30 contains terminator codon, nestles up its 3 ' one ends, and the non-zone of translating of 6 bases was arranged before the tail end of dG/dC.The CAG of the His1 of coding subunit A is positioned at the PstI enzyme of pBTA22, pBTA23 and pBTA290 and cuts segmental 5 ' one ends of cDNA, but the PstI enzyme that is not present in pBTA30 is cut cDNA segmental 240 or 300 base pair places.These two fragments all do not have open code system or the sequence consistent with other clone read, and therefore, they may represent the part of a non-overlapping intron.

In the cDNA sequence, contain an opening from base 1 to 1140 and read code system.Read in the code system at this, first ATG is positioned at base 61(Met-60), aminoacid sequence followed by Met-60 is a signal peptide, but it is different with most of signal peptides, before hydrophobic leucine string, there are not arginine or Methionin (Watson, M.E.E.(1984) the Nucl.Ac.Res.12 volume is 5145～5164 pages).Expect that this signal peptide ends between Gly-44 and the Gly-41, before His-1, stay next about 40 amino acid whose propetides.Therefore, the subunit A of initial synthetic statin be one 38,810 dalton, albumen before Met-60 to Ile300 former.

Subunit A is by cutting the double arginine residue (2 in the precursor,-1) produce, that is a general signal (Steiner, D.F. etc. (1980) in the proteolysis course of processing of amyloid protein precursor, Ann.N.Y.Acad.Sci(NYAS annual), 343 volumes are 1～16 page).The preceding albumen of subunit A is-6 ,-5; 8,9 and 165,166 positions also include three pairs of arginine residues.Subunit A is cut at residue 165,166 places, with produce two we be called two fragments that size is similar of AN and Ac.Segment A c has constituted the 20KD subunit (seeing example 9) of 31KD ox statin.Prediction subunit A contains 11 cysteine residues, wherein has 4 from the AN fragment of His1 to Arg166.These 4 residues may form the chain internal key, make A _NFragment is separated from the Ac subunit.The Ac subunit contains 7 halfcystines, wherein has at least one may form cystine linkage with subunit B.Based on recognition sequence Asn-X-Ser/Thr, subunit A has two potential N-glycosylation sites (Wagh, P.V. and Bahl at Asn80 and Asn202 place, O.P.(1981), CRC Crit.Rev.Biochem.10 rolls up 307～377 pages), and Asn202 is comprised in the Ac subunit.The predicted molecular weight of subunit A and Ac protein chain is 32,298 and 14,624, and this approximately low 25%(of numerical value than the natural statin that SDS-PAGE measures is respectively 43KD and 20KD).This part may be that they may change its molecular weight and molecular volume owing to contain carbohydrate in the natural molecule.It seems A from these difference _NAnd A _CTwo portions all may be by glycosylation, perhaps just in Asn80 and Asn202 site, actually or but also unknown with Serine and Threonine formation oxo bridge in the glycosylation.The carbohydrate that contains among glycoprotein hormones such as ox LH, people CG and the PMSG is estimated as respectively and accounts for 16%, 29～31% and 45%(Pierce of weight, J.G. and Parsons, T.F.(1981), Ann.Rev.Biochem.(bioid academic year comments), 465～495 pages of 50 volumes), therefore, perhaps the numerical value that accounts for apparent molecular weight about 25% that we record represented the lower limit of this scope.

The sequence of cDNA points out at 3 of the mRNA of 42 bases '-end a non-zone of translating is arranged.Its 16 base place before polyadenous glycosides tail end comprises a typical polyadenous glycosides signal (AATAAA) (Nevins, J.R.(1983) the Ann.Rev.Biochem.52 volume is 441～466 pages).With encoding sequence (66.3%G+C) and 5 '-end the non-zone (71.6%G+C) of translating different, 3 '-end the non-zone of translating be rich in A+T(40.4%G+C).

2. clone subunit B(15KD) has detected five independently clones with probe 2, and Fig. 4 has shown the wherein cDNA of the subunit B of two encoding matures.Other three cDNA that contain the restricted sequence similar to pBTA293, but 5 '-the PstI fragment of end is shorter.

The nucleotide sequence of subunit B cDNA is obtained from the sequencing (Fig. 6) of pBTA293 and pBTA294.Subunit B is former proteic form synthetic at least, and similar to the Ac subunit, and preceding protein specificity is positioned at the C end.It is separated by 5 successive arginine residues and preceding protein part.As if it contains two pairs of arginine residues in 13,14 and 102,103 positions, but they are not processing sites (Steiner, D.F. etc. (1980) are referring to top).It also has nine cystine residues, and this odd number is pointed out us, wherein has at least one can form the interchain bridged bond with the Ac subunit.Can predict that from the cDNA sequence molecular weight of subunit B protein chain is 12,977 dalton, this apparent molecular weight of 14,900 with the natural subunit B that measures with the SDS-PAGE method is approximate.In sophisticated subunit B, do not have tangible N-glycosylation sequences, but Asn-145 in the albumen may be by glycosylation before former.

The non-zone of translating of 3 ' one ends of subunit B reaches 94 Nucleotide, and different with the cDNA of coding subunit A, does not have the polyadenous glycosides signal of AATAAA.3 ' one ends are non-translates last 12 bases before the polyadenous glycosides in the zone, (Jacobs, K etc. (1985) the Nature(nature) 313 that match closely with non-last 12 bases of translating of 3 ' one ends of the erythropoietin cDNA that does not also have the AATAAA sequence rolled up 806～810 pages).With subunit A coding region and 3 '-the non-difference of translating between the district of end is different, the G+C content of subunit B coding region (base 157 to 504) is 54.2%, 3 '-the non-G+C content of translating the zone of end also similarly (55.3%).

Example 7

The discriminating of the dna sequence dna of similar ox statin in the genomic dna

To coding ox statin big (43KD) and the similar or homologous sequence of little (15KD) subunit gene, in people, sheep, pig, fish and chicken genomic dna, obtained discriminating.

This is (the Maniatis T. etc. (1982) that southern-blot method (Southern Blot) hybridization technique by routine is finished basically." molecular cloning ", Cdd Spring Harbour publishes).Genomic dna separates the fragment of different sizes basically with the Restriction Enzyme degraded with agarose gel electrophoresis.DNA is transferred on soluble cotton (or the other) film, then with most of protein chain in coding ox statin 43KD or the 15KD subunit ³²The cDNA of P-mark is hybridized with it as probe.Even can detect the similar consistent genomic DNA fragment of nucleotide sequence like this.

Genomic dna is to be U937(ATCC CRL1539 from human macrophage respectively) or human blood, pig blood and chicken blood or from the soft tissue of ox and sheep, prepare.From the method for soft tissue and human cell line preparation basically with front Maniatis T.Deng the described unanimity of people's article.Prepare the method for DNA such as following from blood: 10～15 milliliters of blood (+0.625% Citrate trianion) are with 10mM EDTA, 10mM Tris-Hcl pH7.5(TE10-10) cold soln be diluted to 40 milliliters, place on ice and made globulolysis in 5 minutes.Precipitation is suspended in the cold soln of 10 milliliters of TE10-10 after centrifugal 5 minutes with 4000Xg, is diluted to 40 milliliters, centrifugal 5 minutes with 3000Xg with TE10-10.It is isopyknic to be deposited in 10mM Tris pH7.5,5mM EDTA(and initial blood) disperse in the solution.Add the concentration of 10% SDS to 0.5%, add Proteinase K to 50 mcg/ml, mixture is 37 ℃ of following incubated overnight and light and slow shaking in addition.Add 10 milliliters saturated and contain the phenol of 0.1% oxine with 0.1mM Tris-Hcl pH8.0, at room temperature stirred gently 5～10 minutes.Add 10 milliliters of CHCl ₃: primary isoamyl alcohol (24: 1) also stirred 5～10 minutes, with 8000Xg at room temperature centrifugal 10 minutes then.Water is with 15 milliliters of CHCl ₃: more than the primary isoamyl alcohol extracting twice.5MNaCl and 2 times of volume of ethanol of at room temperature adding 1/20 volume also stir.DNA took out with Pasteur's pipette, and dry air is dissolved in after 30～60 seconds among 4 milliliters of TE, 37 ℃ of slight down stirrings 3 hours.DNA such as above-mentioned precipitation once more also are dissolved among 3 milliliters of TE again.

According to the producer's explanation, under 40～50 mcg/ml concentration with the soaking time that is up to 500 units per ml enzyme concns and 16 hours, with various restriction endonuclease this DNA sample (generally getting 10 micrograms) of degrading.Products obtained therefrom is removed albumen with the equal-volume phenol extraction, and then uses chloroform extraction three times, is deposited among the 0.2MNaCl with 2.5 times of volume of ethanol then.Sedimentary DNA is soluble in water, in the TAE damping fluid on 11 * 14 centimetres sepharose electrophoresis (75 volts, 4 hours), to separate the DNA of different sizes.Gel is dipped in 1.5MNaCl, the 0.5MNaoH solution made the DNA sex change in 45 minutes, be dipped in for twice then among 3.0MNaCl, the 0.5MTris-Hcl pH7 and made it to get back to neutrality in 45 minutes.Utilize wicking action that DNA is transferred to (Schleicher and Schuell company product) on the nitrocellulose membrane, made it fixing in 2 hours at 80 ℃ of following vacuum bakeouts.These filters with contain 50% methane amide, 5 * SSPE(Maniatis etc., referring to the front), the herring sperm dna crossed of 5 * Denhardts and 25 mcg/ml ultrasonication hybridized 2～4 hours in advance.

Hybridization probe is as follows:

1), from the SphI-SmaI fragment (Fig. 5) of 790 base pairs of the cDNA gene of subunit A among the pBTA23.

2), derive from the Niu Yaji B clone's of pBTA293 the SphI-EcoRI fragment (Fig. 4) of 1109 base pairs.It contains cDNA(Fig. 6 of subunit B at 361 to 718 base places), also contain the 751 base pair fragments at pstI to EcoRI point of contact among the pBR322.

These fragments are to be separated to from the gluing sepharose of low temperature behind electrophoresis, and according to Feinberg, A.P. and Vogel-stein, B.(1984) method described in the Anal.Biochem.137 volume 266-267 page or leaf with α- ³²PdATP carries out mark.

The mark of nearly 30 nanogram(ng) DNA is than reaching 2 * 10 by force ⁸To 2 * 10 ⁹Count per minute (CPM)/micrograms of DNA is with 3 * 10 ⁶To 4 * 10 ⁶After probe between the CPM is heated to 100 ℃, mix at the solution that contains the herring sperm dna that 1 * Denhardts, 50% methane amide, 5 * SSPE, 1 * Den-hardts, 10% dextran sulfate, 25 mcg/ml ultrasonication cross.Filter was hybridized 20 hours down at 42 ℃.At room temperature embathe filter with 2 * SSC, 0.1%SDS, respectively in 2 * SSC, 0.1%SDS, among 1 * SSC, the 0.1%SDS, under 50 ℃, embathed 30 minutes among 0.2 * SSC, the 0.1%SDS then.Hybridization conditions must make at least 70～75% reach hybridization with ox cDNA homologous sequence.Being exposed to the RX of Fuji type x-ray film after at least 24 hours, can be the size that standard is determined hybridized fragment with the dna fragmentation of known dimensions.

Provided the approximate size (base pair) of people, ox, sheep, pig and the chicken genomic DNA fragment of hybridizing below with Niu Yaji A or B gene probe height.

The DNA of each test has the fragment of certain number (be generally, minority reaches three with PstI degraded) and the probe hybridization of big or little ox statin subunit cDNA.But they have a common characteristic, and promptly all have a PstI fragment that is approximately 480 base pairs with the DNA of big subunit cDNA hybridization.These hybridized fragments show, in the biological species beyond the ox, also exist similar to the ox inhibin gene or the homologous gene.Do not get rid of such possibility, promptly do not have selected statin cDNA sequence of coming in probe may with the genomic dna hybridization that do not have in the table 3.

In another serial experiment, with the cDNA of Niu Yaji as probe in detecting subunit A among the mouse ovary RNA and the mRNA precursor of B.In the mouse ovary of handling with PMSG, find more horn of plenty of these mRNA, show that inhibin DNA can be used as diagnostic probe.

Therefore, the cDNA gene of coding ox statin subunit A and B can be used in the DNA and the RNA that differentiate the coding statin molecule in other biological gene group and the organ.Because this point, the statin molecule and the ox statin of their codings are homologous, and can be applied in a similar manner.

Example 8

Separating analogous human inhibin hormone's sequence from genomic dna

Separated the similar and homologous human DNA sequence of cDNA who has obtained to coding ox statin subunit A and B.This be by with the DNA library clone of people's gene group in lambda particles phage, use from the cDNA preparation of coding ox statin subunit A or B ³²The dna fragmentation of P-mark makes probe and plaque hybridization is finished.The phage DNA that separates positive plaque, with the restriction endonuclease degraded, for measuring its nucleotide sequence, dna fragmentation (utilizing probe and technology in the example 7 to determine by the southern-blot hybrid method) subclone that will contain similar statin is in M13.

Based on described methods such as top Maniatis, we have also set up people's gene group library in going into phage E MBL3, or in going into L47, set up people of the kind's genomic library (Loenen, W.A.M. and Brammar, 249～259 pages of W.J.1980Gere20 volumes).Human gene group DNA's (as preparation as described in the example 7) carries out the part degraded with Sau3AI, produces length and is approximately the right DNA of 5～30 kilobase.Get 12.5 micrograms of DNA and in TE and 1M NaCl, carry out sucrose gradient centrifugation to separate the DNA(McCarty of different sizes, K.S. etc. (1974), 165～183 pages of Anal.Bioehem.61 volumes), C in the used gradient _Mix=15%, Cr=31.5, Vm=34.45, aK=2.174, centrifugation time are 2 hours, and rotating speed is 50, and 000RPM uses Beckman SW50.1 type rotor.

From then on collect in the gradient and be about the right DNA of 15～25 kilobase, carry out ethanol sedimentation as carrier and be connected on the arm of EMBL3 with 5 microgram tRNA.DNA(U.S. Promega Biotec.MadisonWI company product with endonuclease BamHI and EcoRI degraded EMBL3), remove Deproteinization with phenol and chloroform extraction, under the temperature of the existence of 0.3M sodium-acetate and 0～4 ℃, precipitate with the Virahol of 0.6 times of volume.Right people DNA is 10mMTris-Hcl pH7.5, the 10mM Mgcl of 40 microlitres at volume to get 2.4 micrograms and about 1 microgram, 15～25 kilobase ₂, 1mM ATP, 20mM dithiothreitol (DTT), 2 T of unit ₄Mix in the dna ligase (Boehringer Mannheim company product), be incubated 20 hours down at 15 ℃.The Packagene(Promega Biotec company product that adds 95 microlitres) is incubated 2 hours down at 22 ℃.With restrictive host NM539 coating mixture (referring to the specification sheets of Promega Biotec company), its density is approximately on the every flat board of 14 centimetres of diameters 50,000 plaques.The mixture of above-mentioned reaction can produce 8 such flat boards.

People's gene group library among the phage L47 also is coated with into similar plaque density with NM539.

For the ease of probe hybridization with statin cDNA, according to the described method of people such as Maniatis (1982) plaque to be transferred on the nitrocellulose filter referring to top, each flat board is done two repetitions.The probe of mark is as follows: for the sequence corresponding to ox statin subunit A, use the SphI-SmaI fragment and the hybridization of λ L47 library of 790 base pairs among the pBTA297, use the BamH I-Hind III fragment (seeing Table 2) and the hybridization of EMBL3 library that contain subunit AcDNA among the pBTA297.The probe of small subunit is the SphI-EcoRI fragment described in the example 7.Preparation, mark and hybridization conditions are identical with southern-blot hybrid method described in the example 7.The screening first time for plaque includes two kinds of probes in the hybridization solution.

With potential positive plaque wash-out, coat dull and stereotyped going up with probe hybridization again until obtaining pure clone.There are two clones very useful, that promptly obtain and λ A2 big (A) subunit hybridization and that obtain from the EMBL3 library and the B1 hybridization of little (B) subunit from the L47 library.

A2 carries a right people DNA of about 11～12 kilobase and inserts section.It can be produced some fragments with PstI degraded, wherein have three fragments to merit attention, the usefulness of the A gene of they and ox ³²The SphI-SmaI fragment hybridization (as above-mentioned) of P-mark.Then produce two fragments (table 4) of hybridizing with the degraded of Pvu II with same probe.

1160 with the size of 480 base pair fragments (by Pst I degraded) and 800 base pair fragments (by the degraded of Pvu II) with hybridize in the Pst of same probe I similarly with Pvu II fragment, this same probe is the probe in the southern-blot method analysis of the human genome DNA shown in the example 7.

Among identical the λ A2 and pBTA295 ³²500 base pairs of P-mark

Table 4

Enzyme dna size (base pair) hybridization degree

PstⅠ 2500 +

″ 1160 ++

″ 480 ++++

PvuⅡ 800 +++

″ 420 ++

Pst I fragment is carried out the hybridization of southern-blot method, only identifies the Pst I degradation fragment of 1160 base pairs among the λ A2.The hybridization of this mode is consistent with following hypothesis, and promptly Ke Long people's dna fragmentation is carrying similar to the ox inhibin DNA or the homologous sequence.With Pst I degraded λ A2, the fragment of from the gluing sepharose of low temperature, excising 480,1160 and 2500 base pairs then, in M13, nucleotide sequencing (referring to example 5 the 3rd joint) gained the results are shown among Fig. 7 with its subclone.Between base 275 and 276, omitted one 1.4～1.5 kilobase dna sequence dna to intron.The aminoacid sequence of its representative is very similar with the aminoacid sequence of the former preceding subunit A of ox statin, and this shows that it is a homologous protein, and represents the precursor of human statin subunit A and Ac.The A of human statin _NFragment is defined as amino acid His 1 to Arg 171, and amino acid Ser172 to Ile306 then is the Ac subunit.

The clone of λ B1 carries the right DNA of about 21～26 kilobase and inserts section.This DNA is also with the degraded of restriction endonuclease Pst I, and electrophoresis and is transferred on the nitrocellulose filter separating the fragments of different sizes on 1% sepharose.136 base pairs that obtain with purifying from pBTA293 or the statin Pst I fragment of 510 base pairs ( ³²The P-mark) in (Fig. 4) when hybridization,, less probe is incorporated into and is about on 1300 base pairs (between 1100～1350 base pairs) dna fragmentation, and bigger probe is incorporated on the fragment that is about 800 base pairs (between 740～840 base pairs).The segmental partial nucleotide sequence of 800 base pairs is measured through the following steps: with Pst I degraded λ B1, the Pst I fragment of about 800 base pairs of purifying on the gluing sepharose of low temperature, it is cloned in the Pst I site of M13mp9, measures nucleotide sequence then.Nucleotide sequence shown in Figure 8, be with in the 800 base pair fragments than small segment (Pst I-Sau3A I; Sau3A I-Sau3A I) the sequencing result of subclone after in the M13.Translate definite aminoacid sequence by dna sequence dna and show, the whole B chain of this dna encoding statin, and show that the B chain of Gly1 to Ser116 and ox is consistent in the human B chain.

Can think, these λ clones' fragment carries the dna sequence dna of human statin and similar synthetic fragment, they can insert in prokaryotic organism or the Eukaryotic expression system, with produce human statin or with the polypeptide (seeing example 10) that suppresses to have dependency structure.And λ clone itself also can transduce suitable eukaryotic cell lines to obtain expression.

Utilize ox cDNA as probe, detect the statin subunit gene (example 7) in the various vertebratess, clone technology and sequencing by human statin subunit gene then, the extensive similarity that has shown aminoacid sequence, even everything disclosed other vertebrate statin and ox statin albumen be not consistent also be homologous, this ox statin albumen all has definition in International Patent Application PCT/AU85/00119 and Fig. 5, Fig. 6.

We have detected the activity (for example see Table 5) of statin in multiple vertebrate liquor folliculi or ovary extract, we are also according to the method for International Patent Application PCT/AU85/00119 and example 9, purifying has obtained natural statin from people FF and sheep FF, find these two kinds of statin all with the functional similarity of ox statin, and have the subunit structure form of 58KD and the 31KD similar to the subunit structure of ox.

And, effect by the rabbit anti-serum described in International Patent Application PCT/AU85/00119, can make rabbit, ox and human statin that the immunity neutralization takes place, this antiserum(antisera) is that the ox statin owing to the 58KD of antivenom purification produces, cross reaction can also take place in them in RIA, this has shown once more close structural homology (table 5) between them.

Yet, natural ox statin can cause the immunoreactive fact in the rabbit body, show between rabbit and the ox statin distinct, this difference is discerned as foreign protein by the rabbit immunity system, therefore, the statin of a kind can be used as antigen in another kind, to produce the antibody that can discern endogenous statin.

Even all kinds all have activity (desired conformation consistence when these cells show with its receptor interaction) in the table 5 in mouse pituicyte culture, antibody that rabbit produces and the statin of sheep or mouse still do not have significant cross reaction, and this shows that this antiserum(antisera) has specificity for specific antigen decision base.

From the discussion of front, can obviously find out, because subunit B has the conservative property of height, and may have consistence in several mostly, therefore, the subunit B albumen that utilizes sudden change is as antigen, to produce the antibody that cross reaction can take place with the subunit B of endogenous statin, will practicality widely be arranged for many kinds, and will in many kinds, produce good effect.Can produce such antigen by following technology, vitro mutagenesis as DNA, new gene is expressed as method as described in the example 10, or subunit B albumen carried out chemically modified, or from have to Fig. 6 and Fig. 8 isolate the gene of subunit B in the kind of the similar and inconsistent subunit B of subunit B, this gene is expressed etc. as method as described in the example 10.

Table 5. liquor folliculi statin and rabbit 474 anti-ox 58KD statin

Sero-fast interaction

Plant immune neutralization reaction at RIA ^*In cross reaction % 31KD tracer

The 58KD tracer

Ox+100 100

People+27 28

Sheep-8.0 0.3

Mouse-6.0 is not surveyed

Rabbit+do not survey and survey

^*Referring to example 16 the 1st joint.

Example 9

Relation between two kinds of form statin of 58KD and 31KD

Granulocyte manufacturing statin ， And secretes it to liquor folliculi in the ovarian follicle, and (International Patent Application PCT/Au/85/00119) statin is to exist with the 58KD form at first as previously mentioned.

Being intended to improve from ox liquor folliculi purification statin Research on effect provides evidence for the statin of less form, uses people's such as Roberson.D.M. purification process (1985; Biochemical biophysical research communication 126,220～226, international patent application no PCT/Au85/00119), in the initial neutral and middle precipitation operation of having added at PH4.75 of acidic buffer gel filtration chromatographic separation step.Thereby obtained second kind of bio-active substance, utilizing acid gel to filter can separate this actives and first kind of bio-active substance, second kind of actives carried out the anti-phase high pressure liquid chromatography find that with the polyacrylamide gel electrophoresis analysis that is used to prepare this material is that its molecular weight of a kind of protein is about 31,000, and be respectively 20 by two molecular weight, 000 and 15,000 subunit is formed, and the biologic activity of these two subunits is similar to original 58KD thing.The molecular weight of the small subunit of two kinds of statin is very near (about 15KD), and the difference that two kinds of statin molecular weight of this explanation are shown mainly is that it has shortened about 20KD because of the change of 43KD subunit part.

In addition, purified 58 statin are being cultivated the statin that can change the 31KD form into bullock serum (SS) or people's serum in climacteric (PMS).This cracking phenomenon is with bFF(Fig. 9) can not take place when cultivating.So the subunit of less (31KD) form statin and Qi Geng big (20KD) can be thought directly from the statin of 58KD form.The latter the article of (1985) such as International Patent Application PCT/Au85/00119) and Roberson.D.M. (biochemical and biophysical research communication 126,220-226) in existing introduction.Simultaneously also can be directly derive and get from described subunit gene.

On the other hand, it is equally clear, the serum that does not contain natural statin (SS and PMS) can be used for the reorganization of carrying out statin or its subunit external, and relevant enzyme can or carry out the reaction that propose Chun And the cell of this reaction is used to have same endpoint from serum.This kind of enzyme has the living features to protease inhibitor.Having SS or PMS to exist under the situation with serum iodate 58KD statin, cultivating 17 hours for 30 ℃, the per-cent that 58KD form statin is converted into 31KD form statin can be decreased to 4.5% from 24% because of wrapping letter 3mM parachloromercuribenzoate or 10mMEDTA.And bacillin and Pepstatin A (respectively being 0.3mM) do not have this effectiveness.The restraining effect of this proteolytic enzyme be enzyme process unique feature (Lazure.C etc. (1983), Canadian biochemical magazine, cytobiology, 61,501-515).This kind discovery also has proof, promptly has a typical effect site (arginine-arginine) relevant with A subunit (Fig. 5) Serine 167 that is used for this reaction.

Cracking takes place in being discharged into serum the time in statin, generates 2 molecules, i.e. 31KD form statin and A _NFragment (the 1-166 amino acid of big subunit).Though known 31KD form can suppress the synthetic and release of pituicyte to FSH, it might one or two direct adjusting sexual function of getting back to Xing of molecule Xian And.In addition, except the FSH regulative mechanism of hypophysis, statin itself, statin fragment or its precursor molecule such as A _NBiological function is arranged.Through the immunity of peptide 1 rabbit 699, its FSH titre drops sharply to zero (example 15) this fact and provides certain enlightenment for us.

Two kinds of statin subunits that form can be considered preceding original molecule.The propetide of each subunit may have their biological activitys own, and cell growth and regulating effect.The statin of 31KD form itself and growth conversioning factor-β, closely similar (Derynck).R. etc. (1985) nature 316 701-705), also can be thought, this natural molecule except known to the synthetic FSH of pituicyte influential, still in the cell regulate process, play some effects.

Example 10

The expression of statin CDNA

A, 43KD and 20KD subunit: though clone's BTA405(table 2) contain the CDNA of the big subunit of part of the statin of encoding, but can not expect to generate that and be afraid of a part of statin, because this CDNA is with dC ending (seeing routine 3a), and do not have the binding site of ribosome, and perhaps do not have the ATG(f-methionine(Met) in the starting sequence) codon.Expressed in order to obtain the statin portion gene, pBTA23, (about 480bp) Pst I fragment cloning of cDNA maximum is to the Pst I position of PUR292, to produce a fusogenic peptide.In correct orientation, operation can produce the protein of being made up of most of intestinal bacteria beta galactose glycosidoprotein enzyme like this, also can produce the amino acid 27-183 of statin 43KD subunit.The plasmid structure changes intestinal bacteria BTA647(table 2 over to).

For identifying this clone, used immunoscreening, cell transformed is seeded on the LB agar that contains 50 μ g/ml Ampicillin Trihydrate sodium salts, cultivated 16 hours for 37 ℃, to choose transformant, on nitrocellulose filter (Schleicher and Schuell), duplicate bacterium colony, use the fine needle that is soaked with Indian ink to pass tunica fibrosa and thrust agar to mark the direction of growth.Main flat board can be housed in 4 ℃ standby.The replica of cultivating faces up at filter membrane and placed on the fresh LB agar that contains 50 μ g/ml sodium ampicillins 3 hours.In the LB agar that contains 0.5mM sec.-propyl-β-D thiogalactoside (IPTG), cultivate 2 hours to induce fused protein for 37 ℃.Filter membrane is placed on one uses the 0.2MNaOH/1%(weight/volume) on the saturated Whatman3MM filter paper of SDS, after 5 minutes, on the filter paper saturated, neutralize with the 0.5MpH7.5Tris-Hcl damping fluid.The protein original place that bacterium colony discharges combines with Nitrocellulose.Filter membrane immersed contains additional Tween20(0.5%(volume/volume) TST in (150mMNacl and 0.05%(volume/volume) Tween 20(Sigma) and 10mMTris-Hcl(PH8.0), stirred gently 1 hour, with all residual protein binding points on the sealing soluble cotton.Filter membrane earlier with contain through TST with the rabbit of dilution in 1: 50 anti--(International Patent Application PCT/Au85/00119), at room temperature handle and spend the night is cleaned several times to remove remaining antibody to Niu 58KD statin antiserum(antisera) solution again in TST.Be used among the TST with the pig of dilution in 1: 200 anti--rabbit immunoglobulin-horseradish (horseradish) superoxide enzyme conjugates (Dakopatts), at room temperature handled filter membrane 1 hour, in TST, clean then, at last, wash ， And with containing 0.5mM/ml chloro-naphthol and 0.03%(volume/volume at 20mMpH7.5Tris-Hcl) H ₂O ₂/ 20mM Tris-Hcl, pH are 7.5 solution-dyed.

Contain the bacterium colony of fusogenic peptide can be from the filter membrane the part of color depth identify out that rest part divides system's control strain of growing: BTA647(PUR292).Antiserum(antisera) and the long intestinal bacteria BTA647(PUR292 that inductive and self-dissolving are arranged with dilution) filter membrane give cultivation, resist in the hope of lowering rabbit-statin is sero-fast to be resisted-the colibacillus antibody titers, although done effort like this, still as seen the background of other bacterium colony dyes.

Three such bacterium colonies are carried out purifying ， And their plasmid composition is analyzed, all bacterium colonies all comprise the cDNA fragment that pUR292 And has desired acquisition in the correct post-directed training.One of them bacterial strain is referred to as BTA410, and its plasmid is a pBTA28(table 2).Western engram analysis method (Towbin, H have been used; Deng (1979), American Academy of Sciences reports 76 4350-4354) evaluation of fusogenic peptide is detected, this method comprises with sodium laurylsulfonate makes protein denaturation, makes it order separation by size with polyacrylamide gel electrophoresis, and then transfers on a slice soluble cotton.For determining which kind of protein contains statin antigen neccessary composition, soluble cotton is handled as stated above.Prepare protein example as follows.

At 37 ℃ of BTA647(pUR292 that are grown on the LB) and the overnight culture of BTA410 be diluted in the fresh culture with 1: 100 and cultivate, up to concentration is A6000.4, make 0.5mM IPTG solution then, continue to cultivate results after two hours, the cell granulations thing directly is suspended in load buffer (the containing the 30%(weight/volume) sucrose/1%(weight/volume of 0.1 volume) electrophoretic buffer of SDS/0.1M beta-mercaptoethanol/0.01 bromjophenol blue), heating is 5 minutes in boiling water bath.Sample (10-30 μ l) is used for polyacrylamide gel electrophoresis (Laemmli.U.K.(1970) nature.227,680-685; (1980) Eur.J. biochemistry 114 such as mattick.J.S. is 643-651) till bromjophenol blue reaches the gel bottom.The Hoeffer that horizontal transfer is used moves point apparatus, in 15.6mM Tris alkali/120mM glycine, carry out, electric current is 1amp, hold and continue 1 hour, as mentioned above, filter membrane is handled and interrupted with antiserum(antisera), in order in polyacrylamide gel, directly to see protein, gel is immersed de-inking solution (10%(volume/volume) methyl alcohol/5%(volume/volume) Glacial acetic acid), 30 minutes, use the 0.5%(weight/volume again) be dissolved in Coomassie brilliant blue (Coomassie Brilliant Blue) the R250 dyeing 1 hour of same solution, stir gel gently, change several times de-inking solution so that the gel decolouring.The protein band chain that shows can compare with the protein of Western method and immunodetection.The BTA410 bacterial strain contains two kinds of albumen at least; Both lump together the 5-10% that accounts for the total cell protein that cell induced by IPIG, and And can detect with anti--statin antiserum(antisera) (Figure 13, rule mark 10).Bacterial strain BTA647(pUR292) there are not two kinds of protein in (Figure 13, rule mark 11).Compare with natural beta-galactosidase enzymes, their molecular weight bigger (about 130 and 117KD) are so represented beta-galactosidase enzymes statin fused protein.The protein of estimating in maximum fused protein and the DNA analysis consistent (about 132KD).

Use similar methods, can make 410 of pBTA30 ^bPPst I fragment obtains expressing in pUR291.The plasmid that obtains is referred to as pBTA292(table 2), can detect this fused protein with anti--statin antiserum(antisera) (Figure 13, rule mark 9) method.

In order to obtain to express subunit completely, pBTA290 is connected with cDNA among the pBTA30, so the strategic step that adopts as shown in figure 10.In brief, it has comprised the segmental purification of Sau3A I among each clone, cuts off ， And at unique Rsa I place and goes combination again.Blended again through the cutting of Sau3A I, inserts pUR290 with it in conjunction with product then.With probe 3 and 4 screening and cloning (Fig. 3), contain 3 of 5 of pBTA290 '-Sau3A I-Rsa I fragment and pBTA30 '-Rsa I-segmental clone of Sau3A I simultaneously so that identify, in correct post-directed training, carry out this insertion and can guarantee to produce beta-galactosidase enzymes-statin fusion rotein, because pUR290 can provide from aspartic acid-10 to Isoleucine and correctly read sign indicating number between 300, use is seen example 9 from containing pBTA28 and pBTA292() the post of fusion product isolated specific antibody, can independent detection go out 480 and the segmental correct expression of 410bp Pst I part.The gained plasmid is referred to as pBTA296(table 2).This subunit gene of A completely also Sau3A I of Ceng Zuowei-Sau3A I fragment is cloned into the BamH I point of pUC7, resulting plasmid (pBTA302, Figure 12), be transferred to BTA652 again and make it to produce BTA426(ATCC67057), aspartic acid on Sau3A I position-proline(Pro) sequence can be used for from the statin part of the top of protein chain (upstream) cutting-out fused protein, because of this sequence is very unsettled (nilsson.B. etc. (1985) Nucl.AC.Res.13.1151-1162) in formic acid.

The expression fully that is fused to the 43KD subunit in the beta-galactosidase enzymes (aspartic acid-10 is to Isoleucine 300) of BTA419 bacterial strain is advised shown in the mark 8 as Figure 13.Except the beta-galactosidase enzymes-statin protein of complete length, at least the protein band chain that also has 3 smaller length, its molecular weight is little, and this has perhaps represented complete product albumen matter hydrolytic deterioration phenomenon to close with natural beta-galactosidase enzymes, or crosses early stopping and transcribe and translate.Overwhelming majority fused protein is soluble.The beta-galactosidase enzymes DNA that from pBTA296, downcuts inhibin DNA and accompany with it, be inserted into pBTA286(table 2, Figure 13 as an EcoR I restricted fragment, rule mark 4) to produce pBTA297(table 2), make it above-mentioned bacterium colony immunity hydridization method and can select some clones, they can be at the plain DNA of the proteic C-terminal expression inhibiting of the pBTA286 beta-galactosidase enzymes that has shortened, and using phase microscope to detect these clones (is BTA420; Table 2), can see that they produce a kind of insoluble fused protein product, are referred to as inclusion body, this inclusion body tool prevents the provide protection of cell protein hydrolytic deterioration, and can simplify the purge process (example 12 and 13) in the antigen prepd greatly.Bacterial strain BTA420 names and is ATCC67054, and the inclusion body protein matter behind the purifying of other BTA420 is seen Figure 13, rule mark 3.Figure 13 is seen in the expression of BTA426A subunit, rule mark 14, and this kind protein mainly is to generate with the inclusion body form.The longest fused protein of BTA426 is different with the BTA420 fused protein, and not only quantity is maximum, and reaction is the most obvious in the western engram analysis.It is topmost host-vector conjugant in similar statin protein production in this explanation.

From the above, can find out significantly that other enzyme position that provides constraints also has certain purposes in the expression of A subunit, wherein topmost point is the SP of only leap Histidine 1 coding ^hThe I point can design the oligonucleotide linker and make it to express A subunit or AN fragment in various hosts and carrier, and expression-form can be a fusion product, it also can be non-fusion, independent protein at this moment, has been introduced a new f-methionine(Met) password in CAG Histidine coding front; Or before Histidine 1, add a peptide.All people who is engaged in this work know clearly this structure, and specific examples is seen Figure 11.

Design this expression linker and can make it to express 43KD protein or AN fragment, its method be inserted into trp promoter plasmid as: the natural 291.503-506 of perpL1(Edman.g.c. etc. (1981)) afterwards, use the methionine(Met) of a new N-terminal.This design is for PUC7, and PUC13 or PUR290 have utilized the claI position, and expression-form is beta-galactosidase enzymes-statin fused protein after reeve.For pWT121, then utilize the BamHI position, after insertion expression-form be a kind of trpE-statin fused protein (Tacon, w. etc. (1980) Molec, Gen, Genet, 177.427-438).

The method of rebuilding again of the precursor of former A subunit as described in Figure 12 before the total length.In general, comprise from pBTA295 and separate Pvu II-Pvu II fragment, add the linker (Wei Jing Ling acidification shown in Figure 11 Aii), so that signal peptide 5 ' preceding 4 amino acid (methionine(Met)-60 is to glutamine-57) be reconstructed into first PvU II position ， And again and provide BamH I position at 5 ' end.With the molecule of Sph I cutting linker, receive among the pBTA297 that cut with BamH I and Sph I to produce pBTA305.

The expressed preceding former A subunit of this intermediate is that a kind of fused protein inhibin DNA sequence also can be cut into Hind III-Hind III fragment or ECoR I-EcoR I fragment, uses after being equipped with.Particularly EcoR I-EcoR I fragment can continue by subclone in pUC8 or pUC9, statin cDNA sequence can obtain BamH I-BamH I fragment through cutting, using pZIP NeoSV(X) during 1 carrier, can in eukaryotic cell, obtain expressing (Cepko.C.L. etc. (1984) cell 37,1053-1062).The product that this expression system phase of giving obtains is the proteinic glycosylation form of oozy 43KD, and is different with the prokaryotic system of former description.

Therefore, 5 ' Pvu II, the proteinic linker of the expression 43KD position that can both provide convenience in Sau3A I and Sph I position.Hae II structure at base 734 promoters partly provides convenience for the Ac that expression originates in the A subunit of arginine 165.

Utilize Hae II position linker that Figure 11 A ⅲ describes in pUR290, pBTA286 and pUC13 to obtain the expression-form of beta-galactosidase enzymes fusion product.For realizing this kind expression, used pBTA30Hae II-Sau3A I fragment should need add linker by purifying And, the structure of producing is cut through the Sau3A I, use isopropanol precipitating DNA then, Virahol is the big fragment of deposit D NA effectively, and the little dna fragmentation as the linker is but lacked effectiveness.Sedimentary DNA is dissolved in TE again, and And inserts pUR290, and plasmid is transformed into BTA634, and institute's DCRP is replicated on two filter discs, and one of them filter disc is screened, as described in example 4, this test use ( ³²P)-the Hae II linker (top DNA chain is shown in Figure 11 A ⅲ) of mark.Another filter disc is handled (as Fig. 3) with probe 4.Select the clone who crosses with two probe in detecting, detect its expressional function with the Western engram analysis.One of them such clone is drawn on Figure 13, rule mark 7 ， And called after BTA421(tables 2).The dna fragmentation of coding statin Ac subunit and relevant beta-galactosidase enzymes dna sequence dna thereof is also cut as EcoR I fragment; And is inserted into pBTA286 and is used to give expression to not diffluent equally fused protein, so aspect purifying and preventing degraded, have advantage, this bacterial strain has been named and has been BTA422(ATCC67059; Table 2, Figure 13, rule mark 2).

The new BamH I-Sau3A I fragment of coding Ac subunit also cuts out from pBTA298, and by subclone to PUC13 to produce the fused protein of a weak point.BTA427 bacterial strain (ATCC67056, table 2) produces the such protein that occurs with the inclusion body form, show (as Figure 13 through gel analysis, rule mark 15) the same with the BTA426 situation, maximum And of the longest fused protein quantity and see the easiliest in the Western engram analysis we can say that BTA427 is of great use a host-vector combination for producing similar statin protein.

To have the most outstanding characteristics be may be connected to fused protein when obtaining correct express amino acid sequence (aspartic acid-proline(Pro)) from the initial DNA in BamH I position to each linker among Figure 11.As mentioned above, this sequence is unstable in formic acid, can be used for downcutting statin protein (Nilsson.B. etc. (1985) Nucl.Ac.Res.13 1151-1162), not have aspartic acid-proline(Pro) sequence in the A protein subunit matter wherein from protein top.It also is possible that certain other separation method is isolated certain sequence from fused protein.The example of this respect comprises that entering proteolytic enzyme recognizes sequence, for example Xa factor identification sequence (Nagai.K.and Thoger Son.H.C.(1984) nature 309,810-812) or collagenase identification sequence (Serminu J.and Bastia.D.(1984) proc, Natl acad Sci.UsA81,4692-4696) the possibility of relevant enzyme in order to identification pairing arginine residues, existing in the past discuss (seeing example 9).Connecting methionine(Met) before above-mentioned statin sequence can cut fusion product with cyanogen bromide, to obtain not contain the statin fragment of beta-galactosidase enzymes.Methionine residue can be with external DNA mutagenesis in the statin sequence, and change corresponding other amino acid into, and because total length class statin protein separates with the fused protein precursor, so can use the cyanogen bromide cutting technique more widely.The transformation of methionine residue own also can produce has some better antigenic properties, or the molecule of class statin incipient reagent or antagonist properties.

B.15KD the expression of subunit, the 510bp Pst I cDNA fragment (Fig. 4) of pBTA293 is received pUR291Pst I position, then this plasmid is transformed into intestinal bacteria BTA634, use 24-14 oligonucleotide of doubly degrading from institute's DCRP, screen the recombinant plasmid of generation, originally this Nucleotide be once to be used for separating pBTA293 and pBTA294(probe 2, Fig. 3).To use Restriction Enzyme Hind II with some recombinant plasmid conversion (mapped), in order expressing, then analyze those contain parenthesis in correct post-directed training two plasmids on polyacrylamide gel, this class bacterial strain is referred to as BTA423(table 2).

510 of pBTA293 ^bThe Pst I position ， And that p pst I cDNA fragment directly is cloned into pBTA286 is transformed into BTA634, in order to express a kind of fused protein.PBTA286 is a deutero-from pUR291, so that cross reading sign indicating number and allowing this direct clone of Pst I position, the bacterial strain of this generation is BTA424(ATCC67058, table 2), and generation is as the fusion product of inclusion body.

p ^BTA293510bp pst I _cDna fragmentation also is cloned into the pst I position of puc8, and is transformed into BTA637 in order to express a kind of insoluble short chain fused protein, and the latter also produces bacterial strain BTA1360(ATCC67055; Table 2)

BTA423, the fusion rotein plasmid of BTA424 and BTA1360 can not detect (Figure 13, rule mark 1 with exempting from anti-statin antiserum(antisera), 6 and 16), though it can detect A and Ac subunit fused protein, this shows that concerning 15KD protein, its antibody horizontal is very low, even equals zero.So use A or Ac subunit can obtain the biological effect (see example 17) relevant separately with anti-statin immunization.

By separating Hae II fragment, and add Hae II position linker that Figure 11 A ⅲ describes and can realize that expression to the 15KD sequence, this fragment cross over whole 15KD sequence and arginine-5 to-1.So the fusion password that obtains such as Figure 11 Bi and mentioned above are for p ^UR290/ p ^Uc7/ p ^Uc13In to express the beta-galactosidase enzymes fused protein be of great use, when realizing this expression, to utilize BamH I position and formic acid at the ASP(aspartic acid)-the Pro(proline(Pro)) ability of sequence punishment isolated fusion protein matter.In addition, CIa I position is useful (Edman.J.C. etc. (1981) are aforementioned) to the expression in ptrp/L1, and ATG plays a part new translation starting point in ptrp/L1.

The third possibility of expressing is to use unique Hind II position, or utilizes the linker of requirement and the dna sequence dna of methionine(Met)-1 sequence (Figure 11 B ⅱ) composite coding amino acid/11 to 8.

Therefore, Pst I, Hae II and Hind II position all are to add the position that makes things convenient for of expressing linker.Using this segmental Hae III position (GGCC) of crossing over amino acid/11 and 2 after the partial hydrolysis of the segmental Hae III of 510bp I, also is possible.In addition, concerning the people that this field working experience is enriched, all know clearly multiple expression system.Above-mentioned various possibilities about A and Ac subunit also are suitable for the B subunit.

Clearly,, may only express the precursor of part subunit, not plain Ac of expression inhibiting and B subunit sequence in order to study its function.For example, A _NThe sheet segment DNA can be separated, and as a Sph I-Hae II (part) fragment, under the situation with linker shown in Figure 11 A ⅰ and the 11A ⅲ, makes it to be expressed in puc7 or puc13, so that two ends are transformed into BamH I position.

Simultaneously, the expression of known statin protein or class statin protein or peptide can not be confined to above-mentioned example.A lot of protokaryon or different expression systems of eukaryotic cell of can be used for are still arranged, and they are for the people who is engaged in this respect work is familiar with, and they also are applicable to some sequence that expression is given here certainly.

Because B subunit aminoacid sequence ox and the people is the same, so, be not difficult to understand the c of coding ox B subunit ^DNAProduct when being expressed is consistent with similar human DNA sequence's the product that expression obtained.Therefore, should think that bacterial strain BTA423, BTA424 and BTA1360 also can produce human inhibin hormone's B subunit.

Example 11

Separate anti-statin antibody

The protein component that contains beta-galactosidase enzymes-statin fused protein that obtains from BTA410 and BTA415, combine (Bethell.G.S. etc. (1979) JBio I Chrm254 with SepharosecL-6B by phosphinylidyne diimidazole method, 2572-2574), exempt from the anti-statin antiserum(antisera) to separate antibody to each fused protein with the protein affinity purification method from the 1m I, the antibody of these absorption is to use 3MMgCl ₂Wash-out ， And dialyses in the 10mM Tris-Hcl/150mMNacl solution at PH7.5 from the post.

The antibody that wash-out goes out is in order to carry out the Western engram analysis, detecting various fused proteins, the result shows, they only with combine with their isolated fusion protein matter, be no cross reaction, beta-galactosidase enzymes antibody is compared its quantity with anti-statin antibody and can be ignored.Use from BTA425,420,422 and carried out similar experiment with the fused protein of 424 bacterial strains.

These experiments show, reorganization statin or class statin protein can be used for purifying anti-statin antibody and screening mono-clonal or polyclonal antibody prepared product.So that obtain anti-statin antibody or as the statin pilot system, the standard substance of (as ELISA ' S and RIA ' S test).

Example 12

Synthesizing of synthetic peptide

Another produces the proteinic approach of class statin in protokaryon and eukaryotic cell be the part or all of statin of chemosynthesis.The synthetic peptide can be used as the analogue of statin like this, reinforcer and antagonist, and its purposes is as described in example 10 and 11.

That is adopted synthesizes, purifies, identifies that synthetic peptide program is as follows.Use 430A type peptide synthesizer (Inc company of applying biological system product) and do not pass through commercially available Version 1.00 softwares of transforming.All reagent is all supplied by Applied Biosystems, Inc..Reactor charges into C-terminal amino acid (0.5mmol), and these amino acid can be with its covalent and PAM resin-bonded.After each residue coupling, just survey synthetic effect with the ninhydrin reaction mirror.The productive rate generalized case that is attached at the peptide on the resin can reach 75%.

Make peptide and resin isolation or go protection (deprotection), can be in the presence of scavenging agent phenyl methylcarbamate (0.5ml) and thiocresol (0.5ml), at 0 ℃ with hydrofluoric acid (10ml) processing and peptide bonded resin 1 hour.This separation and go to protect in tetrafluoroethylene HF-reaction tubulature and carry out (Protein Research Foundation; Osaka; Japan); reaction product (is smashed to pieces in 3 * 50ml) at ether; filter; then the peptide that obtains is dissolved in acetate (10%), filters, gained filtrate is carried out frost drying.

Residue is dissolved in the trifluoroacetic acid (0.1%) that contains acetonitrile (10%) makes it to reach homogeneity with anti-phase high-pressure liquid phase look chromatogram purification peptide.Carry out gradient elution with the trifluoroacetic acid that contains 10% to 80% linear increment acetonitrile (0.1%).

Use Altex C8 post to carry out stratographic analysis.In 220nm watch-keeping elution process, making it the per minute flow velocity is 1ml.Be prepared RP-HPLC(anti-phase high pressure liquid chromatography with Vydac albumen and peptide C18 post (Cat, No218TP1010)) to analyze, flow velocity is the 2-4ml/ branch, use gradient to adjust to the various peptides of can purifying.Reclaim the protein of purifying by the method for evaporation Yi Jing And frost drying water.

Use Waters Pico-Tag system that the synthetic peptide is carried out amino acid analysis.Adopt the scheme ， And PCT amino acid alignment that manufacturers provided.The amino acid of each peptide is formed with every seed amino acid ratio of expectation and is conformed to.

Originally segmental two zones of A subunit aminoacid sequence that produce from the cDNA sequence are used to produce synthetic peptide.First section be from Histidine 1 to L-Ala 26, the second sections from Serine 167 to aspartic acid 195, therefore comprised statin 43KD(A) and 20KD(Ac) the N-end of subunit.The sequence total length of peptide 1 is as follows, and wherein digital usefulness is the used numeral of Fig. 5 aminoacid sequence:

Peptide 1

His-Ala-Val-Gly-Gly-Phe-met-

1 2 3 4 5 6 7

Arg-Arg-Gly-Ser-Glu-Pro-Glu-

8 9 10 11 12 13 14

Asp-Gln-Asp-Val-Ser-Gln-Ala-

15 16 17 18 19 20 21

Ile-Leu-Phe-Pro-Ala-Lys

22 23 24 25 26

(annotate: His: Histidine; The Ala L-Ala; Val: Xie Ansuan; Gly: glycine; Phe: phenylalanine; Met: methionine(Met); Arg: arginine; Ser: Serine; Pro: proline(Pro); Glu: L-glutamic acid; Gln: glutamine; Asp: aspartic acid; Ile: Isoleucine; Leu: leucine; Lys: Methionin)

If use a letter representation amino acid code, then above-mentioned sequence can be abbreviated as (H again ₁-A ₂₆) K, the amino acid represent statin sequence in the bracket is identical with Fig. 5 label.

Peptide 2 is Y(H1-A ₂₆) K, it is to add a unification NH by peptide 1 ₂-terminal tyrosine.Single synthesizing with Methionin is to carry out at the beginning.In order to produce peptide 2, remove 75% resin, And adds the tyrosine residue to 25% remaining peptide, and the adding of Methionin residue can promote haptenic preparation, adds tyrosine so that radiation iodization point to be provided.

Example 13

The generation of inclusion body and purification

Bacterial strain BTA420, BTA422 and BTA424 produce the similar statin protein as fusion product.These protein that these three kinds of bacterial strains produce exist with agglomerate undissolved, that be referred to as inclusion body in vivo, can prepare and purify as follows.With the board-like flask of 2 upshifts, be OD0.3-0.4 to be diluted to 2 * 1 liters fresh LB nutrient solution (every liter contains the female extracting solution of 10g tryptones/5g alcohol/5g Nacl) at 1: 50 through 37 ℃ of shaking culture to nutrient solution optical density(OD) with overnight culture.Add sec.-propyl-B-D thiogalactoside enzyme (the IPTG ultimate density is 0.1mM), continue to cultivate 2-7 hour, visible inclusion body is bright particulate state after two hours.Inclusion body particle maximum after common seven hours, number is maximum.

Harvested cell, way is-80 ℃ of freezing spending the night with cutting easily.The cell that obtains is suspended in the 20ml water by every liter of stock culture, And French squeezer ruptured cell.Prepare the suspension of 0.1mM at phenylmethyl sulfonylfluoride (PMSF) and 5% trotyl X-100, then 1, under the 200xg centrifugal 10 minutes.

Abandoning supernatant, borrow the ultrasonic wave effect with deposit seeds thing resuspending in 50ml1M Nacl/5% trotyl X-100 solution, recentrifuge.Repeat above-mentioned cleaning operation.Gained deposit seeds thing is suspended among the 2.5ml1M Nacl/5% trotyl X-100 with every liter of original fluid with ultrasonic wave again.

With gained suspension in the 60%(weight/volume) sucrose density gradient upper berth layer, use Beckman SW28 rotary head 32, under the 000Xg centrifugal 60 minutes.Inclusion body passes the sucrose buffer zone and settles out and separate with cell debris.Inclusion body can wash by water ， And and preserves under-80 ℃ of freezing states, is as good as seen in three months internal protein structure no changes and polyacrylamide gel at least.

Example 14

Antigenic preparation

It is in 8.0 the Tris Hcl damping fluid that the inclusion body of purifying is dissolved in 8M urea/0.1MDTT/0.1MPH with 2mg/ml, and 37 ℃ of insulations are two hours in nitrogen, use 12,000rpm centrifugal solution 15 minutes.50mMNaH with 5 liters of PH7.5 ₂ Po ₄4 ℃ of dialysis of/150mMNacl damping fluid (PBS) supernatant liquor spends the night, and changes at least twice.Protein component in the dialysis tubing forms white throw out, can use, and needn't be further purified.Get and show in the prepared product 1mg intraperitoneal injection of mice that this material does not contain pyrogene and lipopolysaccharides.

Throw out suspension is Marcol52:Montanide 888(9 with equal-volume oil base auxiliary: 1) emulsification, making ultimate density is that every ml contains 100-250 μ g antigen.For the antigen that source more than two is arranged, each concentration also is 100-250 μ g/ml.

With the glutaraldehyde method can with synthesize peptide and porous and easily the hemocyanin coupling of affinity (Briand.J.P. etc. (1985) immunization method magazine 78,56-69), conjugate can be used aforesaid method emulsification.

We can say to also have multiple additive method to prepare antigen, also have many other approaches and methods to carry out immunity.Prepare the emulsion process that antigenic method comprises the complete or incomplete auxiliary of FreundShi, the emulsion process in hydrogel or Chinese honey locust etc., and from containing the method for antigenic polyacrylamide gel part with its leaching.In addition, antigenic importing also can not mixed auxiliary.That route of administration has is oral, epithelial membrane infiltration and muscle, abdominal cavity, subcutaneous injection etc., certainly, also has several different methods to increase peptide and proteinic antigenicity, comprises self-crosslinking, proteic crosslinked with other, changes residue, changes sequence.

Example 15

Immunization is implemented

Inject animal during from zero circle for the first time, give adjuvant after all around, it is as follows to calculate the method that various throw out antigens award dosage:

Rabbit 100 ug/ dosage

Sheep 250 "

Pig 200-250 "

Rat 100 "

In addition, artificial synthesis peptide's (peptide 1, example 10) with porous affinity hemocyanin (KLH), is used for the immunity of rabbit simultaneously, and each dosage is 100g.

Example 16

Sero-fast analysis

Regularly get blood, the standard blood extracting method is given to get the blood one or many before the adjuvant for getting blood once before the injection first, during to adjuvant and get blood weekly once later on.Blood sample spends the night 4 ℃ of flocculations, gets serum through centrifuging and taking, and it is divided into some equal portions, whole analysis antibody and measure FSH titre during all-20 ℃ of following stored frozen.

With three kinds of different test operation check serum; A) measure antibody and iodate 58KD and 31KD statin binding ability in conjunction with tracer one, can recognize the natural statin of calf in order to indicate this antibody.The tracer antibody mixture can make its precipitation by second kind of antibody, and the radioactivity of particulate matter can be represented with the per-cent that full entry reacts quantity.

The iodate program is as follows: the 58KD and the 31KD statin (25 μ l electrophoresis elution damping fluids (international patent application no pCT/AU85/00119) contain 1-2 μ g) of purifying are added 25 μ l0.5MPH7.2 Ling phthalate buffers, add Na125I(0.5mci; 5 μ l, Amersham, Bucks uk), adds 40 μ l chloramine-Ts again, and it and hormone ratio are 8: 1.At room temperature stirring reaction 60 Miao ， And add the inclined to one side sodium sulfites of 20 μ l (3mg/ml) termination.0.5% Polypep at 20mM Ling phthalate buffer/0.1%BSA or PH6.0 makes reaction mixture to 500ul.Through Sephadex G25 gel column, (PD10Pharmacia, Uppsala Sweden), filter free to remove ¹²⁵I.The each several part blank solution is collected in together, to volume 20ml, adds to 200 μ lMatrex Red A(Amicon, Danvers, Mass; USA) on the post,, discard elutriant through containing 400mMKcl De Ling acid buffer wash-out.With 1MKCl/4M Niao Su Ling acid buffer wash-out ¹²⁵The I-statin.The iodate statin further in Sephadex G25 post (PD10) gel-filtration, is removed Kcl/ urea with suitable RIA damping fluid (seeing below) again.

58KD and 31KD statin can reclaim 60uci and 25uci respectively in a large amount of blank solutions behind iodination reaction and Sephadex G25 gel chromatography.But go out about 30% with 1MKCl/4M urea buffer solution wash-out.Estimate from the listed molecular weight of SDS-PAGE, ¹²⁵The I-statin should be present in this part.

The specific activity of iodate preparation can be evaluated with radioimmunoassay experiment, and what this experiment was used is self method of substitution (Marana etc. (1979) Acta Endocrinol(Kbh) 92, and 585-598), And uses hormone as the iodate standard.Record respectively ¹²⁵The I-58KD statin and ¹²⁵The activity specific of I-31KD statin is 50-60 μ ci/ug and 24 μ ci/ μ g, and its rate of recovery is 5-25%.

The to neutralize biological activity of natural statin of the anti-statin antiserum(antisera) that the experimental rabbit of crossing from the immunity of natural 58KD statin 474 makes, suppress to have stronger binding ability with iodate 58 and 31KD, but but be difficult to and the combination of two kinds of statin dissociative subunits, this shows that iodization can not cause the change of molecular structure.So the binding ability of test antiserum(antisera) and iodate statin can be considered as the ability that antiserum(antisera) is recognized natural statin.

(in the International Patent Application PCT/Au85/00119), antibody serum suppresses the bioactive ability of natural statin and shows and exist antibody to be neutralized effect the biological test of b, external biological test-former description.

The FSH serum level of c, FSH-sheep can be measured with the radioimmunoassay experiment method, this method used rabbit anti--sheep FSH serum and as the iodate sheep FSH of tracer.The also available radioimmunoassay experiment method of rabbit FSH serum level is measured, wherein utilize cavy anti--rabbit FSH serum ， And with iodate rabbit FSH as tracer.With the endogenous statin that can remove the antibody of reorganization material effects generation in the blood circulation, thereby be hopeful to increase the FSH titre.

Example 17

The experiment of sheep class

Every group of 9 animal (Corriedales; The duration of test animal is in non-rutting sedson), with the cotton-shaped antigen immune after single variety or the coupling, as shown in table 4.By the example 16 described serum analysis of carrying out.

A) tracer study: 19 animals (giving two weeks of adjuvant) produce to have significantly and the serum (table 4) of tracer bonded ability.Except no medicine control group (A group) with through pBAT301, except the 15KD subunit fused protein immune group (C group).These animals are from each test group.Best reaction occurs in animal 673(D group).Under 1000 times of situations of dilution, be respectively 10% and 3.1% with combining of 31KD tracer and 58KD tracer.

Combination rate is unlisted less than all animals of 1%.

Therefore, reorganization statin subunit when effect antigen, has and improves the effect that goat-anti serum is recognized natural statin ability.This will point out ⅰ) these tests can check the free antibodies in the serum, in addition, such possibility are arranged also, and the antibody that the sheep statin is had a maximum affinity is actually that statin with sheep combines, so can't detect in this experiment.ⅱ) extent of dilution of shaker test use is 1000 times, and this concentration has exceeded the dilution titer of faint positive serum probably.

B) external biological testing data.In external pituicyte, cultivate in the Bioexperiment, under the test conditions that provides (per 2 unit statin, 1 μ l antiserum(antisera)), do not have a kind of serum show in and the active effect of statin.

C) FSH titre.Each animal groups serum FSH level is listed in table 7.Do not have significant difference in the middle of contrast nursing group (A), all experimental group are removed an exception, all observe significant increase, although this increase is instantaneous.

So, reorganization thing statin can be as the antigen that increases domestic animal FSH titre, as known FSH can increase ovulation rate, we can expect also can increase ovulation rate to the immunization of reorganization thing statin, and And is used as dose and improves production efficiency again.Also can draw such conclusion, import the bioactive reorganization thing of tool statin and can suppress the FSH level, thus can be used in female or buck as contraceptive bian, because FSH is relevant with the mechanism that male sperm production rate of control and female ovarian follicle generate.

Example 18

The rabbit experiment

Use the tracer coupling system, the antiserum(antisera) of not castrating adult male rabbit is taken from analysis, and these rabbits have been used natural 58KD or 31KD statin, or carries plasmid pBTA297 with the source what, the fusion rotein of 299 or 301 cells, or carried out immunity with conjugated protein (example 10) that contain synthetic peptide 1.Its measurement result sees Table 8.

The tracer of table 8 rabbit anti-serum is in conjunction with experiment

Rabbit antigen source tracer is in conjunction with percentage ratio

58KD 31KD

474 58KD natural 25.2 28.5

461 31KD natural 4.0 5.8

692 BTA420 3.2 0

693 ″ 23.2 0

694 ″ 7.2 0

464 BTA422 0 0

465 ″ 0 0

466 ″ 0 0

695 BTA424 0 0

696 ″ 0 0

697 ″ 0 0

698 peptides 1 3.8 0

699 ″ 13.9 0

The serum of animal 474 diluted with 1: 2000, and what other were all all diluted by 1: 1000.

These data illustrate that once more recombinant chou statin subunit and synthetic peptide are have the ability to produce antibody response, wherein also comprise can Bian Ren And can with natural statin bonded antibody.Having various reactions of various animals, but lacking, can both produce in all test rabbit of what under the situation of recombinant chou 15KD antigen (from BTA424) of meaningful reaction, a kind of like this fact has appearred, promptly in the test of carrying out up to now, can directly resist the 43KD subunit as all antibody of taking from No. 474 rabbits (being the rabbit that has increased natural 58KD statin resistibility), this just means that the 15KD subunit also is the weak antigen of rabbit.Dan Zhe And does not mean that this subunit can not be with other kind of what.Take a hint by these results, be exactly, in order to produce remarkable antigen-reactive to the 15KD subunit, must be to its structure, sequence or form are carried out some modifications.Equally, the 20KD subunit also is a kind of weak antigen of rabbit.

After urging to rise the rabbit epidemic disease with peptide 1-KLH conjugated antigen (Figure 15), noticeable reduction has appearred in the follicle stimulating hormone content of No. 699 rabbit serum, drops to 0, No. 698 rabbit and also demonstrates decline gradually.The reaction of each animal is all corresponding with its sero-fast titre of opposing 58KD tracer.And synthetic peptide itself or the antiserum(antisera) of directly resisting it are inoperative in external mouse pituicyte biological assay, and they directly do not act on the statin receptor.So this peptide and their derivative can be used as male and female contraceptive bian, since the generation of follicle stimulating hormone and sperm, the generation of ovarian follicle relevant (seeing example 19).In addition, because this is A _NSegmental NH ₂-end, so the reaction known to the supposition is that antibody causes as media, then can inference A _NFragment itself or other the A that derives from ox, people or other vertebrates kinds _NSegmental synthetic peptide also can find to have same purposes.The A that can also inference uses biologically active in the mode different with antigen _NFragment or its component part can increase the content of follicle stimulating hormone, so they can be used as multiplication agent to improve reproductive efficiency (also seeing example 19).

Example 19

The experiment of pig

The draft of this experiment is with noted earlier different.

Select minor pig (22-23 week), beta-galactosidase enzymes flocculation antigen (16 animals with 750ug source what BTA425, control group) or with one contain source what BTA422, the mixture (16 animals, test group) of BTA424 and each 250ug of BTA426 subunit flocculation antigen carries out immunity.The 25th day and the 47th day twice same short liter immunity of do after injection first.Serum is got in after injection first the 60th day, adopts the tracer combining method, analyzes the antibody of anti-statin.After 60 days, observe as early as possible the prematurity pig emotionally with the person's movements and expression of mating.

The serum of 15 test group animals is carried out the mensuration of tracer binding ability, and its Dilution ratio is 1: 100, wherein has 10 to demonstrate and 125 _I-58The combination of KD statin, its incorporation range are 1.7-9.0%(X=4.9 ± 2.5).There is one with 2.0% and 125 _I-58KD statin bonded serum also demonstrates with 6.4% and 125 _I-31The combination of KD statin.And none and any one tracer carry out effective bonded in the control serum of 6 tests, and these tracers are to be used for proving that recombinant chou statin subunit has the ability to make pig to produce and a kind ofly can recognize the existence of nature statin antibody and the antigen-reactive that causes by what.

The pig cycle emotionally is 21 days to 27 days, and after the what bloodletting in 60 days, all animals in the test all can demonstrate emotionally appearance what and carry out mating again this is to take it for granted.Table 10 has listed the data of contrast and test group mating.AX2 analyzes and has illustrated that it is the result that a lot of test group animals do not carry out mating that processing has important effect, this effect.

The X of table 9 mating data ²Analyze

The group mating is the mating sum not

Contrast 14 2 16

Test 6 10 16

Sum 20 12 32

X ²The yates modified value is used in=6.5 P＜0.02

Antibody that above data reflect is to the A of 58KD statin _NThe fragment role is possible, because carry in 10 serum of anti-58KD statin antibody, has 9 under 1: 100 Dilution ratio, fails to detect the 31KD statin, shows that most antibody is A _NSpecifics.Viewed administration for peptides 1 is made result's (example 18) that antigen can cause that follicle stimulating hormone content reduces and has been supported above-mentioned supposition, one of its result to make to stop circulation and generate ovarian follicle in female vertebrates in rabbit test.Usually, during this period, can produce the animal that 31KD statin comparison 58KD is suppressed to have the serum of higher antigen titration degree with one and carry out mating.Other explanation also is possible, and for example: the 43KD statin contains-10 to-1 amino acid of preceding, former A subunit, and such sequence plays effect to effect, and this is possible.Yet no matter according to which mechanism, what obtain in vivo is still specious result, and data have been emphasized the conditioning agent of statin as short ovum hormone, and then has emphasized the conditioning agent to breeding physiologic and method.It has confirmed that also the recombinant chou statin can be used as male and female contraceptive bian and can be used as prevention jenny round-robin particulate.

Example 20

The mouse test

Adopt with the same procedure of what sheep the mouse group is carried out immunity.Serum with dilution in 1: 500 after, analyze being shown in the table 10 of each group in conjunction with the data of percentage ratio mode with mean number ± standard error in conjunction with checking method with the iodate tracer.Antigen with what A-F group sees Table 6.

The tracer of table 10 mouse-anti serum is in conjunction with experiment

Group sex quantity tracer

58KD 31KD

A male 9 1.06 ± 0.26 0.38 ± 0.58

Female 10 0.55 ± 0.45 0.82 ± 0.62

B male 9 7.00 ± 3.50 0.52 ± 0.50

Female 9 4.17 ± 4.84 0.82 ± 0.49

C male 9 0.54 ± 0.53 0.67 ± 0.51

Female 10 0.66 ± 0.72 0.79 ± 0.70

D male 9 1.10 ± 0.74 1.46 ± 0.96

Female 10 0.89 ± 0.83 1.55 ± 0.37

E male 10 8.30 ± 5.00 0.79 ± 0.58

Female 10 4.50 ± 2.65 0.98 ± 0.69

F male 9 0.51 ± 0.61 0.85 ± 0.59

Female 10 0.66 ± 0.72 0.79 ± 0.70

These data by A group tracer binding ability and B group and E organizes or D organizes comparison, illustrate A(43KD once more) subunit is to compare A _c(20KD) the better antigen of subunit.According to the evaluation of tracer in conjunction with research, the B subunit is invalid as antigen, these results have replenished a kind of like this view, be the natural statin of 58KD in No. 474 rabbits, a kind of strong antibody response and neutralizing antibody have been produced, and in No. 461 rabbits and other two rabbits, do not produce neutralizing antibody with the natural statin immunity of 31KD, generation be weak antigen-reactive.

As other animal varieties (sheep, rabbit, pig) situation is the same, in animal with the immunity of recombinant chou statin subunit, none is detected the existence of neutral antibody, and, can also observe, all kinds all have the immune response of resisting antigenic β one galactoside enzyme part widely.Expect that by these observationss the conformation epitope may be important, in view of the beta-galactosidase enzymes of fusions part reduces (Figure 12) significantly or does not exist, those antigens, the what BTA426 that for example originates, the antigen (example 10) of BTA427 and BTA1360 or source what tryptophane carrier will be valuable.In order to produce the conformation epitope and to improve antigenic form, can get down to a little tests.

However, the recombinant chou statin has still been affirmed in the experimentation on animals that provides here, subunit, and fragment and synthetic congener or its homologue can be used what

A) produce the antibody that to recognize natural statin

B) content of change follicle stimulating hormone

C) as multiplication agent or contraceptive bian

Example 21

The production method of statin

The host cell that contains the plasmid recombinant that carries statin producer gene information, be placed on lyophilize little and in, be kept at and produce to cultivate collect in the liquid.After forming again, dull and stereotyped cultivation is in selecting substratum by the cell of storing little and taking-up, and the cell of taking from this substratum can be used to prepare the inoculum of fermentor tank.Inoculum can contain in the seed culture jar of suitable growth substratum with what, and fermentation is carried out under the condition that is suitable for the statin protein production.After fermentation is finished, collecting cell, product just is released from cell, carries out purifying then.Product by analysis with quality test after, be stored under the condition that can keep good stability.Under the sanitary condition of strictness, through making the available product with combining of other components.

Industrial application

The purposes of inhibin

Inhibin or its component part of producing by the present invention can be used as antigen or bioactive compound; The effectiveness that other usings method of effectiveness opposition what of some usings method produce, this point is predictable.

Inhibin or its component part of certain form that produces by the present invention and/or improvement thereafter can be used as antigen, and also available what changes fertility. The raising that comprises people's vertebrate ovulation speed will improve fertility, and what is just to have increased voluminous power or improved the efficient of producing again. Product of the present invention can be used to increase ovulation speed, and what is the propagation program of just having found that available what is external, and for example: with what domestic animal or people, they are also in the non-domestic animal of available what, for example: boost propagation program at the zoo. And product of the present invention also available what promotes the ripe of property or oestruses, with prolong reproductive life and/or promote to produce animal emotionally with shorten between farrowing and mating time and/or with what reduce seasonal or after emotionally. In mating, the product of invention can stimulate with what the generation of sperm.

What is, agricultural varietie, for example: ox, sheep, pig, goat, deer, horse, the production of fish and chicken also can benefit from these of inhibin are used.

Inhibin as activator can be used as the instrument of control jenny ovulation or the generation of Inhibit sperm, so it can be used as contraceptive or coordinates the ovulation agent.

The component part of inhibin, for example: synthetic peptide or A_NFragment can be used as the antigen that suppresses follicle-stimulating hormone (FSH) content, therefore can be used as contraceptive or inhibition particulate emotionally.

Product of the present invention can produce antibody with what, and the antibody of anti-inhibin can be used as diagnosticum, and this also is the part of invention. For example: those monitoring comprise the purposes of people's vertebrate regeneration product circulatory condition. Can expect in this way the quantity that time of ovulating and ovum are discharged, so just can admit to produce the definite of circulation treatment method for changing regeneration.

Antibody can be used to estimate the effect of granulosa cell in jenny, gives the effect marking of the Sertoli cell of buck, selects to do for good gene of raising thing Mark.

In a word, aforesaid recombinant protein matter and its derivative or homologue and congener have very many-sided purposes, and it comprises:

A) antagonist that is used as antigen and inhibin is to weaken the physiological action of regulating or cancelling some or all, and these physiological actions are that natural inhibin or its precursor produce in vivo.

B) clone or polyclonal antibody with manufacture order as antigen.

C) as producing in the body or the external precursor that bioactive recombinant inhibin is arranged.

D) be connected immunosorbent with enzyme as inhibin radioimmunoassay (RIA) and test (ELISA) or other detection systems such as the standard of chemiluminescence or fluhmann's tests.

E) with what screening monoclonal and polyclonal antibody prepared product

F) with the purifying (seeing example 9) of what identification inhibin or similar inhibin amino acid sequence antibody

G) as the activator of inhibin, to strengthen the physiological action of natural inhibin or its in vivo some or all of precursor. Biologically active recombinant inhibin can be external, by in same cell, and the compound expression of two subunits or two precursor, or by indivedual subunits or their precursor, congener, the correct ghost image of homologue or derivative is produced.

Inhibin C as an example^DNASequence has following purposes:

1) is used as at prokaryotes or the synthetic C of eukaryotic cells internal protein^DNATemplate (seeing example 8).

2) as making radioactive label inhibin C^DNADetect the dna profiling of thing. These are detected thing and can be used to survey and the sequence of separating inhibin or similar inhibin, and these sequences are at the genomic DNA of different cultivars or make in the mRNA of cell of inhibin or inhibin analog peptide (seeing example 7 and 8). Therefore, they might diagnose people and domestic animal to exist The defective ， And of the synthetic and adjusting aspect of inhibin is in order to clone and control inhibin gene.

3) there is the radioactive mark RNA of same purposes to detect the dna profiling of thing as making with above-mentioned (2).

4) as the dna profiling of making the radioactive label inhibin.

Claims (31)

1, a kind of method for preparing recombinant DNA molecules, this method comprises:

(a) provide a kind of a kind of dna molecular that is selected from the nucleotide sequence of following sequence that has:

ATG?TGG?CTT?CAG?CTG?CTC?CTC?TTG?CTG?CTG?GCC?CCT?CAG?GGC?GGG

CAT?GGC?TGT?CAT?GGG?CTG?GAG?CTG?GAC?CGG?GAA?CTT?GTC?CTG?GCC

AAG?GTG?AGG?GCC?CTG?TTT?CTG?GAT?GCC?TTG?GGG?CCC?CCA?CCG?GTG

ACT?GGG?GAA?GGT?GGA?GAT?CCT?GGA?GTC?AGG?CGT?CTG?CAC?CGG?AGG

CAT?GCC?GTG?GGG?GGC?TTC?ATG?CGC?AGG?GGC?TCT?GAG?CCC?GAG?GAC

CAA?GAT?GTC?TCC?CAG?GCC?ATC?CTT?TTT?CCG?GCT?GCA?GGT?GCC?AGC

TGC?GGG?GAT?GAG?CCA?GAT?GCT?GGA?GAG?GCT?GAG?GAG?GGC?CTC?TTC

ACG?TAT?GTG?TTC?CAG?CCA?TCC?CAG?CAC?ACA?CGC?AGC?CGC?CAG?GTG

ACT?TCG?GCC?CAG?CTG?TGG?TTC?CAC?ACA?GGA?CTG?GAC?AGA?CAG?GAG

ACC?GCT?GCC?GCC?AAC?AGC?TCT?GAG?CCC?CTG?CTT?GGC?CTG?CTG?GTA

CTG?ACA?TCC?GGG?GGT?CCC?ATG?CCT?GTG?CCC?ATG?TCG?CTG?GGC?CAG

GCC?CCC?CCT?CGC?TGG?GCT?GTC?CTG?CAC?CTG?GCC?ACC?TCC?GCC?TTC

CCT?CTG?CTG?ACC?CAT?CCT?GTC?CTG?GCG?CTC?CTG?CTG?CGT?TGT?CCT

CTC?TGT?TCC?TGC?TCC?ACT?CGG?CCC?GAA?GCC?ACC?CCC?TTC?CTG?GTG

GCC?CAC?ACA?CGG?GCC?AAG?CCG?CCC?AGT?GGA?GGG?GAG?AGG?GCC?CGG

CGC；

GAT?CCT?GGA?GTC?AGG?CGT?CTG?CAC?CGG?AGG?CAT?GCC?GTG?GGG?GGC

TTC?ATG?CGC?AGG?GGC?TCT?GAG?CCC?GAG?GAC?CAA?GAT?GTC?TCC?CAG

GCC?ATC?CTT?TTT?CCG?GCT?GCA?GGT?GCC?AGC?TGC?GGG?GAT?GAG?CCA

GAT?GCT?GGA?GAG?GCT?GAG?GAG?GGC?CTC?TTC?ACG?TAT?GTG?TTC?CAG

CCA?TCC?CAG?CAC?ACA?CGC?AGC?CGC?CAG?GTG?ACT?TCG?GCC?CAG?CTG

TGG?TTC?CAC?ACA?GGA?CTG?GAC?AGA?CAG?GAG?ACC?GCT?GCC?GCC?AAC

AGC?TCT?GAG?CCC?CTG?CTT?GGC?CTG?CTG?GTA?CTG?ACA?TCC?GGG?GGT

CCC?ATG?CCT?GTG?CCC?ATG?TCG?CTG?GGC?CAG?GCC?CCC?CCT?CGC?TGG

GCT?GTC?CTG?CAC?CTG?GCC?ACC?TCC?GCC?TTC?CCT?CTG?CTG?ACC?CAT

CCT?GTC?CTG?GCG?CTC?CTG?CTG?CGT?TGT?CCT?CTC?TGT?TCC?TGC?TCC

ACT?CGG?CCC?GAA?GCC?ACC?CCC?TTC?CTG?GTG?GCC?CAC?ACA?CGG?GCC

AAG?CCG?CCC?AGT?GGA?GGG?GAG?AGG?GCC?CGG?CGC；

CAT?GCC?GTG?GGG?GGC?TTC?ATG?CGC?AGG?GGC?TCT?GAG?CCC?GAG?GAC

CAA?GAT?GTC?TCC?CAG?GCC?ATC?CTT?TTT?CCG?GCT?GCA?GGT?GCC?AGC

TGC?GGG?GAT?GAG?CCA?GAT?GCT?GGA?GAG?GCT?GAG?GAG?GGC?CTC?TTC

ACG?TAT?GTG?TTC?CAG?CCA?TCC?CAG?CAC?ACA?CGC?AGC?CGC?CAG?GTG

ACT?TCG?GCC?CAG?CTG?TGG?TTC?CAC?ACA?GGA?CTG?GAC?AGA?CAG?GAG

ACC?GCT?GCC?GCC?AAC?AGC?TCT?GAG?CCC?CTG?CTT?GGC?CTG?CTG?GTA

CTG?ACA?TCC?GGG?GGT?CCC?ATG?CCT?GTG?CCC?ATG?TCG?CTG?GGC?CAG

GCC?CCC?CCT?CGC?TGG?GCT?GTC?CTG?CAC?CTG?GCC?ACC?TCC?GCC?TTC

CCT?CTG?CTG?ACC?CAT?CCT?GTC?CTG?GCG?CTC?CTG?CTG?CGT?TGT?CCT

CTC?TGT?TCC?TGC?TCC?ACT?CGG?CCC?GAA?GCC?ACC?CCC?TTC?CTG?GTG

GCC?CAC?ACA?CGG?GCC?AAG?CCG?CCC?AGT?GGA?GGG?GAG?AGG?GCC?CGG

CGC；

TCC?ACG?CCC?CCA?CTG?CCC?TGG?CCT?TGG?TCT?CCC?GCT?GCG?CTG?CGC

CTG?CTG?CAG?AGG?CCT?CCA?GAG?GAG?CCC?GCC?GCC?CAT?GCC?GAC?TGC

CAC?AGA?GCC?GCC?CTC?AAT?ATC?TCC?TTC?CAG?GAG?CTG?GGC?TGG?GAC

CGG?TGG?ATA?GTG?CAC?CCT?CCC?AGT?TTC?ATC?TTC?TAC?TAC?TGT?CAT

GGG?GGG?TGT?GGG?CTG?TCC?CCC?CCA?CAG?GAC?CTG?CCC?CTG?CCG?GTC

CCC?GGG?GTG?CCT?CCT?ACC?CCT?GTC?CAG?CCC?CTC?TCT?CTG?GTC?CCA

GGG?GCC?CAG?CCC?TGT?TGC?GCT?GCC?CTC?CCG?GGA?ACC?ATG?AGG?CCC

CTA?CAC?GTC?CGC?ACC?ACC?TCG?GAT?GGA?GGT?TAC?TCT?TTT?AAG?TAT

GAG?ATG?GTG?CCC?AAC?CTT?CTC?ACC?CAG?CAC?TGT?GCT?TGC?ATC；

ATG?GTG?CTG?CAC?CTA?CTG?CTC?TTC?TTG?CTG?CTG?ACC?CCA?CAG?GGT

GGG?CAC?AGC?TGC?CAG?GGG?CTG?GAG?CTG?GCC?CGG?GAA?CTT?GTT?CTG

GCC?AAG?GTG?AGG?GCC?CTG?TTC?TTG?GAT?GCC?TTG?GGG?CCC?CCC?GCG

GTG?ACC?AGG?GAA?GGT?GGG?GAC?CCT?GGA?GTC?AGG?CGG?CTG?CCC?CGA

AGA?CAT?GCC?CTG?GGG?GGC?TTC?ACA?CAC?AGG?GGC?TCT?GAG?CCC?GAG

GAA?GAG?GAG?GAT?GTC?TCC?CAA?GCC?ATC?CTT?TTC?CCA?GCC?ACA?GAT

GCC?AGC?TGT?GAG?GAC?AAG?TCA?GCT?GCC?AGA?GGG?CTG?GCC?CAG?GAG

GCT?GAG?GAG?GGC?CTC?TTC?AGA?TAC?ATG?TTC?CGG?CCA?TCC?CAG?CAT

ACA?CGC?AGC?CGC?CAG?GTG?ACT?TCA?GCC?CAG?CTG?TGG?TTC?CAC?ACC

GGG?CTG?GAC?AGG?CAG?GGC?ACA?GCA?GCC?TCC?AAT?AGC?TCT?GAG?CCC

CTG?CTA?GGC?CTG?CTG?GCA?CTG?TCA?CCG?GGA?GGA?CCC?GTG?GCT?GTG

CCC?ATG?TCT?TTG?GGC?CAT?GCT?CCC?CCT?CAC?TGG?GCC?GTG?CTG?CAC

CTG?GCC?ACC?TCT?GCT?CTC?TCT?CTG?CTG?ACC?CAC?CCC?GTC?CTG?GTG

CTG?CTG?CTG?CGC?TGT?CCC?CTC?TGT?ACC?TGC?TCA?GCC?CGG?CCT?GAG

GCC?ACG?CCC?TTC?CTG?GTG?GCC?CAC?ACT?CGG?ACC?AGA?CCA?CCC?AGT

GGA?GGG?GAG?AGA?GCC?CGA?CGC；

GAC?CCT?GGA?GTC?AGG?CGG?CTG?CCC?CGA?AGA?CAT?GCC?CTG?GGG?GGC

TTC?ACA?CAC?AGG?GGC?TCT?GAG?CCC?GAG?GAA?GAG?GAG?GAT?GTC?TCC

CAA?GCC?ATC?CTT?TTC?CCA?GCC?ACA?GAT?GCC?AGC?TGT?GAG?GAC?AAG

TCA?GCT?GCC?AGA?GGG?CTG?GCC?CAG?GAG?GCT?GAG?GAG?GGC?CTC?TTC

AGA?TAC?ATG?TTC?CGG?CCA?TCC?CAG?CAT?ACA?CGC?AGC?CGC?CAG?GTG

ACT?TCA?GCC?CAG?CTG?TGG?TTC?CAC?ACC?GGG?CTG?GAC?AGG?CAG?GGC

ACA?GCA?GCC?TCC?AAT?AGC?TCT?GAG?CCC?CTG?CTA?GGC?CTG?CTG?GCA

CTG?TCA?CCG?GGA?GGA?CCC?GTG?GCT?GTG?CCC?ATG?TCT?TTG?GGC?CAT

GCT?CCC?CCT?CAC?TGG?GCC?GTG?CTG?CAC?CTG?GCC?ACC?TCT?GCT?CTC

TCT?CTG?CTG?ACC?CAC?CCC?GTC?CTG?GTG?CTG?CTG?CTG?CGC?TGT?CCC

CTC?TGT?ACC?TGC?TCA?GCC?CGG?CCT?GAG?GCC?ACG?CCC?TTC?CTG?GTG

GCC?CAC?ACT?CGG?ACC?AGA?CCA?CCC?AGT?GGA?GGG?GAG?AGA?GCC?CGA

CGC；

CAT?GCC?CTG?GGG?GGC?TTC?ACA?CAC?AGG?GGC?TCT?GAG?CCC?GAG?GAA

GAG?GAG?GAT?GTC?TCC?CAA?GCC?ATC?CTT?TTC?CCA?GCC?ACA?GAT?GCC

AGC?TGT?GAG?GAC?AAG?TCA?GCT?GCC?AGA?GGG?CTG?GCC?CAG?GAG?GCT

GAG?GAG?GGC?CTC?TTC?AGA?TAC?ATG?TTC?CGG?CCA?TCC?CAG?CAT?ACA

CGC?AGC?CGC?CAG?GTG?ACT?TCA?GCC?CAG?CTG?TGG?TTC?CAC?ACC?GGG

CTG?GAC?AGG?CAG?GGC?ACA?GCA?GCC?TCC?AAT?AGC?TCT?GAG?CCC?CTG

CTA?GGC?CTG?CTG?GCA?CTG?TCA?CCG?GGA?GGA?CCC?GTG?GCT?GTG?CCC

ATG?TCT?TTG?GGC?CAT?GCT?CCC?CCT?CAC?TGG?GCC?GTG?CTG?CAC?CTG

GCC?ACC?TCT?GCT?CTC?TCT?CTG?CTG?ACC?CAC?CCC?GTC?CTG?GTG?CTG

CTG?CTG?CGC?TGT?CCC?CTC?TGT?ACC?TGC?TCA?GCC?CGG?CCT?GAG?GCC

ACG?CCC?TTC?CTG?GTG?GCC?CAC?ACT?CGG?ACC?AGA?CCA?CCC?AGT?GGA

GGG?GAG?AGA?GCC?CGA?CGC；

TCA?ACT?CCC?CTG?ATG?TCC?TGG?CCT?TGG?TCT?CCC?TCT?GCT?CTG?CGC

CTG?CTG?CAG?AGG?CCT?CCG?GAG?GAA?CCG?GCT?GCC?CAT?GCC?AAC?TGC

CAC?AGA?GTA?GCA?CTG?AAC?ATC?TCC?TTC?CAG?GAG?CTG?GGC?TGG?GAA

CGG?TGG?ATC?GTG?TAC?CCT?CCC?AGT?TTC?ATC?TTC?CAC?TAC?TGT?CAT

GGT?GGT?TGT?GGG?CTG?CAC?ATC?CCA?CCA?AAC?CTG?TCC?CTT?CCA?GTC

CCT?GGG?GCT?CCC?CCT?ACC?CCA?GCC?CAG?CCC?TAC?TCC?TTG?CTG?CCA

GGG?GCC?CAG?CCC?TGC?TGT?GCT?GCT?CTC?CCA?GGG?ACC?ATG?AGG?CCC

CTA?CAT?GTC?CGC?ACC?ACC?TCG?GAT?GGA?GGT?TAC?TCT?TTC?AAG?TAT

GAG?ACA?GTG?CCC?AAC?CTT?CTC?ACG?CAG?CAC?TGT?GCT?TGT?ATC；

GGC?CTG?GAG?TGT?GAC?GGC?AAG?GTC?AAC?ATC?TGC?TGT?AAG?AAA?CAG

TTC?TTT?GTT?AGT?TTC?AAG?GAC?ATT?GGC?TGG?AAT?GAC?TGG?ATC?ATT

GCT?CCC?TCC?GGC?TAC?CAC?GCC?AAC?TAC?TGT?GAG?GGT?GAG?TGC?CCC

AGC?CAC?ATA?GCA?GGC?ACA?TCG?GGC?TCA?TCC?CTC?TCC?TTT?CAC?TCG

ACG?GTC?ATC?AAC?CAC?TAC?CGC?ATG?CGG?GGC?CAC?AGC?CCC?TTC?GCC

AAC?CTC?AAG?TCG?TGC?TGT?GTG?CCC?ACC?AAG?CTG?AGA?CCC?ATG?TCC

ATG?TTG?TAC?TAT?GAC?GAT?GGG?CAG?AAC?ATC?ATC?AAG?AAG?GAC?ATC

CAG?AAC?ATG?ATC?GTG?GAG?GAG?TGT?GGT?TGC?TCA；

TTT?GAG?ATT?TCC?AAA?GAA?GGC?AGT?GAC?CTG?TCC?GTG?GTG?GAA?CGT

GCA?GAA?ATC?TGG?CTC?TTC?CTG?AAA?GTT?CCC?AAG?GCC?AAC?AGG?ACC

CGG?AGC?AAA?GTC?ACC?ATC?CGT?CTC?TTT?CAA?CAG?CAG?AAG?CAC?CTG

CAG?GGC?AGC?TTG?GAT?GCA?GGG?GAG?GAG?GCT?GAG?GAA?GTG?GGC?TTG

AAG?GGG?GAA?AAG?AGT?GAA?ATG?TTG?ATA?TCG?GAG?AAG?GTG?GTG?GAT

GCT?CGG?AAG?AGC?ACC?TGG?CAC?ATC?TTC?CCT?GTC?TCC?AGC?TGC?ATC

CAG?CGC?TTG?CTG?GAC?CAG?GGC?AAG?AGC?TCC?CTG?GAC?ATA?CGG?ATT

GCC?TGT?GAG?CAG?TGT?CAG?GAG?ACC?GGC?GCA?AGC?CTG?GTG?CTC?CTG

GGC?AAG?AAG?AAG?AAG?AAA?GAA?GAG?GAG?GGG?GAA?GGG?AAG?AAG?AGG

GAT?GGA?GAA?GGA?GGG?GCG?GGA?GGG?GAC?GAG?GAG?AAG?GAG?CAG?TCG

CAC?AGA?CCT?TTC?CTC?ATG?CTG?CAG?GCC?CGC?CAG?TCT?GAA?GAC?CAT

CCT?CAC?CGG?CGC?CGG?CGG?CGG；

AAC?AGG?ACC?CGG?AGC?AAA?GTC?ACC?ATC?CGT?CTC?TTT?CAA?CAG?CAG

AAG?CAC?CTG?CAG?GGC?AGC?TTG?GAT?GCA?GGG?GAG?GAG?GCT?GAG?GAA

GTG?GGC?TTG?AAG?GGG?GAA?AAG?AGT?GAA?ATG?TTG?ATA?TCG?GAG?AAG

GTG?GTG?GAT?GCT?CGG?AAG?AGC?ACC?TGG?CAC?ATC?TTC?CCT?GTC?TCC

AGC?TGC?ATC?CAG?CGC?TTG?CTG?GAC?CAG?GGC?AAG?AGC?TCC?CTG?GAC

ATA?CGG?ATT?GCC?TGT?GAG?CAG?TGT?CAG?GAG?ACC?GGC?GCA?AGC?CTG

GTG?CTC?CTG?GGC?AAG?AAG?AAG?AAG?AAA?GAA?GAG?GAG?GGG?GAA?GGG

AAG?AAG?AGG?GAT?GGA?GAA?GGA?GGG?GCG?GGA?GGG?GAC?GAG?GAG?AAG

GAG?CAG?TCG?CAC?AGA?CCT?TTC?CTC?ATG?CTG?CAG?GCC?CGC?CAG?TCT

GAA?GAC?CAT?CCT?CAC?CGG?CGC?CGG?CGG?CGG；

GCC?CGG?CAG?TCT?GAA?GAC?CAC?CCT?CAT?CGC?CGG?CGT?CGG?CGG；

GGC?TTG?GAG?TGT?GAT?GGC?AAG?GTC?AAC?ATC?TGC?TGT?AAG?AAA?CAG

TTC?TTT?GTC?AGT?TTC?AAG?GAC?ATC?GGC?TGG?AAT?GAC?TGG?ATC?ATT

GCT?CCC?TCT?GGC?TAT?CAT?GCC?AAC?TAC?TGC?GAG?GGT?GAG?TGC?CCG

AGC?CAT?ATA?GCA?GGC?ACG?TCC?GGG?TCC?TCA?CTG?TCC?TTC?CAC?TCA

ACA?GTC?ATC?AAC?CAC?TAC?CGC?ATG?CGG?GGC?CAT?AGC?CCC?TTT?GCC

AAC?CTC?AAA?TCG?TGC?TGT?GTG?CCC?ACC?AAG?CTG?AGA?CCC?ATG?TCC

ATG?TTG?TAC?TAT?GAT?GAT?GGT?CAA?AAC?ATC?ATC?AAA?AAG?GAC?ATT

CAG?AAC?ATG?ATC?GTG?GAG?GAG?TGT?GGG?TGC?TCA

CAT?GCC?GTG?GGG?GGC?TTC?ATG?CGC?AGG?GGC?TCT?GAG?CCC?GAG?GAC

CAA?GAT?GTC?TCC?CAG?GCC?ATC?CTT?TTT?CCG?GCT?GCA?GGT?GCC?AGC

TGC?GGG?GAT?GAG?CCA?GAT?GCT?GGA?GAG?GCT?GAG?GAG?GGC?CTC?TTC

ACG?TAT?GTG?TTC?CAG?CCA?TCC?CAG?CAC?ACA?CGC?AGC?CGC?CAG?GTG

ACT?TCG?GCC?CAG?CTG?TGG?TTC?CAC?ACA?GGA?CTG?GAC?AGA?CAG?GAG

ACC?GCT?GCC?GCC?AAC?AGC?TCT?GAG?CCC?CTG?CTT?GGC?CTG?CTG?GTA

CTG?ACA?TCC?GGG?GGT?CCC?ATG?CCT?GTG?CCC?ATG?TCG?CTG?GGC?CAG

GCC?CCC?CCT?CGC?TGG?GCT?GTC?CTG?CAC?CTG?GCC?ACC?TCC?GCC?TTC

CCT?CTG?CTG?ACC?CAT?CCT?GTC?CTG?GCG?CTC?CTG?CTG?CGT?TGT?CCT

CTC?TGT?TCC?TGC?TCC?ACT?CGG?CCC?GAA?GCC?ACC?CCC?TTC?CTG?GTG

GCC?CAC?ACA?CGG?GCC?AAG?CCG?CCC?AGT?GGA?GGG?GAG?AGG?GCC?CGG?CGC

TCC?ACG?CCC?CCA?CTG?CCC?TGG?CCT?TGG?TCT?CCC?GCT?GCG?CTG?CGC

CTG?CTG?CAG?AGG?CCT?CCA?GAG?GAG?CCC?GCC?GCC?CAT?GCC?GAC?TGC

CAC?AGA?GCC?GCC?CTC?AAT?ATC?TCC?TTC?CAG?GAG?CTG?GGC?TGG?GAC

CGG?TGG?ATA?GTG?CAC?CCT?CCC?AGT?TTC?ATC?TTC?TAC?TAC?TGT?CAT

GGG?GGG?TGT?GGG?CTG?TCC?CCC?CCA?CAG?GAC?CTG?CCC?CTG?CCG?GTC

CCC?GGG?GTG?CCT?CCT?ACC?CCT?GTC?CAG?CCC?CTC?TCT?CTG?GTC?CCA

GGG?GCC?CAG?CCC?TGT?TGC?GCT?GCC?CTC?CCG?GGA?ACC?ATG?AGG?CCC

CTA?CAC?GTC?CGC?ACC?ACC?TCG?GAT?GGA?GGT?TAC?TCT?TTT?AAG?TAT

GAG?ATG?GTG?CCC?AAC?CTT?CTC?ACC?CAG?CAC?TGT?GCT?TGC?ATC；

CAT?GCC?CTG?GGG?GGC?TTC?ACA?CAC?AGG?GGC?TCT?GAG?CCC?GAG?GAA

GAG?GAG?GAT?GTC?TCC?CAA?GCC?ATC?CTT?TTC?CCA?GCC?ACA?GAT?GCC

AGC?TGT?GAG?GAC?AAG?TCA?GCT?GCC?AGA?GGG?CTG?GCC?CAG?GAG?GCT

GAG?GAG?GGC?CTC?TTC?AGA?TAC?ATG?TTC?CGG?CCA?TCC?CAG?CAT?ACA

CGC?AGC?CGC?CAG?GTG?ACT?TCA?GCC?CAG?CTG?TGG?TTC?CAC?ACC?GGG

CTG?GAC?AGG?CAG?GGC?ACA?GCA?GCC?TCC?AAT?AGC?TCT?GAG?CCC?CTG

CTA?GGC?CTG?CTG?GCA?CTG?TCA?CCG?GGA?GGA?CCC?GTG?GCT?GTG?CCC

ATG?TCT?TTG?GGC?CAT?GCT?CCC?CCT?CAC?TGG?GCC?GTG?CTG?CAC?CTG

GCC?ACC?TCT?GCT?CTC?TCT?CTG?CTG?ACC?CAC?CCC?GTC?CTG?GTG?CTG

CTG?CTG?CGC?TGT?CCC?CTC?TGT?ACC?TGC?TCA?GCC?CGG?CCT?GAG?GCC

ACG?CCC?TTC?CTG?GTG?GCC?CAC?ACT?CGG?ACC?AGA?CCA?CCC?AGT?GGA

GGG?GAG?AGA?GCC?CGA?CGC

TCA?ACT?CCC?CTG?ATG?TCC?TGG?CCT?TGG?TCT?CCC?TCT?GCT?CTG?CGC

CTG?CTG?CAG?AGG?CCT?CCG?GAG?GAA?CCG?GCT?GCC?CAT?GCC?AAC?TGC

CAC?AGA?GTA?GCA?CTG?AAC?ATC?TCC?TTC?CAG?GAG?CTG?GGC?TGG?GAA

CGG?TGG?ATC?GTG?TAC?CCT?CCC?AGT?TTC?ATC?TTC?CAC?TAC?TGT?CAT

GGT?GGT?TGT?GGG?CTG?CAC?ATC?CCA?CCA?AAC?CTG?TCC?CTT?CCA?GTC

CCT?GGG?GCT?CCC?CCT?ACC?CCA?GCC?CAG?CCC?TAC?TCC?TTG?CTG?CCA

GGG?GCC?CAG?CCC?TGC?TGT?GCT?GCT?CTC?CCA?GGG?ACC?ATG?AGG?CCC

CTA?CAT?GTC?CGC?ACC?ACC?TCG?GAT?GGA?GGT?TAC?TCT?TTC?AAG?TAT

GAG?ACA?GTG?CCC?AAC?CTT?CTC?ACG?CAG?CAC?TGT?GCT?TGT?ATC；

ccctggcaga?aggggcacag?ggcagggtgt?gggttcccag?tgggcagggc

caggggagct?ATG?TGG?CTT?CAG?CTG?CTC?CTC?TTG?CTG?CTG?GCC?CCT

CAG?GGC?GGG?CAT?GGC?TGT?CAT?GGG?CTG?GAG?CTG?GAC?CGG?GAA?CTT

GTC?CTG?GCC?AAG?GTG?AGG?GCC?CTG?TTT?CTG?GAT?GCC?TTG?GGG?CCC

CCA?CCG?GTG?ACT?GGG?GAA?GGT?GGA?GAT?CCT?GGA?GTC?AGG?CGT?CTG

CAC?CGG?AGG?CAT?GCC?GTG?GGG?GGC?TTC?ATG?CGC?AGG?GGC?TCT?GAG

CCC?GAG?GAC?CAA?GAT?GTC?TCC?CAG?GCC?ATC?CTT?TTT?CCG?GCT?GCA

GGT?GCC?AGC?TGC?GGG?GAT?GAG?CCA?GAT?GCT?GGA?GAG?GCT?GAG?GAG

GGC?CTC?TTC?ACG?TAT?GTG?TTC?CAG?CCA?TCC?CAG?CAC?ACA?CGC?AGC

CGC?CAG?GTG?ACT?TCG?GCC?CAG?CTG?TGG?TTC?CAC?ACA?GGA?CTG?GAC

AGA?CAG?GAG?ACC?GCT?GCC?GCC?AAC?AGC?TCT?GAG?CCC?CTG?CTT?GGC

CTG?CTG?GTA?CTG?ACA?TCC?GGG?GGT?CCC?ATG?CCT?GTG?CCC?ATG?TCG

CTG?GGC?CAG?GCC?CCC?CCT?CGC?TGG?GCT?GTC?CTG?CAC?CTG?GCC?ACC

TCC?GCC?TTC?CCT?CTG?CTG?ACC?CAT?CCT?GTC?CTG?GCG?CTC?CTG?CTG

CGT?TGT?CCT?CTC?TGT?TCC?TGC?TCC?ACT?CGG?CCC?GAA?GCC?ACC?CCC

TTC?CTG?GTG?GCC?CAC?ACA?CGG?GCC?AAG?CCG?CCC?AGT?GGA?GGG?GAG

AGG?GCC?CGG?CGC?TCC?ACG?CCC?CCA?CTG?CCC?TGG?CCT?TGG?TCT?CCC

GCT?GCG?CTG?CGC?CTG?CTG?CAG?AGG?CCT?CCA?GAG?GAG?CCC?GCC?GCC

CAT?GCC?GAC?TGC?CAC?AGA?GCC?GCC?CTC?AAT?ATC?TCC?TTC?CAG?GAG

CTG?GGC?TGG?GAC?CGG?TGG?ATA?GTG?CAC?CCT?CCC?AGT?TTC?ATC?TTC

TAC?TAC?TGT?CAT?GGG?GGG?TGT?GGG?CTG?TCC?CCC?CCA?CAG?GAC?CTG

CCC?CTG?CCG?GTC?CCC?GGG?GTG?CCT?CCT?ACC?CCT?GTC?CAG?CCC?CTC

TCT?CTG?GTC?CCA?GGG?GCC?CAG?CCC?TGT?TGC?GCT?GCC?CTC?CCG?GGA

ACC?ATG?AGG?CCC?CTA?CAC?GTC?CGC?ACC?ACC?TCG?GAT?GGA?GGT?TAC

TCT?TTT?AAG?TAT?GAG?ATG?GTG?CCC?AAC?CTT?CTC?ACC?CAG?CAC?TGT

GCT?TGC?ATC?TAA?gggaatc?ccgctgtgac?AATAAAtgac?atagtgcata?tg；

TTT?GAG?ATT?TCC?AAA?GAA?GGC?AGT?GAC?CTG?TCC?GTG?GTG?GAA?CGT

GCA?GAA?ATC?TGG?CTC?TTC?CTG?AAA?GTT?CCC?AAG?GCC?AAC?AGG?ACC

CGG?AGC?AAA?GTC?ACC?ATC?CGT?CTC?TTT?CAA?CAG?CAG?AAG?CAC?CTG

CAG?GGC?AGC?TTG?GAT?GCA?GGG?GAG?GAG?GCT?GAG?GAA?GTG?GGC?TTG

AAG?GGG?GAA?AAG?AGT?GAA?ATG?TTG?ATA?TCG?GAG?AAG?GTG?GTG?GAT

GCT?CGG?AAG?AGC?ACC?TGG?CAC?ATC?TTC?CCT?GTC?TCC?AGC?TGC?ATC

CAG?CGC?TTG?CTG?GAC?CAG?GGC?AAG?AGC?TCC?CTG?GAC?ATA?CGG?ATT

GCC?TGT?GAG?CAG?TGT?CAG?GAG?ACC?GGC?GCA?AGC?CTG?GTG?CTC?CTG

GGC?AAG?AAG?AAG?AAG?AAA?GAA?GAG?GAG?GGG?GAA?GGG?AAG?AAG?AGG

GAT?GGA?GAA?GGA?GGG?GCG?GGA?GGG?GAC?GAG?GAG?AAG?GAG?CAG?TCG

CAC?AGA?CCT?TTC?CTC?ATG?CTG?CAG?GCC?CGC?CAG?TCT?GAA?GAC?CAT

CCT?CAC?CGG?CGC?CGG?CGG?CGG?GGC?CTG?GAG?TGT?GAC?GGC?AAG?GTC

AAC?ATC?TGC?TGT?AAG?AAA?CAG?TTC?TTT?GTT?AGT?TTC?AAG?GAC?TTT

GGC?TGG?AAT?GAC?TGG?ATC?ATT?GCT?CCC?TCC?GGC?TAC?CAC?GCC?AAC

TAC?TGT?GAG?GGT?GAG?TGC?CCC?AGC?CAC?ATA?GCA?GGC?ACA?TCG?GGC

TCA?TCC?CTC?TCC?TTT?CAC?TCG?ACG?GTC?ATC?AAC?CAC?TAC?CGC?ATG

CGG?GGC?CAC?AGC?CCC?TTC?GCC?AAC?CTC?AAG?TCG?TGC?TGT?GTG?CCC

ACC?AAG?CTG?AGA?CCC?ATG?TCC?ATG?TTG?TAC?TAT?GAC?GAT?GGG?CAG

AAC?ATC?ATC?AAG?AAG?GAC?ATC?CAG?AAC?ATG?ATC?GTG?GAG?GAG?TGT

GGT?TGC?TCA?TAG?agc?gcccagcctg?ggggggatgg?gagcgagacg

gtccagagaa?gacagtggtg?acacgaagac?atgtttaagg?tttctgactg

aaacaacc；

tgagctc?ATG?GTG?CTG?CAC?CTA?CTG?CTC?TTC?TTG?CTG?CTG?ACC?CCA

CAG?GGT?GGG?CAC?AGC?TGC?CAG?GGG?CTG?GAG?CTG?GCC?CGG?GAA?CTT

GTT?CTG?GCC?AAG?GTG?AGG?GCC?CTG?TTC?TTG?GAT?GCC?TTG?GGG?CCC

CCC?GCG?GTG?ACC?AGG?GAA?GGT?GGG?GAC?CCT?GGA?GTC?AGG?CGG?CTG

CCC?CGA?AGA?CAT?GCC?CTG?GGG?GGC?TTC?ACA?CAC?AGG?GGC?TCT?GAG

CCC?GAG?GAA?GAG?GAG?GAT?GTC?TCC?CAA?GCC?ATC?CTT?TTC?CCA?GCC

ACA?GAT?GCC?AGC?TGT?GAG?GAC?AAG?TCA?GCT?GCC?AGA?GGG?CTG?GCC

CAG?GAG?GCT?GAG?GAG?GGC?CTC?TTC?AGA?TAC?ATG?TTC?CGG?CCA?TCC

CAG?CAT?ACA?CGC?AGC?CGC?CAG?GTG?ACT?TCA?GCC?CAG?CTG?TGG?TTC

CAC?ACC?GGG?CTG?GAC?AGG?CAG?GGC?ACA?GAC?GCC?TCC?AAT?AGC?TCT

GAG?CCC?CTG?CTA?GGC?CTG?CTG?GCA?CTG?TCA?CCG?GGA?GGA?CCC?GTG

GCT?GTG?CCC?ATG?TCT?TTG?GGC?CAT?GCT?CCC?CCT?CAC?TGG?GCC?GTG

CTG?CAC?CTG?GCC?ACC?TCT?GCT?CTC?TCT?CTG?CTG?ACC?CAC?CCC?GTC

CTG?GTG?CTG?CTG?CTG?CGC?TGT?CCC?CTC?TGT?ACC?TGC?TCA?GCC?CGG

CCT?GAG?GCC?ACG?CCC?TTC?CTG?GTG?GCC?CAC?ACT?CGG?ACC?AGA?CCA

CCC?AGT?GGA?GGG?GAG?AGA?GCC?CGA?CGC?TCA?ACT?CCC?CTG?ATG?TCC

TGG?CCT?TGG?TCT?CCC?TCT?GCT?CTG?CGC?CTG?CTG?CAG?AGG?CCT?CCG

GAG?GAA?CCG?GCT?GCC?CAT?GCC?AAC?TGC?CAC?AGA?GTA?GCA?CTG?AAC

ATC?TCC?TTC?CAG?GAG?CTG?GGC?TGG?GAA?CGG?TGG?ATC?GTG?TAC?CCT

CCC?AGT?TTC?ATC?TTC?CAC?TAC?TGT?CAT?GGT?GGT?TGT?GGG?CTG?CAC

ATC?CCA?CCA?AAC?CTG?TCC?CTT?CCA?GTC?CCT?GGG?GCT?CCC?CCT?ACC

CCA?GCC?CAG?CCC?TAC?TCC?TTG?CTG?CCA?GGG?GCC?CAG?CCC?TGC?TGT

GCT?GCT?CTC?CCA?GGG?ACC?ATG?AGG?CCC?CTA?CAT?GTC?CGC?ACC?ACC

TCG?GAT?GGA?GGT?TAC?TCT?TTC?AAG?TAT?GAG?ACA?GTG?CCC?AAC?CTT

CTC?ACG?CAG?CAC?TGT?GCT?TGT?ATC?TAA?ggg?tggggggtct

tccttct?taa?tcc；ot

GCC?CGG?CAG?TCT?GAA?GAC?CAC?CCT?CAT?CGC?CGG?CGT?CGG?CGG?GGC

TTG?GAG?TGT?GAT?GGC?AAG?GTC?AAC?ATC?TGC?TGT?AAG?AAA?CAG?TTC

TTT?GTC?AGT?TTC?AAG?GAC?ATC?GGC?TGG?AAT?GAC?TGG?ATC?ATT?GCT

CCC?TCT?GGC?TAT?CAT?GCC?AAC?TAC?TGC?GAG?GGT?GAG?TGC?CCG?AGC

CAT?ATA?GCA?GGC?ACG?TCC?GGG?TCC?TCA?CTG?TCC?TTC?CAC?TCA?ACA

GTC?ATC?AAC?CAC?TAC?CGC?ATG?CGG?GGC?CAT?AGC?CCC?TTT?GCC?AAC

CTC?AAA?TCG?TGC?TGT?GTG?CCC?ACC?AAG?CTG?AGA?CCC?ATG?TCC?ATG

TTG?TAC?TAT?GAT?GAT?GGT?CAA?AAC?ATC?ATC?AAA?AAG?GAC?ATT?CAG

AAC?ATG?ATC?GTG?GAG?GAG?TGT?GGG?TGC?TCA?TAG?agttg?cccagcccagggggaaaggg?agcaaga

Wherein the Nucleotide of lowercase representative is represented non-translated sequence; With

(b) described dna molecular is inserted in the cloning vector.

2, according to the process of claim 1 wherein that described dna molecular is people or cow genome group DNA.

3, according to the method for claim 1, comprising:

(ⅰ) provide many RNA sequences, one or more is a kind of RNA sequence that contains corresponding to the RNA sequence of the dna molecular of claim 1;

(ⅱ) synthetic dna sequence dna corresponding to described RNA sequence is to form the dna sequence dna storehouse;

(ⅲ) described DNA sequence is inserted in the cloning vector of a self-replicating, to form the cloning vector of a reorganization;

(ⅳ) the recombinant cloning vector transformed host cell of usefulness step (ⅲ);

(ⅴ) determine which cell has and the sequence with the probe sequence hybridization that is selected from following probe:

T G

Probe 15 ' C CAT AANCCNCC 3 '

G A

A A T A

Probe 25 ' CCGAT TC TT AA 3 '

T G C G

Probe 35 ' ACGCCTGACTCCAGGA 3 '

Probe 45 ' CCTCCCAGTTTCATCT 3 '

C C

Probe 55 ' ATGTT ACCTT CCGTC 3 '

G G

Probe 65 ' CTTTGAGATTTCCAAAGAAGGC 3 '

(ⅵ) screen the transformed host cell that step (ⅴ) is identified.

(ⅶ) the insertion dna sequence dna that is contained in the gram load shedding body of the transformed host cell of authentication step (ⅵ).

4, according to the method for claim 3, wherein said marker is a kind of radioactively labelled substance.

5, according to the method for claim 3, wherein many RNA sequences contain people or ox RNA sequence.

6, according to each method among the claim 1-5, wherein said nucleotide sequence is expressed the 43kD subunit of coding statin.

7, according to each method among the claim 1-5, wherein said nucleotide sequence is expressed the 20kD subunit of coding statin.

8, according to each method among the claim 1-5, wherein said nucleotide sequence is expressed the 15kD subunit of coding statin.

9, by each method among the claim 1-8, wherein said carrier DNA is selected from bacterial plasmid, bacteriophage or virus.

10, by the method for claim 9, wherein said carrier is a kind of virus that can duplicate in exsomatize eukaryotic cell or whole organism.

11, by any one method among the claim 1-9, wherein said dna molecular is introduced in the carrier with the sign indicating number of correctly reading that has expression control sequenc.

12, by the method for claim 11, wherein said DNA inset is introduced in the colibacillary beta-galactosidase gene.

13, by any one method among the claim 1-9, wherein said recombinant DNA molecules comprises a kind of pBR322 that inserts described dna molecular, pUR290, pUR291, pUR292 of being selected from, pBTA286, pUC7, pUC8, pUC9, pUC13, ptrpL1, pWT111, pWT121 and pWT131 plasmid.

14, by the method for claim 11, wherein said expression control sequenc connects by operation and described dna molecular.

15, by the method for claim 14, wherein said expression control sequenc is selected from the leftward promotor of colibacillary beta-galactosidase gene, trp operon, λ bacteriophage or the long repeating unit of holding of Moloney Leukemia virus.

16, by the method for claim 14, wherein said expression control sequenc comprises a promotor and a rotaring intertranslating start signal.

17, by each method among the claim 1-9, wherein said recombinant DNA molecules is selected from the front and described and be defined as pBTA22, pBTA23, pBTA28, pBTA29, pBTA30, the plasmid of pBTA290 and pBTA292-pBTA305.

18, a kind of host of conversion is so that this host can produce whole, the part or the method for precursor of statin, this method comprises provides a kind of suitable host, and will introduce among the described host correctly to read sign indicating number by at least a recombinant DNA molecules that each method produced of claim 1 to 17, obtain host transformed.

19, by the method for claim 18, wherein said host is selected from bacterial cell, yeast, fungi, bacteriophage and comprises vertebrates and the eukaryotic cell of vegetable cell.

20, by the method for claim 19, wherein said conversion host can express 43KD, 20KD or the 15KD subunit of the statin of non-glycosylated form.

21, by the method for claim 19, the 43KD of wherein said statin, 20KD or 15KD subunit are equivalent to the sequence of people or ox statin.

22, by the method for claim 18, wherein said conversion host is selected from following conversion microorganism: intestinal bacteria BTA1360(CCTCC NO.86-024), intestinal bacteria BTA420(CCTCC NO.86-025), intestinal bacteria BTA422(CCTCC NO.86-026), intestinal bacteria BTA424(CCTCC NO.86-027), intestinal bacteria BTA426(CCTCC NO.86-028) and intestinal bacteria BTA427(CCTCC NO.86-029).

23, a kind of method of biosynthetic polypeptide, described polypeptide comprise statin whole, the part or precursor, this method comprises: provide at least a according to any one the recombinant DNA molecules of method preparation of claim 1-20, with above-mentioned at least a recombinant DNA molecules transformed host cell, make that this host cell can the marking protein product; Cultivate described host cell to express described protein and to collect described protein.

24, by the method for claim 23, wherein said protein forms with interior letter bodily form formula.

25, by the method for claim 23 or 24, wherein said protein is ox or human inhibin hormone's 43KD, 20KD or 15KD subunit or its essential part.

26, by the method for claim 23 or 24, wherein protein is collected with the form of basic purifying.

27, by claim 23 or 24 method, wherein protein comprise one with homologous first peptide sequence of host and one second peptide sequence, described second peptide sequence is the whole, partly or the aminoacid sequence of precursor of statin.

28, by the method for claim 27, wherein said first aminoacid sequence is the part or all of of β-gala neuraminidase, and described host cell is intestinal bacteria.

29, by the method for claim 23 or 24, wherein said protein comprises 43KD, 20KD or 15KD subunit, the 43KD of statin and the combination of 15KD subunit of statin, or the combination of statin 20KD and 15KD subunit.

30, by the method for claim 29, wherein said 43KD, 20KD or 15KD subunit are equivalent to ox or human inhibin hormone's subunit on sequence.

31, a kind of preparation is selected from the nucleotide sequence of the sequence that claim 1 limits and corresponding to the method for the RNA sequence of sequence that claim 1 limits, but comprising, this method provides conversion host that a kind of method by claim 18 produces and at statin or its a part of antiserum(antisera) with the evaluation expression inhibiting is plain or its a part of transformed host cells.

Images