CN1453294A - Fusion and solubility expression of cobratoxin and acidolysis release and purification of recombinant toxin - Google Patents

Abstract

The present invention discloses the fusion solubility expression of cobratoxin and acid schizolysis release and purification of recombinant toxin. It includes the determination of the physical and chemical properties of the natural toxin, the cloning and fusion solubility expression of the neurotoxin gene, fusion site improvement of recombinant protein, and the acid schizolysis release and purification of the recombinant toxin. By means of the gene engineering method of producing recombinant neurotoxin, great amount of recombinant neurotoxin may be obtained for clinical application without natural condition limitation.

Description

The acidolysis release and the purification process thereof of the proteic fusion soluble-expression of a kind of Cobratoxin, recombinant toxin

Invention field

What the present invention relates to is the proteic fusion soluble-expression of a kind of Cobratoxin, the proteic acidolysis release of recombinant neurotoxins and purification process thereof, belongs to biochemical field.

Background technology

The snake venom neurotoxin is according to the different presynaptic neurotoxin and the postsynaptic neurotoxins of being divided into of they and neuromuscular junction relation.Postsynaptic neurotoxin is the maximum a kind of neurotoxin that is studied.The Naja postsynaptic neurotoxin is the protein blocking agent of a class nicotinic receptor, mainly acts on nicotinamide acetylcholine receptor (periphery n receptor) and neurone α 7 acceptors.In recent years, the Cobratoxin albumen of purifying is used for analgesia clinically and obtains good effect, has also represented good prospects for application aspect detoxification.Therefore the clone obtains Naja postsynaptic neurotoxin gene, and the expression of research recombinant neurotoxins has important meaning.

Postsynaptic neurotoxin has many common ground:

1) structurally quite similar, all have " three refer to structure ", the disulfide bond content height;

2) physico-chemical property is close, is basic protein entirely, and stable in properties has resistance to heat and many chemical reagent, does not have enzymic activity;

3) similar to the receptors bind mode, specificity is strong, can only specific combination in the nicotinamide acetylcholine receptor.

Postsynaptic neurotoxin can be divided into two types of long-chain and short-chain neurotoxins according to their aminoacid sequence with the characteristics that combine of acceptor.Short-chain neurotoxin contains 60--62 amino acid and 4 pairs of disulfide linkage, and it only has stronger bonding force with flesh type nicotinamide acetylcholine receptor, and (Fig. 1 a).Long-chain neurotoxin contains 71--74 amino acid and 5 pairs of disulfide linkage, and it and flesh type and α 7 neurone nicotinamide acetylcholine receptors all have very high bonding force (Fig. 1 b).It is similar in long-chain and the short-chain neurotoxin pairing of 4 pairs of disulfide linkage being arranged, and the 5th pair of disulfide linkage in the long-chain toxin is between the 29--33 amino acids.

The common feature of postsynaptic neurotoxin primary structure is that molecule is made up of 60--75 amino acid, contains 4--5 to disulfide linkage (Fig. 1).The amino acid that some high conservatives are arranged in the primary structure, in short-chain neurotoxin, except that the invariant position of 8 Cys, Ser-8, Lys-27, Trp-29, Arg-33, Arg-36 also guards in most of toxin.And in long-chain neurotoxin, except that 10 Cys, Lys-23, Trp-25, Asp-27, Arg-33 also are conserved amino acids.

Do not contain the α spiral in the secondary structure of neurotoxin, mainly be made of 5 antiparallel beta sheets, βZhe Die maintains together by a large amount of hydrogen bonds, and content reaches 40% (Fig. 3).

The result of study of X ray and NMR structure determination shows, many neurotoxins at crystal and solution state all have similar structure, all be to form a hydrophobic core by 4 disulfide linkage, from then on core is stretched out 3 ring (Fig. 2 that limited by disulfide linkage, yellow expression Cys and disulfide linkage), this structure is referred to as " three finger structures " visually and (threefingers), is called as " three finger proteins " with some other albumen with analog structure.Long-chain neurotoxin also has a little ring that is made of the 5th pair of disulfide linkage (Fig. 2 b) at the tip of intermediate ring.The main characteristics of their conformations are that whole molecule is the three chain βZhe Die laminated structures (Fig. 3) that the segment by two segments of intermediate ring II and ring III forms.The maximum differential of long-chain and short-chain neurotoxin structure is that there is a pair of extra disulfide linkage the ring centre of the ring II of long-chain toxin, forms a little ring at the top.

Nearest studies show that this is essential (Servent, D., et al.2000) to the little ring that disulfide linkage forms for long-chain neurotoxin and combining of α 7 neuronal acceptors.

The feasible rare albumen of method mass production by culturing bacterium or true cell of the development of genetic engineering technique becomes possibility, and expressing the neural poison of production reorganization with engineered method has two purposes:

1) neurotoxin is carried out rite-directed mutagenesis, the mode of action of research nicotinamide acetylcholine receptor and activator and antagonist, action site; Simultaneously the functional site of long-chain and short-chain neurotoxin and the functional site of receptors bind are studied.

2) obtain to can be used for clinical recombinant neurotoxins in a large number, can make the source of toxin not be subjected to the restriction of natural condition.

Expression to snake class neurotoxin mainly contains dual mode: secreting, expressing and formation inclusion body fusion rotein.The secreting, expressing yield is lower, the purge process complexity, and some mutant can not secreting, expressing; And the inclusion body expression need be carried out renaturation, and then BrCN removes N end fusion part.

The secretor type fusion vector expressed fusion protein ZZ--Ea secretion of Erabutoxina (Ea) enters substratum, centrifugal removal thalline, supernatant 0.2 μ m membrane filtration, 10,000Dalton membrane ultrafiltration, IgG-Sepharose affinity purification, the fusion rotein freeze-drying is dissolved in the 0.1N hydrochloric acid, after 500 times of excessive BrCN cracking, reverse successively column purification, ion-exchange purification.Final recombinant protein yield is that every liter of nutrient solution is 0.025～0.5mg.With the series mutation body of this method production Erabutoxin, the functional site of scrutiny short-chain neurotoxin and nAChR receptors bind (Tr ē meau, o., et al., 1995).

Expression to a-cobratoxin is that gene clone is gone in the pCP carrier, and by E.coli bacterial strain BL (DE3) amalgamation and expression, fusion rotein is by the IgG-Sepharose affinity purification, BrCN cracking, renaturation, oppositely C4 column purification.The recombinant protein yield is that every liter of nutrient solution is 0.5～1.2mg.Produce the recombinant alpha-cobratoxin of expression and its mutant, in order to functional site (Antil, S., the et al.1999 of research long-chain neurotoxin; Servent, D., et al., 2000).

After Cobrotoxin expresses with pET20b (+), form inclusion body, with denaturing agent dissolving, renaturation, high performance liquid phase purifying, but in BrCN cracking simultaneously fusogenic peptide, cause the neural N that recombinates to hold heterogeneity, hold isomerization (Chang, the L-S. of the recombinant neurotoxins research Cobrotoxin of fusogenic peptide with the N of band, et al., 1999).

Three kinds of homologous Cobratoxins are expressed with pET28b+, the recombinant protein of expressing forms inclusion body, use guanidine hydrochloride dissolution, through two steps dialysis renaturation, the recombinant protein freeze-drying that will have fusogenic peptide concentrates, and is used to measure lethal toxicity (Zhong, the X-Y. of the mouse of toxin, et al., 2000).

In order specifically to carry out follow-up work of the present invention, the researchist at first measures the physico-chemical property and the sequence of the natural Cobratoxin that the present invention relates to.

In said determination, the Cobratoxin lyophilized powder is provided by the research of the military region, Jinan pharmaceutical biological product.Acetonitrile is a chromatographically pure, and experimental water is ultrapure water (18.2M Ω).Capillary electrophoresis column 75 μ m * 57cmFS are Supleco company product.Freund adjuvant (Freund`s Adjuvant) is a Gibcol company product.TFA, TEMED, ammonium persulphate, acrylamide and N, N '-methylene diacrylamide is available from Sigma company.SDS-PAGE low molecular weight protein (LMWP) standard is available from the beautiful pearl east wind in Shanghai Bioisystech Co., Ltd.

Employed electrophoresis apparatus is an Amersham Pharmacia company product, and Mini proteinII type electrophoresis chamber and glue mould are the Bio-Rad product.The protein sequencing instrument is ABI 337 Sequencing of PE company, and mass spectrograph is Britain Autospec-UltimaETOF.Capillary electrophoresis apparatus is Beckman P/ACE System 5000.High-efficient liquid phase chromatogram HPLC is a Shimazu company product.The reverse chromatograms post is ZORBAX 300 SB-C8.GDS-8000 gel images treatment system is a UVP company product.

Concrete experimental technique is as follows:

The SDS-PAGE electrophoresis

The solution preparation: acrylamide soln (30%): get acrylamide 60g and N, N '-methylene diacrylamide 1.6g is dissolved in water, and is settled to 200ml, and filter paper filtering keeps in Dark Place in the brown bottle.

The separation gel damping fluid: get Tris 36.3g, add water 70ml dissolving, hydrochloric acid is transferred pH to 8.8, is settled to 100ml.

Concentrate the glue damping fluid: get Tris 6.0g, add water 70ml dissolving, hydrochloric acid is transferred pH to 6.8, is settled to 100ml.

Electrode buffer: get Tris 6.0g, glycine 28.8g, SDS 1.0g, add water 800ml dissolving after, be settled to 1000ml.

SDS solution (20%): get SDS 20g, add water 70ml dissolving, be settled to 100ml.

Ammonium persulphate liquid (10%): get ammonium persulphate 1g, add water 8ml dissolving, be settled to 10ml.

Tetrabromophenol sulfonphthalein solution (0.1%): get in the 0.1g tetrabromophenol sulfonphthalein 100ml volumetric flask, be dissolved in water, be settled to scale.

The 2X sample buffer: get and concentrate glue damping fluid 2.5ml, 20%SDS solution 2.5ml, 0.1% tetrabromophenol sulfonphthalein solution 1.0ml,

Glycerine 3ml, mercaptoethanol 1.0ml, mixing, airtight, 4 ℃ of preservations.

Stationary liquid: get glacial acetic acid 400ml, methyl alcohol 100ml adds water 500ml mixing.

Destainer: get glacial acetic acid 100ml, add water 900ml, mixing.

Staining fluid: get Xylene Brilliant Cyanine G G-250 0.1g, be dissolved in the 500ml destainer, fully after the dissolving, remove by filter insolubles, airtight preservation.

Preparing gel: 16% separation gel preparation: vertical panel glue mould is installed, to separate glue (acrylamide soln: separation gel damping fluid: SDS solution: ammonium persulfate solution: water: TEMED=5.0: 1.52: 0.08: 0.1: 5.3: 0.01) pour in the mould, to the about 3cm of glass top place.Water binds, and polymerization finishes, and the layer that anhydrates inclines.

Concentrate the preparation of glue: on separation gel, pour into concentrated glue (acrylamide soln: concentrate the glue damping fluid: SDS solution: ammonium persulfate solution: TEMED: water=0.83: 1.25: 0.025: 0.05: 0.005: 2.37), insert sample comb, polymerization finishes, and carefully takes out sample comb.

Specimen preparation: extracting sample solution is an amount of, adds isopyknic 2X sample buffer, and 95 ℃ of water-baths 5 minutes are centrifugal after the cooling, standby.

Last sample and electrophoresis: electrophoresis chamber adds electrode buffer up and down, and each sample adds 20 μ l samples and molecular weight standard albumen respectively, and establishing starting voltage is 80V, after treating that tetrabromophenol sulfonphthalein is taken concentrated glue out of, transfer voltage to 120V, when the continuation electrophoresis is 1cm to tetrabromophenol sulfonphthalein apart from glass plate edge, stop electrophoresis.

Fixing, dyeing and decolouring: electrophoresis takes off sheet glass after finishing, and gel adds an amount of stationary liquid, and room temperature is fixed 30 minutes.Outwell stationary liquid, add an amount of staining fluid, dye after 1 hour, outwell staining fluid, decolour to background transparent with destainer.Change the water logging bubble, stop decolouring.

Image processing: with image processing system gel is carried out imaging, purity of protein analysis and quantitative.

Reverse phase liquid chromatography:

Mobile phase A: 0.1%TFA has the aqueous solution; B: contain 0.1%TFA, the aqueous solution of 80% acetonitrile

Chromatographic column: ZORBAX 300 SB-C8

Column temperature: 36 ℃

Flow velocity: 1.0ml/min

Sampling volume: 50 μ l

Type of elution: the initial 100%A balance chromatographic column of using increased B to 60% with 1%B/min after 15 minutes, kept 10 minutes, and 100%B washed post after 10 minutes then.RestPose, diode array all-wave is long to be detected.

The free zone electrophoresis of kapillary: the pH2.5 phosphate buffered saline buffer with 0.1mol/L is an electrode solution, and kapillary is 75 μ m * 57cmFS, and column temperature is made as 25 ℃, and running voltage is 1.4kV, sample introduction: pressure 0.5psi, 5 seconds, the UV-detector wavelength was 210nm.

The N terminal amino acid sequence is measured: after the Cys in the albumen is carried out derivatization treatment, carry out according to the standard of instruments schedule of operation, adopt pvdf membrane solid phase Edman sequencing.

Mass spectrum: be dissolved in through the sample of desalination and contain 50% methyl alcohol, in 0.1% the acetic acid water solution, according to standard of instruments program electric spray sample introduction, positive ion detects.

Test resulting Cobratoxin molecular weight, purity and ultraviolet spectrum characteristic are as follows:

The neurotoxin apparent molecular weight of SDS-PAGE cataphoretic determination is 16,500daltons, and its purity is greater than 95% (Fig. 4).And electrospray ionization mass spectrum to measure its molecular weight be 6946daltons (Fig. 5).Chang, L.S. waits (1996) to think that the segment between the 23-28 amino acids of cobrotoxin and the interaction of other residues cause this class neurotoxin electrophoretic unusual.

Free zone band capillary electrophoresis purity is greater than 98% (Fig. 6).Oppositely (Fig. 7 a), the main peak retention time is at 24.3min, and the full wavelength scanner of main peak (190-800nm) characteristic absorbance is at 202nm and 276nm (Fig. 7 b) greater than 98% for high-performance liquid chromatogram determination purity.

The N terminal sequence of Cobratoxin: 15 aminoacid sequences of neurotoxin N end of mensuration are Leu-Glu-Cys-His-Asn-Gln-Gln-Ser-Ser-Gln-Thr-Pro-Thr-Thr-Thr (sequence 1).

Natural Cobratoxin of the present invention is to produce from the Hunan to extract purifying the Chinese cobra snake venom, is the amorphous lyophilized powder of white, and easy moisture absorption deliquescence is-20 ℃ of airtight preservations.

It is carried out purity and property analysis: SDS-PAGE from three aspects, the free zone electrophoresis of RP-HPLC and kapillary.The purity of measuring with different methods is all greater than 95%, and protein sequence is measured and required purity greater than 95%, meets the requirement that protein sequence is measured.Obtained simultaneously at the chromatogram keeping characteristics of C8 post and the migration feature of capillary zone electrophoresis.At 276nm characteristic absorbance is arranged, illustrate that albumen has die aromatischen Aminosaeuren.Because the unusual electrophoresis behavior of neurotoxin carries out electrospray ionization mass spectrum and measures its definite molecular weight.

Summary of the invention

The object of the present invention is to provide the proteic amalgamation and expression of a kind of Cobratoxin, the proteic acidolysis of reorganization Cobratoxin to discharge and the production purification process.

Below be the detailed content of the method for the invention,, can be well understood to the present invention by following content and in conjunction with figure and explanation thereof.One, a kind of clone of Cobratoxin gene and the expression study in three kinds of different E.coli carriers thereof

Rich and varied based on the protein individual character, not having a kind of carrier is general to all proteic expression, be applicable to that expressing certain proteic carrier then may not be fit to another kind of albumen, so the present invention seeks the expression vector that is fit to target protein of the present invention by following experiment.1, material and instrument

1.1 reagent and consumptive material

It is German QIAgen company product that total RNA (Yeast Nucleic Acid) extracts test kit RNeasy Mini Kit, reverse transcription PCR (polymerase chain reaction) test kit SUPERSCRIP ^TMONE-STEP ^TMRT-PCR System is available from Gibcol company.A small amount of and a large amount of plasmid extraction kit are available from Shanghai China Shun bio-engineering corporation.DNA PCR System and AP coupling goat anti-rabbit antibody are the product of Huamei Bio-Engrg Co..Primer is given birth to worker bio-engineering corporation by Shanghai and is synthesized.Restriction endonuclease is available from U.S. New England Biolab company.The T4 dna ligase is available from German Boehringer Mannheim company.PGEM-T Easy Vector System is a Promega company product.Pvdf membrane is available from Gelman company.Enzyme plate is Nunc 96 hole flat undersides.

1.2 bacterial strain and plasmid

E.coli BL21 is available from Amersham Pharmacia company.E.coli bacterial strain TOP10, pBAD/gIII carrier are Invitrogen company product.Fusion expression vector pThioHis C is provided by this institute vaccine two Room, carrier pBV220 and E.coli bacterial strain DH5 α, and HB101 is provided by Military Medical Science Institute eight.

1.3 instrument

The PCR instrument is the Cyclogene Thermal Cycler of Britain Techne company, and Multiphor II electricity rotary device is an Amersham Pharmacia company product.2, experimental technique

2.1 the total RNA of Naja poison gland (Yeast Nucleic Acid) extracts

The snake venom gland extracts: after the Hunan was produced the Chinese cobra Plating and adopted snake venom, head-breaking was put to death, and wins both sides poison gland rapidly, dropped in the liquid nitrogen quick-frozen after removing subsidiary muscle.Preserve in the liquid nitrogen.

Total RNA (Yeast Nucleic Acid) extracts according to RNeasy ^Mini Handbook carries out.

2.2 PCR (polymerase chain reaction) design of primers

According to 15 amino acid whose sequences of neurotoxin N end of measuring, with Blast Search retrieval homologous protein.Analyze the homologous protein sequence, find out conserved amino acid and corresponding nucleotide sequence, by homologous protein cDNA both sides conserved regions, design RT-PCR primer is used Primer Calculator software primer is assessed.Choosing best a pair of primer synthesizes.

Primer 1:5 ' ATG CTG GAA TGT CAC AAC CAA C (sequence 2)

Primer 2: 5 ' CTA ATT GTT GCA TCT GTC TGT T (sequence 3)

Set PCR (polymerase chain reaction) reaction constant according to assessment result.

2.3?RT-PCR

Add 25 μ l reaction buffers successively by the test kit explanation, each 1 μ l of forward and reverse primer, the total RNA of 1-5 μ l (Yeast Nucleic Acid), 1 μ l reversed transcriptive enzyme and Tap enzyme mixture, adding water to cumulative volume is 50 μ l.50 ℃ of incubations 35 minutes, 94 ℃ of thermally denatures 2 minutes are finished reverse transcription; With 94 ℃ of sex change 30 seconds, annealed 30 seconds for 41 ℃, 72 ℃ were extended 26 seconds, and carried out 40 circulations.Last circulation extension time is 7 minutes.The electrophoretic examinations amplification.

2.4 T-A carrier cloning and mensuration

Get RT-PCR product 0.2,1.0 μ l respectively, add 5 μ l 2x and connect damping fluid, 1.0 μ l pGEM-T Easy carriers, 1.0 μ l T4-DNA ligase enzymes, adding water to cumulative volume is 10 μ l.Room temperature connects 3.5 hours.Get the JM109 E.coli cell that connects product 2-8 μ l transformed competence colibacillus, with the negative contrast of plasmid pGEM-5f transformation receptor bacterium, coating IPTG/X-Gal flat board, 37 ℃ are cultured to and grow single bacterium colony, carry out indigo plant and screen in vain.Select white colony, extract plasmid, the Ecorl enzyme is cut preliminary evaluation.Measure and insert the segment complete sequence.

2.5 be cloned into the abduction delivering of fusion expression vector pThioHis C and fusion rotein

2.5.1 the neurotoxin gene two ends add Kpn I and Sal I site (base sequence in the shade) respectively

With the T carrier that contains neurotoxin gene is that template is carried out PCR (polymerase chain reaction) amplification, 94 ℃ of sex change 30 seconds, and 55 ℃ of annealing 30 seconds, 72 ℃ were extended 26 seconds, and reacted 40 circulations.Kpn I and Sal I enzyme are cut PCR (polymerase chain reaction) product, reclaim DNA, as inserting segment.

2.5.2 carrier double digestion and connection transform

PThioHis C carrier extracts, Kpn I and Sal I double digestion, and carrier glue recovery etc. are carried out according to conventional procedure.Electrophoresis estimation enzyme is cut carrier and is inserted pulsating concentration, carry out ligation with the carrier of difference amount and the insertion segment of equivalent, transformed competence colibacillus TOP10 E.coli, 37 ℃ are cultured to and grow single bacterium colony, select several single bacterium colony order-checkings, determine to insert segment and correctly be connected in the carrier.

2.5.3 the abduction delivering of neurotoxin fusion rotein

Inoculate single bacterium colony to 50mlLB liquid nutrient medium (100 μ g/ml penbritin), 37 ℃, the 200rpm shaking culture is spent the night.Be seeded to fresh LB substratum with 1: 50 next day, continues shaking culture to thalline OD ₆₀₀Be about 0.5.Adding IPTC is 1mmol/L to final concentration, and continuation was cultivated four hours.Before adding IPTC and after adding, got 0.1ml bacterium liquid every 1 hour, centrifugal, supernatant discarded, thalline is labeled as 0,1,2,3 respectively, 4,5 hours abduction delivering product.Add 2x SDS-PAGE sample-loading buffer 0.1ml, abundant mixing, 95 ℃ of heating in water bath 10 minutes.Sample on the 20 μ l, electrophoretic examinations.

2.5.4 the osmotic shock of fusion rotein discharges

Inoculate single bacterium colony to 50mlLB liquid nutrient medium (100 μ g/ml penbritin), 30 ℃, the 200rpm shaking culture is spent the night.Be seeded to fresh LB substratum with 1: 50 next day, and 37 ℃ of shaking culture are to thalline OD ₆₀₀Be about 0.5.Add IPTG to concentration be 1mmol/L.Continued shaking culture 5 hours.Measure thalline OD ₆₀₀Value, 4 ℃ 6, the centrifugal collection thalline of 000rpm is abandoned supernatant, and thalline is suspended in an amount of cold osmotic shock 1# solution (20mmol/L Tris, pH8.0,5mmol/L EDTA, 20% sucrose), makes cell density OD ₆₀₀Be about 5.0, ice-water bath, 10 minutes.Centrifugal, supernatant discarded, thalline is suspended in the cold osmotic shock 2# solution of equivalent (20mmol/L Tris, pH8.0,5mmol/L EDTA), ice-water bath, 10 minutes.4 ℃ 10, centrifugal 15 minutes of 000rpm gets supernatant, and-20 ℃ frozen.Protein electrophoresis is checked.

2.5.5 different host bacterium are to the influence of amalgamation and expression

Must get the pThioHis C carrier that contains neurotoxin gene, it is described that Transformed E .coli BL21, abduction delivering, osmotic shock press the 2.5.4 joint.Relatively E.coli bacterial strain TOP10 and BL21 are to the difference of expressing fusion protein.

2.6 excretion vector pBAD/gIII expresses neurotoxin

2.6.1 experimental design

The pBAD/gIII carrier inserts the zone:--BamHI--signal peptide-NdoI-Ecl136I-XhoI-XbaI, design primer a1, a2 amplifies Segment a: BamHI--signal peptide-XboI

Neurotoxin gene 5 ' end codon conversion does not change coded amino acid, increases the XhoI site, and 3 ' end increases the XbaI site, design primer b1, and b2 amplifies Segment b: XhoI---neurotoxin gene--XbaI

To amplify segment a and be connected by Xho I, form with b Segment c: BamHI---signal peptide-neurotoxin gene-XbaI is a template with this segment, and with a1, b2 is the primer segment c that increases in a large number.BamHI and XhoI double digestion segment c and vector plasmid pBAD/gIII connect, and neurotoxin gene is inserted after the signal peptide just, make up and finish secretive expression vector.

2.6.2 expression plasmid makes up synthetic primer

A1:5 ' CGC GGA TCCTAC CTG ACG CTT (sequence 8)

A2:5 ' CCG CTC GAGGCT ATG GCT AT (sequence 9)

B1:5 ' CCG CTC GAGTGT CAC AAC CAA C (sequence 10)

B2:5 ' GC TCT AGAIt is 50pmol/L. that TTA ATT GTT GCA TCT GT (sequence 11) primer is dissolved in sterile pure water concentration

Amplification segment a:0.5 μ l template pBAD/gIII, primer a1, each 0.5 μ l of a2, PCR (polymerase chain reaction) damping fluid 5 μ l, dNTP 4 μ l add 50 μ l, mixing.94 ℃ of sex change 30 seconds, 50 ℃ of annealing 30 seconds, 72 ℃ were extended 26 seconds, and reacted 40 circulations.

Amplification segment b:0.5 μ template contains the pGEM-T carrier of neurotoxin gene, and annealing temperature is 58 ℃, and other condition is with amplification segment a.

Segment a is connected with b: carries out according to routine operation, and the amplified production purifying, the XhoI enzyme is cut.The concentration of electrophoresis estimation a and b is provided with ligation with 1: 1, and 4 ℃, the T4DNA ligase enzyme connects and spends the night.

A is connected the segment amplification with b: get connection product 1.0 μ l templates, and each 0.5 μ l of primer a1 and b2, annealing temperature is 55 ℃, other condition is with amplification segment a.Segment a is connected product with b be c.

Carrier and pulsating connection of insertion transform and screening: segment c BamHI and XhoI double digestion, conduct insertion segment behind the purifying.PBAD/gIII BamHI and XhoI double digestion, the big segment of gel electrophoresis Separation and Recovery.Insert segment 0.1,1.0 μ l respectively, with 5 μ l carrier mixings, add 1.0U T4DNA ligase enzyme, 4 ℃, connection is spent the night.Transformed competence colibacillus TOP10 recipient bacterium, spread plate was cultivated 18 hours for 37 ℃, selected single bacterium colony, and enzyme is cut and is differentiated insertion, order-checking.

2.6.3 the abduction delivering of neurotoxin

Inoculate single bacterium colony to 10mlLB liquid nutrient medium (50 μ g/ml penbritin), 37 ℃ of shaken overnight are cultivated.Be forwarded to 6 fresh 4ml LB liquid nutrient mediums at 1: 50 next day, continue shaking culture to cell density OD ₆₀₀Be about 0.5.Adding pectinose to concentration respectively is 0.2%, 0.02%, 0.002%, 0.0002%, 0.00002%, and another is a blank.Continue to cultivate after 4 hours, 4 ℃ of high speed centrifugations are collected thalline.1) SDS-PAGE electrophoretic examinations expression.2) the complete ultrasonic freeze-thaw method fragmentation of bacterium checks whether expressing protein is solvable.3) the osmotic shock method checks whether expressing protein can discharge in the pericentral siphon chamber.

2.7 temperature-induced type loads the expression of body pBV220 to neurotoxin

2.7.1 the neurotoxin gene two ends add EcoR I and sal I site and codon ATG synthetic primer

5 ' CGG GAA TTC GAT T AT GCT GGA ATG (sequence 12)

5 ' GGC GAC GAC TTA ATT GTT GCA TCT (sequence 13)

The T carrier that carries neurotoxin gene is template 1.0 μ l, and annealing temperature is 50 ℃, and other conditions are described with the 2.6.2 joint.Electrophoretic examinations, purifying PCR (polymerase chain reaction) product.

2.7.2 the structure of expression vector

PCR (polymerase chain reaction) product and plasmid pBV220 EcoR I and sal I double digestion, purifying connects, and Transformed E .coli DH5 α carries out as described in 2.5.2.

2.7.3 the thermal induction of neurotoxin gene is expressed

Inoculate single bacterium colony to 10mlLB liquid nutrient medium (50 μ g/ml penbritin), 37 ℃ of shaken overnight are cultivated.Be converted into fresh LB liquid nutrient medium at 1: 50 next day, continue shaking culture to cell density OD ₆₀₀Be about 0.5.Elevated temperature to 42 ℃ continues to cultivate 4 hours, every 1 hour 1ml bacterium liquid, centrifugal collection thalline.1) SDS-PAGE checks the neurotoxin expression.2) ultrasonic freeze-thaw method checks whether expressing protein is solvable.

2.8 immunoblotting (western blot) inspection is identified the recombinant neurotoxins of expressing

2.8.1 natural Cobratoxin rabbit anti-serum preparation

It is an amount of to get neurotoxin, is made into the concentration of 1.0mg/ml, and after the formaldehyde attenuation treatment, with the emulsification of an amount of Freund's complete adjuvant mixing, white rabbit is planted by subcutaneous injection immunity New Zealand, in good time reinforced immunological.Heart extracting blood, the centrifugation antiserum(antisera).

2.8.2 indirect ELISA is checked neurotoxin antibody in the antiserum(antisera)

Neurotoxin is dissolved in the PBSN solution and (contains 0.5%NaN ₃PBS) in, make the solution of 1 μ g/ml and 2 μ g/ml, with 50 μ l/ hole point enzyme plates, flick and make the antigen uniform distribution, preservative film is sealed, and room temperature is incubated overnight.Pure water is sealed up blocking solution and (is contained 0.05%Tween 20,1mmol/L EDTA, 0.25%BSA, 0.05%NaN after washing plate 3 times ₃PBS) room temperature placed 1 hour.Pure water is used PBSN solution 4 multiple proportions serial dilutions respectively with antiserum(antisera) and control serum after washing plate 3 times, gets 50 μ l and is added to each bag by in the hole.Preservative film is sealed, and room temperature is incubated overnight.Pure water is washed plate 3 times.Add the AP coupling goat anti-rabbit antibody 50 μ l/ holes with dilution in 1: 200 with PBSN, the room temperature incubation was washed plate 3 times after 2 hours.Every hole adds colour developing liquid (66 μ l 5%NBT are dissolved in 70% dimethyl formamide, and 33 μ l 5%BCIP are dissolved in 100% dimethyl formamide, mixing in 10ml blockades liquid) 50 μ l colour developing.Microplate reader is measured the absorption value in every hole at 550nm.

2.8.3 immunoblotting

Be modified as follows by standard program (Ao Sibai etc., 1998): use pvdf membrane, with 0.8mA/cm ²Current transfer 1.5 hours, antiserum(antisera) was with dilution in 1: 200, enzyme labelled antibody was an AP coupling goat anti-rabbit antibody, with dilution in 1: 500.Developing time is 30 minutes.3, proteic homology search of experimental result 3.1 natural toxins and design of primers

According to 15 amino acid whose sequences of neurotoxin N end, the result is as follows for Blast Search retrieval homologous protein, retrieves 22 protein sequences altogether.Database：nt

807,597sequences；2,863,827,885total?lettersRID：983778928-6701-21870

Score ESequences producing significant alignments:(bits) Valuegi/4867885/emb/AJ239050.1/NNA239050 Naja naja atra mRNA for... 36 0.32gi/1326084/gb/U42582.1/NAU42582 Naja atra cobrotoxin mRNA; ... 36 0.32gi/12002777/gb/AF161797.1/AF161797 Naja atra short chain ne..., 36 0.32gi/6650220/gb/AF068052.1/AF068052 Naja naja neurotoxin prep..., 36 0.32gi/1399223/gb/U58519.1/NAU58519 Naja atra cobrotoxin`mRNA; ... 36 0.32gi/5524749/emb/Y12492.2/NACOBROTX Naja atra gene encoding c... 36 0.32gi/1688230/gb/U77492.1/NAU77492 Naja atra cobrotoxin```mRN... 36 0.32gi/1399225/gb/U58520.1/NAU58520 Naja atra cobrotoxin``mRNA... 36 0.32gi/1688228/gb/U77491.1/NAU77491 Naja atra cobrotoxin``mRNA... 36 0.32gi/1399227/gb/U58521.1/NAU58521 Naja atra cobrotoxin```mRN... 36 0.32gi/1688226/gb/U77490.1/NAU77490 Naja atra cobrotoxin`mRNA... 36 0.32gi/4185751/gb/AF088998.1/AF088998 Naja atra cobrotoxin III... 35 0.55gi/2688935/gb/AF023271.1/AF023271 Naja sputatrix post synap... 35 0.72gi/3860082/gb/AF096999.1/AF096999 Naja sputatrix post synap... 35 0.72gi/3860086/gb/AF097001.1/AF097001 Naja sputatrix post synap... 34 1.2gi/3860084/gb/AF097000.1/AF097000 Naja sputatrix post synap... 34 1.2gi/2688937/gb/AF023272.1/AF023272 Naja sputatrix post synap... 34 1.2gi/5419941/emb/Y13399.2/NAY13399 Naja atra gene encoding co... 34 1.2gi/2625123/gb/AF031472.1/Naja atra cobrotoxin mRNA,comple... 34 1.2gi/804789/gb/L42002.1/NAJNEUR Naja naja ( clone NTX1 ) neurot... 33 2.7gi/804791/gb/L42003.1/NAJNEURA Naja naja ( clone NTX2 ) neuro... 32 4.7gi/4185749/gb/AF088997.1/AF088997 Naja atra cobrotoxinIV m... 32 8.010： ( 14-23 )

The N end and the C end of ripe toxin protein go out with dash box.These 10 kinds of albumen derive from respectively: 1 AJ239050 Naja naja atra mRNAfor cobrotoxin homolog2 U42582 Naja atra cobrotoxin mRNA, complete cds3 AF161797 Naja atra short chain neurotoxin precursor, gene, complete cds4 AF068052 Najaj naja neurotoxin preprotein precursor, mRNA, complete cds5 U77492 Naja atra cobrotoxin```mRNA, complete cds6 AF088998 Naja atra cobrotoxinIII mRNA, partial cds7 AF023271 Naja sputatrix post synaptic alpha neurotoxin precursor (ntx) mRNA, ntx-3 allele, complete cds8 AF031472 Naja atra cobrotoxin mRNA, complete cds9 AF088997 Naja atra cobrotoxinIV mRNA, partial cds10 AF096999 Naja sputatrix post synaptic alpha neurotoxin precursor (ntx) gene, ntx-1 allele, complete cds

These neurotoxins belong to the Naja Zhoushan subspecies (Najanaja atra Cantor) and the Naja sputatrix of the Elaps (Naja) of Elapidae (Elapidae), all have higher homology, and their N end and C end conservative property are all very strong.According to the base sequence design synthetic primer of their N ends and C end, by Primer Calculator assessment, select best a pair of primer, the result is as follows:

Forward?Primer?????????????????????????????Reverse?PrimerATGCTGGAATGTCACAACCAAC???????????????????????TTGTCTGTCTACGTTGTTAATCA-8(36.36％)?C-6(27.27％)????????????????????A-3(13.64％)C-4(18.18％)G-4(18.18％)?T-4(18.18％)????????????????????G-6(18.18％)T-9(50.00％)Length-22?bases?MW-6709?daltons(g/M)?????????Length-22?bases?MW-6694?daltons(g/M)

T _m????????????????????????????????????T _mNearest?Neighber?T _m????62.12????????????????Nearest?Neighber?T _m??52.23％GC?method?T _m?????????52.97????????????????％GC?method?T _m???????49.252(A+T)+4(G+C)T _m????????64.00????????????????2(A+T)+4(G+C)T _m??????60.00

Forward?Primer???????????????????????????????Reverse?PrimerPrimers?may?fold?and?anneal?against?themselyes.A?likely?folding?scenario?is?displayed?below.

5`-ATGCTGGAATGT3`???????????5`-TTGTCTGTCTAC3`

|?|????????????????????||??|

3`CAAC-CAA?CAC?5`???????????3`CTAATTGTTGPrimers?may?anneal?with?other?copies?of?themselves.Below?is?a?candidate?alignment.5`ATGCTGGAATG?TCACAACCAAAC3`5`TT?G?TCTGTCTA?CGTTGTTAATC3`

|?|||?????|?|||??|?|????????????|??|??|?|?|||?|?|???|3`--CAACCAAC--ACTGTAAGGTCGTA?3`--CTAATTGTTGCATCTGTCTGTT?5`Forward?primers?may?anneal?with?reverse?primers.A?likely?alignment?is?shown?below.

5`--ATGCTGGA?ATGTCACAACCAAAC3`

|???|?|????|??||||??|

3`TTGTCTGTCT-A-CGTTGTTAATC5`

3.2 the clone of neurotoxin gene and complete sequence

The total RNA of snake venom gland (Fig. 8) and the RT-PCR result (Fig. 9) that extract, the master tape size of amplification is about 200bp.The pGEM-T Easy carrier of packing into transforms fourth M109 competent cell, carry to insert pulsating recombinant plasmid and be white in color, and blank plasmid is blue or light blue.White colony accounts for 98% on the flat board.Because respectively there is an EcoRI site on both sides, pGEM-T Easy carrier insertion point.Select 8 white colony rapid extraction plasmids, the EcoRI enzyme is cut evaluation and is all contained insertion segment (Figure 10).

Clone's PCR product fragment and adjacent pGEN-T Easy carrier sequence are as follows: (sequence 24) CCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGC GTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGC dotted line adds the EcoRI site that the frame district is a carrier, and adding the black alkali base is the reverse transcription primer.Inserting the fragment encoding district is: (sequence 25, pure amino acid sequence wherein is: sequence 26)

ATG?CTG?GAA?TGT?CAC?AAC?CAA?CAA?TCA?TCG?CAA?ACT?CCA?ACC?ACT

L???E???C???H???N???Q???Q???S???S???Q???T???P???T???T

ACA?GGT?TGT?TCA?GGT?GGG?GAG?ACC?AAT?TGC?TAT?AAA?AAG?CGT?TGG

T??G????C???S???G???G???E???T???N???C???Y???K???K???R???W

CGT?GAT?CAC?CGT?GGA?TAT?AGA?ACC?GAG?AGG?GGA?TGT?GGT?TGC?CCT

R??D????H???R???G???Y???R???T???E???R???G???C???G???C???P

TCA?GTG?AAG?AAC?GGC?ATT?GAA?ATT?AAC?TGT?TGC?ACA?ACA?GAC?AGA

S???V???K???N???G???I???E???I???N???C???C???T???T???D???R

TGC?AAC?AAT?TAG

C??N????N??stop

Clone's PCR product 5 ' end encoding amino acid sequence is identical with 15 aminoacid sequences of neurotoxin N end, the base complete sequence is translated to aminoacid sequence, complete sequence is identical with cobrotoxin sequence in the gene pool, contains the p-GEM-T Easy carrier called after pGEM-NT of this sequence.

3.3 the amalgamation and expression of neurotoxin in pThioHisC

3.3.1 the structure of fusion expression vector

Being reflected at neurotoxin protein gene two ends by PCR increases by two restriction endonuclease sites, thereby toxin gene is connected in the carrier, and sequencing proof neurotoxin gene correctly is connected in the carrier recombinant plasmid pTN314 of structure such as Figure 11 A.The fusion rotein of expressing is by Trx, the enteropeptidase recognition site, and neurotoxin albumen 3 parts are formed.The neurotoxin albumen n end has the amino acid Val and the Pro of two redundancies.

3.3.2 the abduction delivering of fusion rotein

Recombinant plasmid pTN314 has strong promoter Ptrc, can induce fusion rotein by IPTG.When cell grows into mid-log phase, OD ₆₀₀Be about at 0.5 o'clock, adding IPTG dense extremely eventually is 1mmol/L.Increase along with incubation time, the Expression of Fusion Protein amount also increases, cultivate after 5 hours, the fusion protein expression maximum, account for 28% (Figure 12) of bacterial protein, induction time and thalli growth density, fusion protein expression and fusion rotein account for the relation of the relative quantity of total protein in the thalline and see Figure 13.Inducing in back 1 hour and in 2-3 hour, be the fusion protein expression sharp increase phase, and after inducing 3 hours, expression amount is tending towards stability.Cell density is also basicly stable after inducing 3 hours, but the expressing protein amount continues to increase.Therefore select to induce the back to cultivate and collected thalline in 4 hours.

3.3.3 the osmotic shock purifying of fusion rotein and the differential expression of different strains

The thalline of results discharges fusion rotein through twice osmotic shock, discharges 75.7% of total fusion rotein amount for the first time approximately, discharges 7.5% approximately for the second time, has 16.8% fusion rotein to remain in the cell approximately and is not released.In primary osmotic shock liquid, fusion rotein accounts for 65% of total protein.

In order to study the expression of this plasmid in different strains, select E.coliBL (21) strain of transforming protein enzyme defect, found that this bacterial strain also can efficiently express fusion rotein, use the osmotic shock purifying, the fusion rotein amount that discharges is less than 15%, 80% fusion rotein is retained in (Figure 14, lane 1-3) in the cell.

Osmotic shock is a kind of method of succinctly and efficiently purified fusion protein, through single step purification, albumen is discharged in the damping fluid of low ionic strength, is easy to carry out next step purifying.

3.4 the expression of neurotoxin in excretion vector

3.4.1 the structure of secreted expression carrier

With the pBAD/gIII carrier is template, and the signal peptide segment that goes out of design primer amplification 5 ' end has BamHI, and and then the signal peptide back is the XhoI site, and this restriction enzyme site proteic N of neurotoxin that encodes simultaneously holds preceding two amino acid.And be template with pGEM-NT, the design primer is replaced into the XhoI site with neurotoxin gene 5 ' end, but do not change the sequence of toxin protein, 3 ' end increases the XbaI site after being right after termination codon TAA, after these two sequences were connected by the XhoI site, PCR (polymerase chain reaction) amplified the segment that a large amount of N ends contains the toxin gene of signal peptide for the second time.The unidirectional carrier that is connected into of neurotoxin gene that the N end is contained signal peptide by BamHI and XbaI site.Sequencing proof neurotoxin gene correctly is connected into carrier, recombinant plasmid pBAD-NT such as Figure 16.

3.4.2 the abduction delivering of neurotoxin

The pBAD/gIII plasmid is adjustable E.coli secreted expression carrier, a kind of minor coat protein of gene III coding filobactivirus fd, be long 18 amino acid whose signal peptide sequences, it can pass inner membrance, and recombinant protein is imported (Rfapoza﹠amp in the E.coli pericentral siphon chamber; Webster, 1993).This plasmid is regulated albumen and pectinose promotor (P by araC _BAD) regulating and expressing.When having pectinose, P _BADActivated transcription, gene begin to express, and P when not having pectinose _BADLow-down transcriptional level (Lee, et al., 1987) is only arranged.Protein expression level can be regulated (Guzman, L.M., et al.1995) by the concentration of inductor pectinose

Neurotoxin is by the pectinose abduction delivering, cultivate after 4 hours, collect thalline, thalline whole protein electrophoresis (Figure 17), western blot detects simultaneously, the result shows, when arabinose concentrations is 0.0002% (3.9, lane 4), can detect the expression of neurotoxin by immunoblotting, and concentration is 0.02% o'clock, and it is maximum that expression amount reaches.

The broken thalline of ultrasonic freeze-thaw method is contrast not induce engineering bacteria, detect find to be induced the bacterium expressed proteins concentrate on the precipitation part (Figure 18, A and B, Lane4), only have in the supernatant trace expressing protein (A and B, Lane2).Thalline is carried out twice osmotic shock inspection, induces neurotoxin that bacterium expresses after inducing for the second time, only have trace discharge from the pericentral siphon chamber (A and B, Lane8).

3.5 the temperature-induced expression of neurotoxin in pBV220

3.5.1pBV220 the structure of expression vector

This carrier contains efficient tandem promoter of PRPL, and the CIts857 gene can pass through temperature variation, induces the PL promoter expression, can transform any engineering bacterial strain commonly used (Zhang Zhiqing etc.), plasmid Figure 19 of structure.Behind the elevated temperature, do not detect the obvious expression (Figure 20) of neurotoxin at different induction time SDS-PAGE, changing the host bacterium is the bacterial strain BL (21) of proteolytic enzyme defective, still can not express neurotoxin.Culture temperature is reduced to 30 ℃, 28 ℃, 25 ℃, finally still fail to detect the expression (data not shown) of neurotoxin.

3.6 the mensuration of natural neurotoxin rabbit anteserum antibody titers

When using neurotoxin concentration to be 1 μ g/ml and 2 μ g/ml, antiserum(antisera) is with 1/4 serial dilution (1/4,1/16,1/64,1/256,1/1024,1/4096), indirect elisa method detected result such as Figure 21 are when the antiserum(antisera) extension rate is 256 (0.0039), with blank serum difference maximum, detection specificity is the highest.Therefore carrying out western blot employing dilution in 1: 250 antiserum(antisera).

4 brief summaries

Table 1: three kinds of comparisons that carrier is expressed neurotoxin

Expression vector	Bearer type	Express and solvability	Expression amount	The purifying mode	The renaturation situation
						pTN314	Merge	Express, solvable	28％	Osmotic shock	Do not need
PBAD-NT	Secretion	Express, soluble	Do not survey	Broken bacterium	Need renaturation
						pBV-NT	Non-fusion	Do not express	-	-	-

Neurotoxin gene is packed in three kinds of dissimilar expression vectors, relatively their expression.Amalgamation and expression significantly is better than other two kinds of phraseologies.Therefore select fusion expression vector pTN314 as the emphasis of further studying.

Because bearer type difference, its phraseology is also varied, the neurotoxin that employing pTN314 carrier of the present invention carries out amalgamation and expression has higher expression and soluble expression-form, helps being rich in the recombinant neurotoxins maintenance native conformation of disulfide linkage.Two, the acidolysis of the transformation of reorganization Cobratoxin fusion rotein position of fusion of the present invention and reorganization Cobratoxin discharges

Reorganization Cobratoxin albumen of the present invention discharges from fusion rotein, requires to have between carrier proteins and target protein a cracking site.

In most of fusion expression vector, this site is a special proteolytic enzyme recognition site, is generally zymoplasm, enteropeptidase, the site of proteolytic enzyme such as factor Xa.Be connected with the recognition sequence Asp-Asp-Asp-Asp-Lys of enteropeptidase in the pThioHis carrier at the C of Trx end, the cutting cracking site is at the C of Lys end.

Acid hydrolysis method is used for crack fusion protein, and the reorganization target protein is had two basic demands: 1) target protein should be acidproof, should not contain acid-sensitive sense site.2) heat-resisting, albumen can keep stable when temperature is higher, and when perhaps temperature reduced, metaprotein can recover native conformation.

Recombination ox intestine kinase (EKMax ^TM) be the catalytic subunit of the Enteropeptidase that reaches by pure matrix, a kind of have a highly narrow spectrum serine protease, and the SDS-PAGE4 apparent molecular weight is 43, and 000Dalton, theoretical molecular are 26, and 000Dalton contains 3 Asn baseization sites.Generally recognition site had very high specificity.

The present invention is that fusion rotein is inserted sudden change to position of fusion transformation, add two amino-acid residues (DP) in the front of target protein, and the peptide bond acid labile between them, when hanging down pH, can spontaneously rupture, thereby the recombinant neurotoxins of the redundant Pro of N end is discharged.

1. reagent and material

Recombination ox intestine kinase (EKMax ^TM, EnterkinaseMax ^TM) available from Invitrogen company.The QIAquick of plasmid and PCR (polymerase chain reaction) product purification test kit QIAGE company ^TMSpin, SSCS conversion reagent box is available from Shanghai bio-engineering corporation.

2. experimental technique

2.1 the recombinant neurotoxins enzymolysis process discharges from fusion rotein

From 6 0.5ml centrifuge tubes, respectively get fusion rotein 26 μ l (about 20 μ g of purifying, fusion rotein is produced the third part that purification process is seen specification sheets of the present invention), add 3 μ l 10x enzymolysis damping fluids, add EK enzyme 1.0 respectively, 0.5,0.3,0.2,0.1unit, give over to and be not enzyme-added contrast, adding water, to make cumulative volume be 30 μ l.With per 6 arms is one group, 4 ℃ respectively, and 16 ℃, 25 ℃ of constant temperature hydrolysis, every 12 or 24 hours sampling 5 μ l, SDS-PAGE checked the release of heavily giving neurotoxin, hydrolysis time to 72 hour.

2.1.2 the solid phase enzymolysis of fusion rotein

In the centrifuge tube of per 6 0.5ml, respectively get the fusion rotein 26 μ l (about 20 μ g) of purifying, according to the form below adds sample, the μ l of unit.

Table 2: solid enzyme is separated composition

	control	?1	?2	?3	?4	?5	?6
								Fusion rotein	?50	?50	?50	?50	?50	?50	?50
?10xbuffer	?6	?6	?6	?6	?6	?6	?6
								?0.5MK 3PO 4	?0.6	?0.12	?0.24	?0.36	?0.48	?0.60	?0.60
	?5mM	?1mM	?2mM	?3mM	?4mM	?5mM	?5mM
								?1.0MCaCl 2	?0.6	?0.6	?0.6	?0.6	?0.6	?0.6	?0.6
	?10mM	?10mM	?10mM	?10mM	?10mM	?10mM	?10mM
								?EKM AX	?0.8μ	?0.8μ	?0.8μ	?0.8μ	?0.8μ	?0.8μ	?0.8μ
?H 2O	?3.4	?3.28	?3.16	?3.04	?2.92	?2.8	?2.8

25 ℃ of enzymolysis 72 hours were got 5 μ l every 24 hours, centrifugal, reset and added equivalent electrophoresis sample buffer in the taking-up; Precipitation adds 5 μ l 0.1N dissolving with hydrochloric acid, adds equivalent electrophoresis sample buffer, behind the mixing, drips 1.0M Tris alkali, until solution colour by xanthochromia indigo plant.Supernatant and precipitation electrophoresis are checked the recombinant neurotoxins release conditions.

2.1.3 the amplification of solid phase enzymolysis, the pickling of reorganization Cobratoxin is taken off and immunoblotting

Get the fusion rotein solution 0.5ml of purifying, add enzymolysis damping fluid 60 μ l, add 0.5MK ₃PO ₄With 1.0M CaCL ₂Each 6.0 μ l, mixing adds EKMax 8.0 units, 25 ℃ of incubations 72 hours.Centrifugal, precipitation is used 10mM successively, the 100mM hydrochloric acid vibration dissolving that suspends, 8000rpm, 4 ℃ centrifugal 15 minutes, get supernatant, 5 μ l electrophoretic examinationss and western blot, all the other-20 ℃ are frozen.

2.2 the introducing in the acid-sensitive sense site (DP) in fusion rotein site

2.2.1 primer design and PCR (polymerase chain reaction)

As implied above, this figure is the position of fusion sequence chart of insertion D-P of design, after 5 ' end of the plasmid neurotoxin gene of pTN314 and 3 ' the end terminator codon, Kpn I and Pst I site is arranged, and designs will the encode base sequence of acid-sensitive sense site DP of primer

Be added to neurotoxin gene 5 ' end.Primer is given birth to worker bio-engineering corporation by Shanghai and is synthesized, and is restriction enzyme site in the frame, and dash area is the base sequence of encoding D-P.

PCR (polymerase chain reaction) amplification; With 0.5 μ l p TN314 is template, each 0.5 μ l of forward and reverse primer, and PCR (polymerase chain reaction) damping fluid 5 μ l, dNTP 4 μ l add water to 50 μ l, mixing.94 ℃ of sex change 1.0 minutes, 65 ℃ of renaturation 45 seconds, 72 ℃ were extended 1.0 seconds, and reacted 30 circulations.Last circulation was extended 5 minutes for 72 ℃.

2.2.2 insert the structure of the segmental expression vector of DP

Double digestion: plasmid extracts and PCR (polymerase chain reaction) product purification is undertaken by the test kit handbook.1) get pTN314 plasmid 40 μ l, add 10xbufferl 8 μ l, BSA 0.8 μ l, Kpnl 50 units and Pstl 30 units, adding water to cumulative volume is 80 μ l, abundant mixing, 37 ℃ are incubated 12 hours.2) get PCR (polymerase chain reaction) the product 60 μ l of purifying, add 10xbufferl 15 μ l, BSA 1.5 μ l, Kpnl 100 units and Pstl 50 units, adding water to volume is 150 μ l, fully 37 ℃ of insulations of mixing are 12 hours.Electrophoretic examinations is also reclaimed the big segment of carrier, and the PCR that enzyme is cut (polymerase chain reaction) product is purifying once more, reclaims big segment.

Connect: serial ligation is set, fetches and record body segment 6 μ l, add double digestion PCR (polymerase chain reaction) product 0.4 of purifying respectively, 0.2 0.1 μ l adds 1.0 μ l and connects damping fluid, add T4 dna ligase 1.0 unit, adding water to cumulative volume is 10 μ l.Establish carrier (6.0 μ l) respectively and insert segment (0.4 μ l) contrast.16 ℃, connection is spent the night.

Transform: the preparation of TOP10 competent cell is undertaken by the test kit specification sheets, in the 1.5ml centrifuge tube, get connection product and each 5 μ l of contrast thereof, add recipient cell 100 μ l, the mixings gently of prepared fresh, ice-water bath incubation 10 minutes, 40 ℃ of heat-shockeds 90 seconds were put ice-water bath 5 minutes, added the fresh LB substratum of 0.9ml, 37 ℃, 200rpm shaking culture 1 hour.Get 150 μ l coating LB culture medium flat plate (100 μ g/ml), 37 ℃ are cultured to single bacterium colony and grow.

Select single bacterium colony, plasmid extracts enzyme and cuts evaluation and sequencing.

2.3 the acidolysis of recombinant neurotoxins discharges

2.3.1 the abduction delivering of fusion rotein and purifying preparation

Contain DP and insert the abduction delivering of segment fusion rotein and the first part that specification sheets of the present invention is seen in osmotic shock release, 2.5.3-4 joint.Third part is seen in the purifying preparation of fusion rotein.

2.3.2 the optimization of fusion rotein cracking condition

In the 0.5ml centrifuge tube, get the fusion rotein 40 μ l of purifying, add glacial acetic acid 6.5 μ l or 13 μ l respectively, formic acid 134 μ l or 67 μ l, abundant mixing is in other 2 0.5ml centrifuge tubes, respectively get natural neurotoxin 40 μ l (1mg/ml), add the formic acid and the acetate of equivalent.Mixing, with 4 or 6 side reaction Guan Weiyi group, respectively at 37 ℃, 85 ℃ of insulations.48 hours and 3 hours, got 5 μ l freeze-drying, the release of electrophoretic examinations recombinant neurotoxins every 20 hours or 1 hour.

In 5 0.5ml centrifuge tubes, respectively get the fusion rotein 43.5 μ l of purifying, add hydrochloric acid 5,2.5,1.25, the 0.5 μ l of 1.0N respectively, stay one for not adding the acid contrast.Other gets 2 centrifuge tubes, and each adds hydrochloric acid 5, the 2.5 μ l that natural neurotoxin 20 μ l (1mg/ml) add 1.0N respectively.It is 50 μ l that this 7 arm adds water to cumulative volume, mixing, and respectively being one group with this 7 arm, at 65 ℃, 85 ℃ are incubated 3 hours, every one hour sampling 5 μ l, the release of electrophoretic examinations recombinant neurotoxins.Western biot checks the antigenicity of reorganization Cobratoxin.

3 experimental results

3.1 EKMax ^TMEnzymolysis to fusion rotein

3.1.1 EKMax in solution ^TMNon-degrade specifically fusion rotein

Link to each other based on the recognition sequence Asp-Asp-Asp-Asp-Lys (DDDDK) by an Enteropeptidase between fusion rotein recombinant neurotoxins and the Trx, and Enteropeptidase is the narrow spectrum serine protease of a kind of height, and it discharges (Light﹠amp by the C end of cutting Lys with target protein from fusion rotein; Janska, 1989, EKMax ^TMInstruction Manual).

But for the neurotoxin fusion rotein,, 16 ℃, act on 72 hours EKMax at 4 ℃ ^TMAll detect less than the recombinant neurotoxins albumen (datd not shown) that discharges.At 25 ℃ of enzymolysis after 24 hours, detect the recombinant neurotoxins maximum and discharge about 10% (Figure 22 A), and after acting on 36 hours, recombinant neurotoxins disengages about 25%, but occur two low-molecular-weight protein bands simultaneously and account for 10% (Figure 22 B, non specific).Enteropeptidase cracking neurotoxin fusion rotein efficient is low, and along with the prolongation of enzymolysis time, side reaction is serious.

In experiment, find Ca ²⁺With PO ₄ ^3-The precipitation that ion forms can be adsorbed recombinant neurotoxins, improves scission reaction, therefore, has further explored the Ca of different concns ²⁺With PO ₄ ^3-The influence of ion pair endonuclease reaction is referred to as " solid phase enzymolysis ".

3.1.2 the solid phase enzymolysis improves the yield of recombinant neurotoxins, but causes the forfeiture of toxin antigenicity

The K of different concns ratio ₃PO ₄With CaCl ₂In the endonuclease reaction damping fluid, can form the white flocks of different amounts, CaCl in reaction system ₂When concentration is 10mM, improve K gradually ₃PO ₄Concentration, the fusion rotein of precipitated absorption, recombinant neurotoxins and carrier proteins also increase gradually.Adsorption mechanism is deeply inquired into, but may be similar to the proteic principle of " hydroxyapatite " adsorption and purification.Centrifugation precipitation and supernatant (Figure 23).Work as K ₃PO ₄When concentration was 5Mm, precipitation had almost been adsorbed all fusion roteins and has been given birth to group neurotoxin (lane 8).

Add K in this ratio ₃PO ₄With CaCl ₂Reaction volume is brought up to 0.5ml, after enzymolysis is finished, use the 10mM dissolving with hydrochloric acid, but the recombinant neurotoxins of the Trx of wash-out 98% and 45% (Figure 24 A, lane3), precipitation continues to use the 100mM dissolving with hydrochloric acid, and wash-out goes out 55% recombinant neurotoxins, in the elutriant, toxin account for more than 95% of total protein (Figure 24 A, lane4).The neurotoxin molecular weight of albumen basically identical of the natural and reorganization of SDS-PAGE presentation of results, but western blot result shows, the immune response of the master tape of the recombinant neurotoxins of purifying and rabbit anteserum antibody almost completely disappear (Figure 24, B).

Analyze its reason and have 2: 1) in the fusion rotein solution of purifying, have the trace proteolytic enzyme, and these proteolytic enzyme water destructs the antigenic determinant of neurotoxin.2) EKMax is to the proteic non-degrade specifically of neurotoxin.Do not contain the recognition site (DDDDK) of enteropeptidase in the neurotoxin sequence, but might contain the charge characteristic sequence similar to recognition site, and by enteropeptidase degraded (Light ﹠amp; Janska, 1989).Experiment shows and containing neurotoxin 20 μ g, and reaction volume is in the 30 μ l systems, adds the EKMax of different amounts, 37 ℃ of incubations 16.5 hours.When the enteropeptidase consumption is 0.5 μ, natural neurotoxin be degraded (Figure 25, Lane 4); When intestines swashed 4.0 μ, about 45% neurotoxin was degraded to two less bands of molecular weight (Figure 25, Lane 2).

3.1.3 brief summary

Enteropeptidase is the strong proteolytic enzyme of a crack fusion protein species specificity commonly used, but is not suitable for producing the neurotoxin fusion rotein in this experiment.1) poor to this fusion rotein specificity, the recombinant protein yield is low, and the recombinant neurotoxins that perhaps cuts out changes.2) EKMax costs an arm and a leg, and is not suitable for the mass production recombinant protein.

Therefore, design changes the position of fusion of recombinant protein, 5 ' of neurotoxin gene is introduced in acid-sensitive some site (DP) held, and wishes by acid hydrolysis method recombinant neurotoxins to be separated from fusion rotein.

3.2 DP inserts the structure of expression vector

Dna segment such as Figure 26 of amplification are about 200bp.Amplification segment and plasmid pTN314 are by KpnI and Pst I double digestion, result such as Figure 27.Can see that the amplification segment after enzyme is cut is more smaller before cutting than enzyme, but, conform to actual greater than the small pieces that pTN314 cuts out.Select single bacterium colony after the conversion, order-checking is carried out according to a conventional method.Recombinant plasmid such as Figure 28, called after pTNP314.

3.3 the acidolysis of fusion rotein discharges

The IPTG of the carrier pTNP314 that makes up leads expression thoroughly, and the osmotic shock inspection is basic identical with pTNP314, confirms that the DP sequence of inserting does not influence Expression of Fusion Protein.

13% and 26% acetate, 35% and 70% formic acid is 37 ℃ of acidolysis fusion roteins 48 hours, only part cracking of fusion rotein, and do not observe recombinant neurotoxins (Figure 29 A and B).And 85 ℃ of acidolysis after 1 hour, fusion rotein degraded serious (Figure 29 C).

The dilute hydrochloric acid of different concns acts on 2 hours at 85 ℃, and fusion rotein is by efficient cracking (Figure 30 A), and Western blot presentation of results recombinant neurotoxins and natural neurotoxin rabbit anti-serum have strong reactivity (Figure 30, B and C).

When the final concentration that adds dilute hydrochloric acid is respectively 5,10,25,50, during 100mM, fusion rotein reduces gradually, and recombinant protein accounts for total protein in lysate ratio also increases gradually, always but the recombinant neurotoxins yield do not reduce and increase with fusion rotein, when sour final concentration is 25mM, the recombinant protein yield is up to 63%, accounts for that total protein content is 28% (Figure 31) in the acid hydrolysis solution, and this moment, cracked solution pH was about 2.2.

4, discuss

4.1, the acidolysis fracture mechanism and the influence factor of Aspartyl-Prolyl peptide bond

Aspartic acid-proline(Pro) peptide bond is in the acyclic acidic mirror, and is very unstable, and cracking, reaction mechanism following (Walker, J.M., 1996) take place the C end of aspartic acid.

Some reaction conditionss can promote the Asp-Pro peptide bond cracking (landon, M.1977); 1) protein dissolution adds 10%7 acid in the 7.0M Guanidinium hydrochloride, and pH to 2.5 is transferred in the arsenic pyridine.2) in 37 ℃ of long-time incubations (to 24 hours).3) freeze-drying termination reaction.

4.2 the side reaction of acidolysis and to the influence of recombinant neurotoxins

Under low pH and the hot conditions, the contingent main side reaction of albumen is aspargine and glutaminase deamination, but the reaction times was controlled within 2 hours, side reaction can be reduced to minimum level (walker, J.M.1996, Wright, H.T., 1991).Deamination will cause the protein band negative electricity to increase, and free zone band capillary electrophoresis can detect the variation of albumen specific charge, therefore can by capillary electrophoresis detect the homogeneity of recombinant neurotoxins electric charge.The capillary electrophoresis of recombinant neurotoxins is the wall scroll band, with natural neurotoxin transition time 0.10min difference (Figure 33, natural neurotoxin is seen Fig. 6) is only arranged.So the deamination reaction that recombinant neurotoxins takes place in acid hydrolysis solution is negligible.

Other more contingent less important reactions comprise (Walker, J.M.1996); 1) Asp-X, when the fracture of X-Asp peptide bond was his amino acid of base except that Pro as X, reaction yield was very low.2) rupture at the Glu residue; 3) the tryptophan residue part is destroyed; 4) N holds the cyclisation of Glu residue etc.But these reactions can be avoided by shortening the reaction times.

4.3 the application potential of acid hydrolysis method on recombinant protein is produced

At present, use this strategy, by import the Asp-Pro site in fusion rotein, the acidolysis fusion rotein is with the other thyroxine fragment of the people (hPTH of reorganization ₃₈) and a kind of antibacterial peptide discharge and be able to mass production (Gavit.﹠amp; Better.2000, Gram, H.., et al., 1994).But this two peptide species is all less than 40 amino acid, and do not contain halfcystine, promptly do not contain disulfide linkage.

Reorganization short chain Cobratoxin of the present invention contains 62 amino acid, forms the protein molecular with imporosity by 4 pairs of disulfide linkage, thereby is different from above-mentioned two kinds of little peptides fully.

The production that acid hydrolysis method of the present invention is used for recombinant protein has following advantage: 1) hydrochloric acid is nontoxic, does not have dangerous.Compare with other chemical cracking methods, hydrochloric acid just can be removed easily by regulator solution pH after cracking is finished.And other chemical cracking agent must carefully be used.Cyanogen bromide (Br-CN) is a highly toxic substance, and azanol is explosive material.2) the hydrochloric acid cost is low, and scission reaction is easy to amplify.And with specific proteases cracking cost height, be difficult for amplifying, be used to produce and must strictly control experiment condition, and the enzyme of different batches is variant to the cracking meeting of fusion rotein.3) salt acidolysis efficient height, under experiment condition of the present invention, finally to the cleavage rate of fusion rotein greater than 90%, and the yield of recombinant neurotoxins is also greater than 60%.Believe the further optimization of this acidolysis condition, yield can also increase substantially.

Three, recombinant neurotoxins of the present invention is produced purifying process

The experimental technique that is used for separation and purification of protein comprises that ion-exchange, gel permeation chromatography, reverse chromatograms, metal Ao close chromatography etc.

The most frequently used isolation technique is ion-exchange and gel permeation chromatography in the separating technology of recombinant protein.The batch processed amount of ion-exchange techniques is big, and different ion-exchangers is applicable to each stage of recombinant protein separation and purification.Gel-filtration is based on the difference of molecular weight of albumen and the method for separating target protein and foreign protein, is applicable to the later stage of separation and purification.

Aforementioned neurotoxin albumen is after osmotic shock is released in the low salts solution, and fusion rotein content is about 65% of solution total protein content, and the albumen subsequent purification at first is suitable for ion exchange technique.

With regard to ion-exchange, Q and SP Sepharose, QAE and Sephadex serial application are captured target protein in the initial stage from dilute solution, be applicable to industrial-scale production.Source series Ion Exchange Medium is applicable to the polishing purification of sample, and is withstand voltage good, the flow velocity height.

Because the separation and purification of recombination fusion protein of the present invention need be taken all factors into consideration the batch processing of industrial scale and sample, velocity of separation, the bonding force of medium, the factor of aspect such as the resolving power and the rate of recovery, in laboratory scale, require the existing high resolving power of ion-exchanger simultaneously, high carrying capacity is arranged again, therefore, the present invention adopts Source series to carry out ion-exchange.

On the other hand, because after the fusion rotein acidolysis of the present invention, mainly there are recombinant neurotoxins albumen and carrier proteins in the solution, the difference of the two molecular weight is about 6,000 Dalton, so the present invention adopts the higher gel-Superdex of resolving power 75 Prep that fusion rotein is carried out the subsequent purification separation.1, experiment material

1.1 reagent, substratum and solution

Protein purification medium Source 15Q, Superdex 75 prep, Superdex G-15 and chromatographic column K26/20, XK16/70, HR10/10 are all available from Amersham Pharmacia company.Extra-pure grade Tris is available from Sigma company.NaCl and other chemical reagent are analytical pure.Developing medium Tryptone, Yeast Extract are Oxoid company product.

The LB liquid nutrient medium: every liter contains 10g Tryptone, 5g yeast Extract, and 5g NaCl, the pH value is adjusted to 7.0 with NaOH, autoclaving.Adding penbritin to final concentration before the inoculation is 100 μ g/ml.

Penbritin solution: get 50mg, be dissolved in the 1ml pure water, 0.2 μ m membrane filtration degerming ,-20 ℃ of preservations.

IPTG solution (100mM): get 238.3mg IPTG and be dissolved in the 10ml pure water, 0.2 μ m membrane filtration degerming ,-20 ℃ of preservations.

Osmotic shock 1# solution: 20mM Tris, pH 7.0,5mM EDTA, 20% sucrose, filtration sterilization, 4 ℃ of preservations.

Osmotic shock 2# solution: 20mM Tris, pH 7.0,5mM EDTA, autoclaving, 4 ℃ of preservations.

1.2 instrument

Mesolow chromatographic system  KTA Purifier 100 gives for Amersham Pharmacia company, and high-capacity and high-speed refrigerated centrifuge 20PR-52D type is available from being Hitachi company.2 experimental techniques

2.1 the cultivation of engineering bacteria, the osmotic shock of microorganism collection and fusion rotein discharges

The single bacterium colony in inoculation activatory engineering bacteria TOP 10 (pTNP 314) spends the night with the 220rpm shaking culture at 37 ℃ in 15ml LB liquid nutrient medium.The 3ml culture transfer next day to 150ml LB substratum, at 30 ℃ with 220rpm shaking culture 6 hours.Be forwarded in the 2.7L substratum with 1: 40 then, 37 ℃ of 220rpm shaking culture to the logarithm later stage, cell density OD ₆₀₀About 0.5.Add TPTG to final concentration 1mM, continue to cultivate 4 hours.

Measure bacterium liquid OD ₆₀₀, with 8,000xg centrifugal 30 minutes, collects thalline in being chilled to 4 ℃ high speed freezing centrifuge in advance.The supernatant that inclines directly adds an amount of ice-cold osmotic shock 1# solution in centrifuge tube, make the OD of bacteria suspension ₆₀₀Be 5.0.After fully suspending, ice-water bath was placed 10 minutes.At 4 ℃ of high speed freezing centrifuges with 10,000xg, centrifugal 30 minutes, outwell supernatant, thalline is suspended in the osmotic shock 2# solution identical with the 1# liquor capacity, fully behind the mixing, ice-water bath was placed 10 minutes.High speed centrifugation is 30 minutes once more.Take out supernatant and put in the centrifugal bottle of cleaning ,-25 ℃ frozen, the electrophoretic examinations fusion rotein that takes a morsel discharges.

2.2 the purifying of fusion rotein

2.2.1 ion-exchange chromatography condition optimizing

Chromatographic column: HR 10/10

Filler: Source 15Q, 8ml

Last sample volume: the fusion rotein solution 10ml that osmotic shock discharges

Basic moving phase: A 20mM Tris, pH 8.0

B?20mM?Tris，pH?8.0，1.0?M?NaCl

Elution requirement: chromatographic column balance 100%A 2CV

Last sample 10ml

Penetrate component wash-out 100%A 2CV

Gradient elution 0-20%B 20CV

20-60％B??5CV

60-100％B?0CV

100％B????2CV

100-0％B??0CV

100％A????4CV

Detection mode: ultraviolet (280,260,214nm), electrical conductivity detector, pressure detector

Moving phase optimization factor: a, b, c, optimization method: in sample and moving phase, 1) add 1% a; 2) add 10% b; 3) with one times of sample concentration dilution; 4) in sample and moving phase, add the c of different concns, i.e. c1, c2, c3, c4, c5.

Change moving phase and sample solution successively and form, every kind of moving phase repeats once.After each change moving phase, need balance chromatographic column once more.Calculate the each yield (mAU*m1) of isolated fusion protein and ratio that peak area accounts for total peak area of dividing.

2.2.2 the preparation of fusion rotein

Chromatographic column: XK26/20

Filler: Source 15Q, 37ml

Last sample volume: the fusion rotein solution 250ml that osmotic shock discharges.

The moving phase of optimizing: A 20mM Tris, pH 8.0+c2

B?20mM?Tris，pH?8.0，1.0?M?NaCl+c2

Flow velocity: 23ml/min

Elution requirement saves with 2.2.1

Collection mode: components such as fraction collector are collected

Last sample loading mode: sample on the sample pump

Fusion rotein solution is put 37 ℃ of water-baths, rotates quick-thawing gently, adds c to c2 concentration, in 4 ℃ of high speed freezing centrifuges with 10,000xg, centrifugal 20 minutes, get supernatant and measure its volume, sample volume settings in is with sample on the flow velocity one-tenth of 11.5ml/min.Penetrate each component that component and wash-out go out, electrophoretic examinations with 10ml/ pipe fraction collection.The fusion rotein of wash-out is frozen at-25 ℃.

2.3 the preparation of recombinant neurotoxins

2.3.1 the acidolysis of recombinant protein discharges

Get the fusion rotein solution 10ml of purifying, hydrochloric acid to the final concentration that adds 1N is 25mM, and the jog mixing is put 85 ℃ of water bath heat preservation reactions 2 hours.Taking-up naturally cools to room temperature, the release conditions of electrophoretic examinations recombinant neurotoxins.Tris alkali to the Tris final concentration that adds 1.0M is 50mM, and behind the mixing ,-25 ℃ frozen.

2.3.2 imitating, the filling of the proteic gel-purified of recombinant neurotoxins (1) gel column and post measure

Material: column filler RK16, chromatographic column XK16/70, gel media Superdex 75 prep, HiTrap DesaltingSuperdex G-25 are Amersham Pharmacia company product.

Solution: deionized water, 20% aqueous ethanolic solution, Tween-20, acetone

Column filler is installed in XK cylinder top, and pure water cleans, and filter membrane is contained in the column bottom, adds 20% ethanolic soln, washes post.Chromatographic column vertically is contained on  KTA Purifier 100 pylons, adds pure water, after the cleaning chromatographic column, the column bottom adds the high pure water of about 2cm, plug sealing post lower part outlet.Get the Superdex 75 prep gels of 138ml natural sedimentation, add pure water and be suspended into cumulative volume 475ml, add 0.25ml Tween-20, disposable at the uniform velocity pouring in chromatographic column and the column filler, add water and add full column filler, the column filler inlet is connected  KTA, open the chromatographic column outlet, with the pure water is moving phase, if flow velocity is 1.0ml/min, turn on pump is after 3 hours, the gel column bed volume is stable, closes pump.Carefully unload the accent column filler, packing inlet adapter becomes 1 hour with the flow velocity of 6ml/min.Regulate adapter to gel column bed surface and press down 5mm, screw.

The chromatographic column of filling in is connected  KAT Purifier 100, is moving phase with the pure water, and it is 280nm that detector is provided with wavelength.Flow velocity is 2.0ml/min, is sample with acetone, sample introduction 0.2ml.The record color atlas, the theoretical plate number at calculating acetone peak.(2) reorganization Cobratoxin albumen and carrier proteins separates

Chromatographic column: XK16/60 filling Superdex 75 prep media

Moving phase: 50mM Tris, pH8.0,0.15 M NaCl

With the flow velocity of 1.0ml/min,, get Tris neutral fusion rotein solution 5ml after the acidolysis, last sample with the moving phase balance chromatographic column of two column volumes.Component is collected at the peak, and-25 ℃ frozen.(3) recombinant protein concentrates and desalination

Moving phase: 5mM NEPES, pH7.0,25mM NaCl

Recombinant protein content is measured in the recombinant neurotoxins freeze-drying of gel separation, and recombinant protein is dissolved in the pure water with 1mg/ml, goes up sample 1.0ml at every turn, and ultraviolet and electricity are led detection, the desalination of HiTrap Desalting Superdex G-25 post.Collect protein ingredient, the BCA method is measured protein content, and-25 ℃ frozen.3, experimental result and the fermentation culture and the osmotic shock of 3.1 engineering bacterias are discussed

Under laboratory condition, the engineering bacteria shake-flask culture reached stable cell density, OD after 4 hours ₆₀₀Be about 2.0-2.2.20PR-52D type whizzer can be handled 2.0L bacterium liquid at every turn, and the bacterial sediment of fresh culture carries out osmotic shock in the centrifugal bottle of 500ml, behind the adding 1# solution, sedimentary thalline fully must be suspended evenly, can not have cotton-shaped or the sheet thalline.2.7L bacterium liquid is suspended in the 1.08L solution approximately, places more than 10 minutes at ice-water bath, fully osmotic equilibrium.Owing to contain 1# solution 20% sucrose, need be with higher whizzer when centrifugal.After outwelling 1# solution, make the centrifugal bottle mouth down, place several minutes, remove the drop of the mouth of pipe then with thieving paper.

2.7L the osmotic shock solution that nutrient solution finally may about 1.0L is with 4 centrifugal bottle packing, after-70 ℃ of quick-frozens ,-25 ℃ of preservations.3.2 optimization (1) Ion Exchange Medium and the choice of experimental conditions of the separation and purification 3.2.1 ion-exchange chromatography condition of fusion rotein

Ion-exchange is one of useful method of purifying gene engineering recombinant protein, and the exchang medium binding capacity is big, can a large amount of samples of primary treatment.Fusion rotein is discharged in the osmotic shock 2# solution, and ionic strength is low, is fit to ion exchange method be for further processing (Sun Zhixian etc., 1995).This pH value of solution value is 8.0, and fusion rotein amino acid complete sequence is drawn with its biochemical property of ProtParam tool software analysis: iso-electric point pI is 5.50, and therefore in this solution, the strong negative electricity of fusion rotein band is selected anionite Source 15Q.This Ion Exchange Medium has following characteristics: 1) medium is withstand voltage rigidity bead, has uniform 15 μ m diameters, and the resolving power height can be at purifying protein under the high flow rate; 2) use the pH wide ranges, binding capacity is big; 3) chemical stability is good, in the scope of pH 2.0-12 (Handbook of Ion Chromatography, 1991) steady in a long-term.

After choosing Ion Exchange Medium, select the separation condition of experiment successively: initial moving phase pH value and ionic strength, wash-out salt kind, flow velocity, type of elution.1) pH of initial moving phase is preferably identical with the pH value of fusion rotein solution, and therefore selecting mobile pH value is 8.0.2) wash-out salt adopts the NaCl solution of 1.0M.3) Source 15Q is withstand voltage good, and it is 30-600cm/h that linear rate of flow is recommended by manufacturer, and the selection flow velocity is 23ml/min.4) select linear gradient separations, separate for the first time and adopt the wide region gradient, in 20 column volumes, NaCl concentration is increased to 100% by 0.The discovery fusion rotein by wash-out, therefore is being provided with gradient in 20 column volumes when NaCl is 0.13M (13%NaCl), NaCl concentration is increased to 20% by 0.(2) optimization of moving phase component

Fusion rotein combines with separating medium and dissociates and influenced by many-sided factor, and the composition of moving phase and the ionic strength important factor that is one of them.Therefore primary study changes the composition of moving phase, reduces the non-specific adsorption of fusion rotein and exchang medium as far as possible, keeps fusion rotein to have homogeneous and stable conformation.

Under the identical applied sample amount situation identical, only change the composition of moving phase, by the amount and the shared per-cent (Figure 34) of the separating obtained fusion rotein of chromatogram calculation with other chromatographic conditions.Add C when concentration is C2 in moving phase, the yield of fusion rotein is the highest, and therefore selecting C2 is that fusion rotein is formed as the moving phase of separation and purification.3.2.2 ion exchange method purified fusion protein

Freezing fusion rotein solution quick-thawing prevents that albumen is degraded, and high speed centrifugation is removed issuable precipitation in the course of defrosting.Reduce during last sample that flow velocity prevents because the post voltage rise height that the increase of sample solution viscosity causes.Sepn process is as figure (Figure 35 A).Penetrate and each main peak electrophorogram (Figure 35 B), fusion rotein purity is greater than 95% (lane 6), the fusion rotein main peak of fraction collection.3.3 the acidolysis of the preparation 3.3.1 of recombinant neurotoxins reorganization Cobratoxin discharges

After acidolysis reaction is finished, through preliminary experiment, add Tris alkali to 50mM, acid hydrolysis solution pH is adjusted to about 7.0.Its effect has two aspects: 1) rising pH, in and hydrochloric acid, termination reaction; 2) regulate acid hydrolysis solution Tris to 50mM, form close with next step gel-purified moving phase.

Acid hydrolysis solution after the acidolysis fully, carries out the gel column purifying through electrophoretic examinations.3.3.2 the post glue of gel column detects

Zhuan Tian gel chromatographic columns must detect its post effect voluntarily, and every meter theoretical plate number (N/m) should be greater than 10,000.Post is imitated and is measured color atlas (Figure 36), and it is 14,500 that post is imitated every meter theoretical plate number (N/m).Illustrate that chromatographic column reaches requirement of experiment.3.3.3 the gel chromatography separation of recombinant neurotoxins

Different with the unusual electrophoresis behavior at SDS-PAGE, on gel column, neurotoxin lags behind Trx (MW:13,068 Dalton), molecular weight surface normal (Figure 37).The recombinant protein main peak is collected, and vacuum freezing concentrates, and protein peak is collected in desalination (Figure 38), measures recombinant protein concentration and is about 0.5mg/ml.4. brief summary

Comprehensive entire production process, per step purified product electrophoresis purity analyze (Figure 39, A) and corresponding immunoblotting result (Figure 39, B).

The final yield of recombinant neurotoxins is 35.3% (is 1 with osmotic shock acquisition amount) (table 3).Every liter of zymocyte liquid finally can get purity greater than the about 12mg of 95% recombinant neurotoxins.Under the 500ml shake-flask culture condition of laboratory, the highest stand density of thalline is to OD ₆₀₀Be 2.0-2.2.If use fermentor cultivation, thalli growth density can improve greatly, therefore changes culture condition, and recombinant protein output can be greatly improved.

Ion Exchange Medium Source 15Q is that a kind of resolution is very high, be applicable to the industrial filler of laboratory polishing purification and recombinant protein simultaneously, but price is higher, in amplification technique from now on, can consider to change other is more suitable for and industrial medium, suitably sacrificing under the prerequisite of resolution, significantly reduce cost, improve the batch processed amount.The control of acidolysis condition is a step very crucial in the production process, always the yield of recombinant protein does not increase (Figure 31) with the raising of the acidolysis rate of fusion rotein.Next step amplification has use the acidproof small canister of heating jacket and agitator.Gel-purified is a very effective step in process of production, if post footpath and column length are improved greatly, can improve every batch processing amount and resolution.

The component volume that gel is collected will increase and be twice abovely, therefore must concentrate and desalination.For recombinant neurotoxins, once used the dialysis of 1000Dalton molecular weight and ultra-filtration equipment that recombinant protein is concentrated and desalination, but the albumen yield is very low, perhaps compact structure causes owing to recombinate the Cobratoxin densification for this.So adopt the freeze-drying concentrating sample, the gel column desalination.

The production technique of recombinant protein is a systems engineering, the selection of separating medium, and the linking of separating step and optimization are not isolated one by one processes, be according to industrial scale, running cost is taken all factors into consideration, and is optimized configuration.Table 3: the comprehensive yield of recombinant neurotoxins

Purification step	Yield	Purity
			Osmotic shock	????100％	????65％
Ion-exchange	????82％	????90％
			Acidolysis	????63％	????28％
Gel-filtration	????76％
			The pure product of desalination	????91％	????＞95％
Final yield	????35.3％

Four, the physico-chemical property of recombinant neurotoxins and toxicity test

The reorganization ophiotoxin is carried out analysis of physical and chemical property, and from molecular weight, the N terminal amino acid sequence to the aspects such as medium lethal dose of mouse mainline, compares with natural toxin.1, experiment material

Kunming mouse is provided by Chinese medicine institute of biological products Experimental Animal Center.2, the physico-chemical property of experimental technique 2.1 reorganization Cobratoxins

The SDS-PAGE electrophoresis, reverse phase liquid chromatography, capillary zone electrophoresis, N terminal amino acid sequence mensuration, methods such as mass spectrum are measured identical with natural neurotoxin.2.2 the toxicity test (Meier﹠amp of reorganization Cobratoxin; Theakston, 1986)

Get 10 of 18-20g Kunming kind small white mouses, the recombinant neurotoxins solution by tail vein injection 0.5ml different concns respectively, make the injection of mouse after the survival time between 1 minute to 30 minutes.The survival time of record mouse.Dosage/survival time (D/T) with every kg body weight is an X-coordinate, is the ordinate zou mapping with the injected dose of every kg body weight of mouse, linear regression, and the intersection point of curve and ordinate zou is for killing the dosage of 50% laboratory animal, i.e. LD in unlimited time ₅₀

Natural neurotoxin is measured by same procedure.3, experimental result 3.1 recombinant neurotoxins molecular weight determination and purity

The recombinant neurotoxins apparent molecular weight of SDS-PAGE cataphoretic determination is 16, and 500dalton (Figure 39 A, Lane3), basic identical with natural neurotoxin.It is 7046dalton (Figure 40) that electrospray ionization mass spectrum is measured its molecular weight.Oppositely high-performance liquid chromatogram determination purity is greater than 98% (Figure 41), and diode full wavelength scanner (190-800nm) characteristic absorbance is at 205nm and 276nm (Figure 42), and free zone band capillary electrophoresis purity is greater than 95% (Figure 43).3.2 the N terminal sequence of recombinant neurotoxins

Measuring recombinant neurotoxins N terminal sequence by the Edman solid phase sequencing is:

Pro-Leu-Glu-Cys-His-Asn-Gln-Gln-Ser-Gln-Thr-Pro-Thr-Thr is with to carry neurotoxin gene 5` end encoding amino acid sequence on carrier pTNP314 consistent.3.3 the toxicity of recombinant neurotoxins

Corresponding relation such as Figure 44 of the dosage/survival time (D/T) of the every kg body weight of mouse and the injected dose of every kg body weight, reorganization and natural neural poison are to the LD of mouse ₅₀Value is respectively 0.556mg/kg and 0.369mg/kg.4. discussion list 4: reorganization and natural neurotoxin physico-chemical property and toxicity are relatively

Toxin source	Apparent MW SDS-PAGE (n=3)	The MW mass spectrum	RP-HPLC retention time (n=3)	CZE transition time (n=3)	?????LD 50Mouse tail vein (n=2)	N terminal amino acid (5)	With exempt from antiserum(antisera) reaction
								Recombinant neurotoxins	??16,500	?7046	?24.3min	??14.090	???0.556mg/kg	??PLECH	Positive
Natural neurotoxin	??16,500	?6946	?25.0min	??14.183	???0.369mg/kg	??LECHN	Positive

The molecular weight of natural neurotoxin electrospray ionization mass spectrum practical measurement is 6946Daltons, and the molecular weight that the reorganization Cobratoxin is measured differs 100Daltons for the 7046Daltons molecular weight; And the sequencing result shows that the reorganization Cobratoxin Duos a Pro than natural toxin N end, and the residue molecular weight is 97.1Daltons, differs about 3 total mass numbers, and experimental error is within systematic error.

Recombinant neurotoxins of the present invention is a bit larger tham natural neurotoxin in the retention time of C8 reversed-phase column, and this and recombinant neurotoxins are at the many Pro of N end, and hydrophobicity increases relevant.

The mouse tail vein injection medium lethal dose of recombinant neurotoxins of the present invention is slightly less than natural toxin, and the toxicity that the reorganization Cobratoxin is described is near natural toxin.

Five, the mensuration----of recombinant neurotoxins of the present invention and flesh type nicotinamide cholinocepter binding ability is to the restraining effect of the Skeletal Muscle Cell nicotine induced current of cultivation

Cobra short-chain neurotoxin and flesh type nicotinamide acetylcholine receptor have very high special avidity, and it is a reversible process with combining of acceptor.Short-chain neurotoxin is the activator vagusstoff of this receptoroid, the competitive antagonist of nicotine etc.On the single bone cells of cultivating, adopt the full cell of patch clamp to clamp down on voltage at-70mV, add a certain amount of activator such as nicotine, can record the open inward electric current that produces of receptor channel.When activator exists, behind the adding recombinant neurotoxins, can record the minimizing that combines the inward electric current that causes owing to the part receptor channel with neurotoxin.The concentration of the reduction of this electric current and add-on group neurotoxin is proportionate.

1 experiment material

1.1 reagent and instrument

Nicotine (oxalate) DMEM substratum, cytosine arabinoside and colchicine are Sigma company product, horse serum, bovine serum and Regular Insulin-Transferrins,iron complexes-Sodium Selenite mixture (ITS) is a Gibcol company product.It is Sutter company product that PC-84 type electrode draws instrument; The AxonPatch-ID amplifier, the TL-1AD change-over panel, Clampex 7.0 editions, 6.0 editions samplings of Clampfit and analysis software are Axon Instrument company product; PPS-2 air pressure administration 5 systems are Medical System company product.Cell culture incubator is a Baxer company product.Phase microscope Olympus company product.

1.2 solution

Cell seeding liquid: contain 80% DMEM, 10% horse serum, 10% foetal calf serum;

Cell feeding liquid: contain 90% DMEM, 10% horse serum and 1% ITS;

Extracellular fluid: contain 0.82% Nacl, 0.04% KCl, 0.02% MgCl ₂, 0.24% HEPES, 0.20% glucose adds 0.03%CaCl at last ₂, it is 7.3 that NaOH regulates pH.

Intracellular fluid: contain 2.36% CaCl ₂, 0.24%4 HEPES, 0.38% EGTA, 0.11% ATP, regulating pH is 7.3.

2. experimental technique

2.1 the cultivation of Skeletal Muscle Cell

Get new life's on the same day Wistar rat, put to death behind 75% ethanol disinfection, under aseptic condition, get its hind leg bone flesh, in the phosphate buffered saline buffer of 0 ℃ pH 7.3, shred, in the damping fluid that contains 0.25% pancreatin, digested 60 minutes in 37 ℃ of logical oxygen, centrifugal, discard Digestive system, add plantation liquid, piping and druming, 200 mesh sieves filter, and filtrate is at 37 ℃, 10%CO ₂Incubator in cultivate, change feeding liquid after 24 hours, change liquid in good time and add cytosine arabinoside and colchicine, be used for experiment after having the flesh ball to form in 5-8 days.

2.2 the drawing of glass microelectrode

The soft glass blank of cut-off footpath 1.4mm at drawn glass microelectrode more than 800 ℃, is surveyed its tip diameter and be should be 1 μ m after polishing.

2.3 full cell record

The patch clamp recording unit is by phase microscope, recording electrode, and narishige, prime amplifier, oscilloscope, AD change-over panel and workstation control analysis system form.The Skeletal Muscle Cell of cultivating is dipped in the 2ml extracellular fluid.Under inverted phase contrast microscope, press to flesh ball surface by the glass microelectrode that little manipulation instrument will be full of intracellular fluid, and show the sealing-in test pulse by oscilloscope, observe electrode resistance and change.When the current value of pulse representative descended suddenly, surface electrode is exposing cell, at this moment imposes negative pressure to glass microelectrode immediately, made cell and glass electrode form the sticking type sealing-in, and the electric current calculating sealing-in resistance that reads from oscilloscope is about 1-3G Ω.Continue to apply negative pressure or making alive 1.5V 10ms, electric shock is broken cytolemma, and intracellular environment is communicated with electrode, forms full cell record and applies and clamp down on voltage.

2.4 administering mode

Doser is by nitrogen, the gaseous tension system, and narishige and administration electrode are formed.The administration electrode that will be full of soup places and writes down the same plane of cell, on the distance position of 1～2 flesh ball, regulates the soup covering record cell that administration pressure makes ejection.Three administration electrode blanks are bundled, and draw moulding, be full of the solution of different pharmaceutical or medicine various dose of the same race in the electrode, be used to observe different pharmaceutical or various dose homocellular effect.With the natural toxin is contrast, and reorganization and natural toxin are observed their restraining effect to the nicotine induced current with the extracellular fluid dilution that contains 80mM nicotine.

2.5 data gathering and processing

Depolarization current and nicotine inducing current are measured current amplitude through AD change-over panel and amplifier Clampex7 version workstation acquisition and recording with Clampfit 6.0 editions.Average through standardized current amplitude and to represent with X ± s, with single factor folk prescription difference analysis different pharmaceutical relatively, various dose is clamped down under the voltage toxin to the influence of nicotine electric current inhibiting rate at-70mV.

3, experimental result

3.1 the bone cells of cultivating

After cultivating in 5～8 days, Skeletal Muscle Cell has the flesh ball to form (Figure 47), and the myocyte grows normally.

3.2 skeletal muscle brings out the nicotine electric current of cell

With the cell clamp that forms full cell record built in-70mV, record inducing current (Figure 48) when giving a series of stimulation, visible significantly sodium, the potassium ion electric current illustrate that the Skeletal Muscle Cell function of cultivation is normal.Sprayed 40,80,120 μ M nicotine in order 1 second to same cell, 3 minutes at interval, visible nicotine inducing current constantly increased (table 5), illustrates that the nicotine inducing current has dose-effect relationship.

The concentration dependent (n=9) of table 5 nicotine inducing current

Nicotinic density (μ M) current amplitude (nA) F check

40????????????????0.90±0.22??????--

80????????????????1.75±0.42*????P＜0.05

160???????????????2.23±0.65*????P＜0.05

Get 80 μ M nicotine as bringing out concentration, sprayed nicotine 1 second, can bring out the inward electric current of 1～4nA to cell.With dosing interval 2～3 minutes, same cell gave 80 μ M nicotine 1 second repeatedly for several times, visible inducing current basically identical, the reactive self-consistentency (Figure 49) of superficial cell.

3.3 reorganization and natural neurotoxin neurotoxin are to the restraining effect of nicotine inducing current

Sprayed 80 μ M nicotine 1 second to cell, the 3 fens same cells of clockwise in every interval spray successively and contain 2.3,11.5,80 μ M nicotine of 23 μ M reorganization or natural neurotoxin 1 second, visible nicotine inducing current progressively reduces (Figure 50, Figure 51, Figure 46), show that reorganization and natural toxin suppress the nicotine inducing current concentration dependent is arranged, retarding effect curve (Figure 15) must be recombinated and the IC of natural neurotoxin to Skeletal Muscle Cell nicotine inducing current therefrom ₅₀Be respectively 26.2 * 10 ^-6Mol/L and 7.5 * 10 ^-6Mol/L.

Table 6 reorganization Cobratoxin or natural toxin suppress the concentration dependent (n=6) of 80 μ M nicotine electric currents

Reorganization Cobratoxin natural toxin

Concentration/μ M electric current/nA inhibiting rate/% concentration/μ M electric current/nA inhibiting rate/%

0??????1.70±0.39????--?????????0????????1.52±0.33?????--

2.3????1.55±0.41???9±4????????2.3??????1.04±0.42????32±9

11.5???1.19±0.25???30±9???????11.5?????0.46±0.30*???70±16*

23?????0.97±0.32???43±11*?????23???????0.29±0.15*???81±23*

The F check, * P＜0.05, vs small dose group

4 discuss

4.1 the measuring principle of patch clamp technique

The full cell record method of patch clamp (patch-clamp) is after forming the high resistance sealing-in between glass microelectrode and the cytolemma, cause rupture of diaphragm in the eletrode tip with negative pressure or the method that adds electricimpulse, the interior liquid of electrode is communicated with intracellular fluid, can write down the electrical activity that an intact cell produces like this.Under the condition of voltage clamp, can write down all ionic summations by cytolemma.If on purpose current potential is clamped down on, can accomplish optionally to suppress the activity of some passage, and only write down the summation (Zhang Juntian, 1996) of certain overall channel electric current in a certain degree.

Press the effect of medicine to cholinergic receptor, acceptor is divided into nAChR (n receptor) and muscarinic acceptor (m receptor), and in electric organ and muscle tissue, n receptor is the transmembrane glycoprotein of an about 290kD, the pentamer α that is made up of 4 kinds of different subunits ₂β γ δ is the Rose flap.In the middle of ionic channel is enclosed in by these 5 subunits, the M2 fragment of each subunit has constituted the outer side wall of ionic channel and has controlled the start or stop of ionic channel, the neurotransmitter binding site mainly is made up of the amino acid in the hydrophilic area that is present on the α subunit, when agonist combines with these sites, 5 subunits of n receptor are distorted or the shape allosteric of blooming, thereby cause the opening of ionic channel.

The short chain Cobratoxin restrains phatidylcholine acceptor (n receptor) to flesh type Buddhist nun very high avidity, is the competitive antagonist of nicotine, and toxin combines with nAChR, and the signal conduction of energy block nerves one muscle (Servant, D., etal.2000).With the nicotine activated cell of same concentrations, along with the increase nicotine inductive electric current of toxin concentration will progressively reduce.By full cell record mode, cell membrane potential is clamped down at-70mV (near the resting potential of cell), record the nicotine electric current that progressively reduces, show the enhancing gradually of neurotoxin pair and nAChR keying action, with the natural toxin is contrast, has detected the power of recombinant neurotoxins and receptor binding capacity.

4.2 the toxicity test method of recombinant neurotoxins

Weigh or recombinant neurotoxins more of the present invention has 3 kinds of methods usually with the toxic difference of natural toxin: 1) to measure this be tradition mensuration snake venom toxicity and the most frequently used method of other toxin to the mouse medium lethal dose, and method is simple.2) restrain the phatidylcholine acceptor with purifying or semipurified electric fish Buddhist nun and put and exempt from competition and combine and suppress experiment, this method is a kind of external biochemical measurement method indirectly.Be particularly useful for measuring the variation of the neurotoxin and the receptor binding capacity of mutation expression, thereby understand the functional site with the neurotoxin of receptors bind, with [ ³H] natural toxin of mark is tracer element, observes the competitive inhibitory effect of other toxin to the neurotoxin of it and receptors bind, draws their IC ₅₀3) neurotoxin to the restraining effect of bringing out stripped frog rectus abdominis muscle by vagusstoff and shrinking by detecting the muscle tissue tensile that exsomatizes and changing and relatively reorganization and natural toxin to the antagonism of vagusstoff.

The single electrode clamping technology also once was used to measure the blocking effect of the cobrotoxin of purifying to acetylcholine receptor, eletrode tip is drawn vagusstoff solution, the rear portion charges the toxalbumin that contains different concns, select the myocyte of cultivation, make born of the same parents' upper diaphragm pincers, voltage clamp can record the open movable of acceptor at+20mV.When the toxalbumin at electrode rear portion was diffused into eletrode tip gradually, passage promptly was blocked.The concentration of the toxalbumin that change electrode rear portion charges, with the ratio of average open hour of acetylcholine receptor before and after the toxalbumin effect concentration to toxalbumin, to the activity of toxalbumin the dose curve of reacting, and calculate half blocking-up amount with the ratio of average open hour of acetylcholine receptor before and after the toxalbumin effect to acceptor with this.

The present invention adopts the full cell record mode of two electrodes, promptly adopt a microelectrode to clamp down on cell, electrode communicates with intracellular fluid, and command potential is at-70mV, another electrode is the administration electrode, the toxin protein of different concns is dissolved in the receptor stimulant of same concentration, by pressure drug delivery system administration 1 second, make the soup of ejection evenly cover surface of cell membrane, acceptor experience ionic channel on the cytolemma is open, produces immediate current, the process of closing, the electric current that produces is gathered by workstation by recording electrode, handles.The effect curve of doing to the inhibiting rate of acceptor and acceptor density calculates IC ₅₀

The present invention adopts this method to measure the avidity of recombinant neurotoxins and cholinocepter, and researchist of the present invention thinks that this method also can be used for measuring the neurotoxin of different loci sudden change and the difference of receptors bind.

Description of drawings:

Fig. 1 is the primary structure of short-chain neurotoxin of the present invention (A) and long-chain neurotoxin (B);

Fig. 2 is short-chain neurotoxin of the present invention (1NOR) and long-chain neurotoxin (1CTX) space structure figure;

Fig. 3 is the secondary structure figure of short-chain neurotoxin of the present invention (A) and long-chain neurotoxin (B);

Fig. 4 is a neurotoxin SDS-PAGE electrophorogram of the present invention; Wherein:

Lane?1：protein?molecular?weight?marker，Lane?2～3：cobra?neurotoxin，5ug，10ug

Fig. 5 is the molecular weight that electrospray ionization mass spectrum is measured neurotoxin of the present invention;

Fig. 6 is Cobratoxin capillary electrophoresis figure of the present invention;

Fig. 7 is long (190-800nm) scintigram (b) of the all-wave of described neurotoxin purity testing HPLC figure (a) and main peak;

Fig. 8 is the total DNA of snake venom gland that extracts; Wherein:

Lane?1～3：total?RNA

Lane?4：1?kbp?DNA?ladder

Lane?5：100?bp?DNA?ladder；

Fig. 9 is the RT-PCR amplification; Wherein:

Lane?1～4：PCR?products?at?different?concentrations?of?RNA?templateLane?5：100bp?ladder；

Figure 10 extracts recombinant plasmid EcoRI enzyme to cut the evaluation electrophorogram, wherein, and the insertion fragment that the arrow indicator enzyme cuts out;

Wherein:

Lane?1：1kbp?ladder

Lane?2～9：recombinant?plasmids?cleaved?by?EcoRI

Lane?10：100bp?ladder；

Figure 11 is the fusion expression plasmid pTN314 (a) that makes up, albumen integration region (b);

Figure 12 is the whole cell protein electrophoresis figure that IPTG induces the different time expressed fusion protein; Wherein:

Lane?1：Low?molecular?weight?protein?marker

Lane?2：the?whole?cell?lysate?before?induction

Lane?3～7：the?whole?cell?lysate?induction?at?1，2，3，4，5?hours；

Figure 13 is induction time and thalli growth density OD ₆₀₀, fusion protein expression reaches the graph of a relation of relative content in thalline;

Figure 14 is in E.coil bacterial strain TOP10 and BL (21), the comparison that pTN314 expressed fusion protein and osmotic shock discharge; Wherein:

Lane?1：the?first?osmotic?shock?fluid?of?E.coli?BL(21).

Lane?2：the?second?osmotic?shock?fluid?of?E.coli?BL(21).

Lane?3：cell?pellet?after?second?osmotic?shock?of?E.coli?BL(21).

Lane?4：Low?molecular?weight?protein?marker

Lane?5：the?first?osmotic?shock?fluid?of?E.coli?TOP10.

Lane?6：the?second?osmotic?shock?fluid?of?E.coli?TOP10.

Lane?7：cell?pellet?after?second?osmotic?shock?of?E.coli?TOP10；

Figure 15 is reorganization (a) and natural neurotoxin (b) the retarding effect curve to the nicotine inducing current;

Figure 16 is the secreting, expressing plasmid pBAD-NT (a) that makes up and secretes regional toxin gene on position (b);

Figure 17 is pectinose abduction delivering SDS-PAGE (a) and the immunoblotting (b) of pBAD-NT; Wherein:

Lane1～5：0.2％，0.02％，0.002％，0.0002％，0.00002％of?ArabinoseLane?6：the?control?without?induction

Lane?7：Protein?molecular?weight?marker；

Figure 18 is thalline ultrasonic degradation supernatant and precipitation, osmotic shock, SDS-PAGE (a) and immunoblotting (b); Wherein:

Lane?1：protein?marker

Lane?2：the?supernatant?by?induction

Lane?3：the?supernatant?without?induction

Lane?4：the?precipitate?by?induction

Lane?5：the?precipitate?without?induction

Lane?6：the?first?osmotic?shock?fluid?by?induction

Lane?7：the?first?osmotic?shock?fluid?without?induction

Lane?8：the?second?osmotic?shock?fluid?by?induction

Lane?9：the?second?osmotic?shock?fluid?without?induction

Figure 19 is temperature-induced type expression vector pBV-NT;

Figure 20 is the temperature-induced expression of expression vector pBV-NT; Wherein:

Lane?1：low?molecular?weight?of?protein?marker

Lane?2：before?induction

Lane?3～6：induction?time?at?1，2，3，4?hours.

Lane?7：native?cobra?neurotoxin；

Figure 21 is that indirect elisa method is checked the rabbit anteserum antibody titer, and arrow indication extension rate is 256, wherein, and Neurotoxin 1 μ g/ml (a), 2 μ g/ml (b);

Figure 22 is EKMax ^TM25 ℃ of splitting actions to fusion rotein in solution, enzymolysis time are 24 hours (a), 36 hours (b), and wherein:

Lane?1：Protein?molecular?weight?marker

Lane?2～6：addition?of?0.1，0.2，0.3，0.5，1.0uEKMax ^TM

Lane?7：control?without?EKMax ^TM

Lane?8：native?neurotoxin；

Figure 23 is the K of different concns ratio ₃PO ₄, CaCl ₂To the influence of fusion protease, precipitation part (a) and supernatant part (b); Wherein:

Lane?1：Protein?molecular?weight?marker

Lane?2：control?without?EKMax

Lane?3～8：the?addition?of?K ₃PO ₄?1.0，2.0，3.0，4.0，5.0mM?respectively.

Lane?9：native?neurotoxin；

Figure 24 is the purifying (a) of solid enzyme hydrolysis products, and immunoblotting (b); Wherein:

Lane?1：protein?marker

Lane?2：precipate?from?EXMax?digestion

Lane?3：the?elute?from?10mM?HCL

Lane?4：the?elute?from?100mM?HCL

Lane?5：native?neurotoxin；

Figure 25 is that EKMax cuts the non-specific enzymes of natural neurotoxin, wherein:

Lane?1：polypaptide?marker

Lane?2～6：addition?of?EKMax?4.0，1.0，5.0，0.2，0.1?unit

Lane?7：control?without?EKMax；

Figure 26 is that DP inserts the fragment PCR amplification, wherein:

Lane?1：100bp?DNA?marker

Lane?2～4：Amplified?the?DNA?fragments

Lane?5：100bp?ladder；

Figure 27 is that DP inserts fragment and carrier double digestion, wherein:

Lane?1：double-digested?pTN314

Lane?2：control?of?pTN314

Lane?3：double-digested?DP?insert

Lane?4：control?of?DP?insert

Lane?5：100bp?ladder；

Figure 28 is expression plasmid pTN314 (a) and amalgamation and expression zone (b) that has the acidolysis site;

Figure 29 separates fusion rotein with formic acid and acetate, at 37 ℃, is incubated 24 hours (a) and 48 hours (b), at 1 hour (c) of 85 ℃ of insulations, wherein:

A：Lane?1：protein?molecular?weight?marker

Lane?2：control?without?acid

Lane?3～4：addition?of?13％and?26％?of?acetic?acid?respectively

Lane?5～6：addition?of?35％and?70％of?formic?acid?respectively

B：Lane?1～2：addition?of?13％and?26％of?acetic?acid?respectively

Lane?3～4：addition?of?35％and?70％?of?formic?acid?respectively

Lane?5：control?without?acid

Lane?6：protein?molecular?weight?marker

Lane?7：native?neurotoxin?in?13％?of?acetic?acid

Lane?8：native?neurotoxin?in?70％?of?formic?acid

C：Lane?1：control?without?acid

Lane?2：protein?molecular?weight?marker

Lane?3～4：addition?of?13％and?26％of?acetic?acid?respectively

Lane?5～6：addition?of?35％and?70％of?formic?acid?respectively

Lane?7：native?neurotoxin

Lane?8：native?neurotoxin?in?13％?of?formic?acid；

Figure 30 is that different concns dilute hydrochloric acid is incubated 2 hours sour fusion roteins (a) at 85 ℃, immunoblotting contrast (b), and immunoblotting (c), and b and c applied sample amount are 1/4 of a, wherein:

A?Lane?1：native?neurotoxin

Lane?2：protein?molecular?weight?marker

Lane?3～7：addition?of?100，50，25，10，5mM?of?HCl?respectively

Lane?8：fusion?protein?control?without?acid

B?and?C：Western?blot.The?loading?sample?of?B?and?C?were?as?much?as?about

1/4?of?the?sample?in?A.

Lane?1：protein?molecular?weight?marker

Lane?2～5：addition?of?100，50，25，10，5mM?of?HCl?respectively

Lane?6：fusion?protein?control?without?acid

Lane?7：native?neurotoxin?in?100mM?of?HCl

Lane?8：native?neurotoxin；

Figure 31 is the recombinant neurotoxins of a hydrolysis fusion rotein and release proportion respectively not in the acid hydrolysis solution, the yield of recombinant neurotoxins;

Figure 32 is an aspartic acid C end peptide bond scission reaction mechanism;

Figure 33 is the capillary electrophoresis of recombinant neurotoxins, and transition time is 14.09min;

Figure 34 is the optimization that chromatogram flow phase is formed, and dil refers to one times of sample concentration dilution, and control is for to carry out isolating contrast with basic moving phase, a, and b, c are different additive, c1-c5 refers to add the different concns of c;

Figure 35 is ion exchange method purified fusion protein color atlas (a) and respective components electrophorogram (b); Wherein:

Lane?1：flow-through

Lane?2：protein?molecular?weight?marker

Lane?3～4.8～9：impurities?in?the?osmotic?shock?fluid.

Lane?5～7：the?fractions?of?fusion?protein；

Figure 36 is that the post of XK16/60 Superdex 75 prep is imitated mensuration;

Figure 37 is that gel chromatography separates recombinant neurotoxins;

Figure 38 is the recombinant neurotoxins desalination, (1) recombinant neurotoxins peak, and ultraviolet 280nm, (2) salt peak, electricity is led detection;

Figure 39 is that per step purified product electrophoresis purity is analyzed (a) and immunoblotting detects (b); Wherein:

A：Lane?1，6：fusion?proteins?from?ion?exchange?colum.

Lane?2：acedic?lysate

Lane?3：recombinant?neurotoxin

Lane?4：protein?molecular?weight?marker

Lane?5：native?neurotoxin

B：Lane?1：osmotic?shock?fluid

Lane?2：fusion?protein?from?ion?exchange?column.

Lane?3：acetic?lysate

Lane?4：recombinant?neurotoxin

Lane?5：native?neurotoxin；

Figure 40 is the electrospray ionization mass spectrum of recombinant neurotoxins;

Figure 41 is reverse high-performance liquid chromatogram determination recombinant neurotoxins purity (1) and solvent blank (2);

Figure 42 is the full wavelength scanner figure of recombinant neurotoxins main peak ();

Figure 43 is the free zone electrophoresis figure of the kapillary of recombinant neurotoxins;

Figure 44 is the LD of reorganization (a) and natural neurotoxin (b) ₅₀Measure;

Figure 45 is a patch clamp experiments device synoptic diagram;

Figure 46 is full cell patch pincers administering mode synoptic diagram;

Figure 47 is the cultured neonatal rat Skeletal Muscle Cell;

Figure 48 is the voltage-gated channel electric current of the Skeletal Muscle Cell cultivated, and the voltage depolarize stimulates from-70mV to 40mV, step 10mV, totally 12 times, visible export-oriented potassium current and interior to sodium current;

Figure 49 is the repeatability that 80mmol/L brings out skeletal muscle nicotine electric current;

Figure 50 is the restraining effect of natural neurotoxin to the nicotine electric current; Wherein:

Lane?1：control，80mM?nicotine-evoked?currents?by?recombinant?neurotoxin

Lane?2?and?3：80mM?nicotine+2.3uM?native?neurotoxin

Lane?4：80mM?nicotine+11.5uM?native?neurotoxin

Lane?5?and?6：80mM?nicotine+23uM?native?neurotoxin；

Figure 51 is the restraining effect of recombinant neurotoxins to the nicotine electric current; Wherein:

Lane?1：control，80mM?nicotine-evoked?currents

Lane?2：80mM?nicotine+11.5uM?native?neurotoxin

Lane?3?and?4：80mM?nicotine+23uM?native?neurotoxin

Figure 52 is reorganization (a) and natural neurotoxin (b) the retarding effect curve to the nicotine inducing current.

Claims (5)

1, a kind of warm mode soluble-expression Cobratoxin albumen, acidolysis release and purification process thereof is characterized in that described method comprises:

(1) clone of neurotoxin gene;

(2) solvable amalgamation and expression;

(3) acidolysis;

(4) after acidolysis reaction is finished, add Tris alkali to 50mM, acid hydrolysis solution pH is adjusted to about 7.0, after electrophoretic examinations acidolysis fully, carries out the gel column purifying;

(5) the recombinant protein main peak is collected, and vacuum freezing concentrates, and protein peak is collected in desalination, measures recombinant protein concentration and is about 0.5mg/ml, and the final yield of recombinant neurotoxins is 35.3% (is 1 with osmotic shock acquisition amount);

(6) the comprehensive yield of recombinant neurotoxins

Purification step yield purity

Osmotic shock 100% 65%

Ion-exchange 82% 90%

Acidolysis 63% 28%

Gel-filtration 76%

The pure product 91%＞95% of desalination

Final yield 35.3%

2, method according to claim 1 is characterized in that described solvable fusion expression method comprises:

(1) adds Kpn I and Sal I site (base sequence in the shade) respectively at the neurotoxin gene two ends

Forward primer 5 ' CGG GTA CCG CTG GAA TGT CAC

Reverse primer 5 ' GGC GTC GAC TTA ATT GTT GCA TCT

With the T carrier that contains neurotoxin gene is that template is carried out PCR (polymerase chain reaction) amplification, 94 ℃ of sex change 30 seconds, and 55 ℃ of annealing 30 seconds, 72 ℃ were extended 26 seconds, and reacted 40 circulations; Kpn I and Sal I enzyme are cut PCR (polymerase chain reaction) product, reclaim DNA, as inserting segment;

(2) carrier double digestion and connection transform

PThioHis C carrier extracts, Kpn I and Sal I double digestion, and carrier glue recovery etc. are carried out according to conventional procedure; Electrophoresis estimation enzyme is cut carrier and is inserted pulsating concentration, carry out ligation with the carrier of difference amount and the insertion segment of equivalent, transformed competence colibacillus TOP 10 E.coli, 37 ℃ are cultured to and grow single bacterium colony, select several single bacterium colony order-checkings, determine to insert segment and correctly be connected in the carrier;

(3) abduction delivering of neurotoxin fusion rotein

Inoculate single bacterium colony to 50mlLB liquid nutrient medium (100 μ g/ml penbritin), 37 ℃, the 200rpm shaking culture is spent the night; Be seeded to fresh LB substratum with 1: 50 next day, continues shaking culture to thalline OD ₆₀₀Be about 0.5; Adding IPTC is 1mmol/L to final concentration, and continuation was cultivated four hours; Before adding IPTC and after adding, got 0.1ml bacterium liquid every 1 hour, centrifugal, supernatant discarded, thalline is labeled as 0,1,2,3 respectively, 4,5 hours abduction delivering product; Add 2x SDS-PAGE sample-loading buffer 0.1ml, abundant mixing, 95 ℃ of heating in water bath 10 minutes; Sample on the 20 μ l, electrophoretic examinations;

3, method according to claim 1, it is characterized in that the osmotic shock release of described fusion rotein comprises: inoculate single bacterium colony to 50mlLB liquid nutrient medium (100 μ g/ml penbritin), 30 ℃, the 200rpm shaking culture is spent the night; Be seeded to fresh LB substratum with 1: 50 next day, and 37 ℃ of shaking culture are to thalline OD ₆₀₀Be about 0.5; Add IPTG to concentration be 1mmol/L; Continued shaking culture 5 hours; Measure thalline OD ₆₀₀Value, 4 ℃ 6, the centrifugal collection thalline of 000rpm is abandoned supernatant, and thalline is suspended in an amount of cold osmotic shock 1# solution (20mmol/L Tris, pH8.0,5mmol/L EDTA, 20% sucrose), makes cell density OD ₆₀₀Be about 5.0, ice-water bath, 10 minutes; Centrifugal, supernatant discarded, thalline is suspended in the cold osmotic shock 2# solution of equivalent (20mmol/L Tris, pH8.0,5mmol/L EDTA), ice-water bath, 10 minutes; 4 ℃ 10, centrifugal 15 minutes of 000rpm gets supernatant, and-20 ℃ frozen; Protein electrophoresis is checked;

The soluble-expression amount of pTN314 expression vector is for being 28%, and its purifying mode is that osmotic shock and renaturation situation be not for needing;

4, method according to claim 1 is characterized in that described acidolysis comprises:

(1) in the introducing in the acid-sensitive sense site (DP) in fusion rotein site

As implied above, this figure is the position of fusion sequence chart of the insertion D-P of design, after 5 ' end of the plasmid neurotoxin gene of pTN314 and 3 ' the end terminator codon, Kpn I and pst I site are arranged, to the encode base sequence GAT CCG of acid-sensitive sense site DP of design primer is added to neurotoxin gene 5 ' and holds, in the frame is restriction enzyme site, and dash area is the base sequence of encoding D-P;

(2) PCR (polymerase chain reaction) amplification; With 0.5 μ l p TN314 is template, each 0.5 μ l of forward and reverse primer, and PCR damping fluid 5 μ l, dNTP 4 μ l add water to 50 μ l, mixing; 94 ℃ of sex change 1.0 minutes, 65 ℃ of renaturation 45 seconds, 72 ℃ were extended 1.0 seconds, and reacted 30 circulations; Last circulation was extended 5 minutes for 72 ℃;

(3) DP inserts the structure of expression vector

Dna segment such as Figure 26 of amplification are about 200bp; Amplification segment and plasmid pTN314 are by KpnI and Pst I double digestion, result such as Figure 27; Can see that the amplification segment after enzyme is cut is more smaller before cutting than enzyme, but, conform to actual greater than the small pieces that pTN314 cuts out; Select single bacterium colony after the conversion, order-checking is carried out according to a conventional method; Recombinant plasmid such as Figure 28, called after pTNP314;

(4) acidolysis of fusion rotein discharges

Concentration be the dilute hydrochloric acid of 5-100mM at 85 ℃, act on 2 hours, fusion rotein is by efficient cracking, when sour final concentration was 25mM, the recombinant protein yield was up to 63%, accounted for that total protein content is 28% in the acid hydrolysis solution, this moment, cracked solution pH was about 2.2;

5, method according to claim 1 is characterized in that described purification process comprises:

(1) the separation chromatography post of recombinant toxin and carrier proteins: XK16/60 filling Superdex 75 prep medium flowing mutually: 50mM Tris, pH8.0,0.15 M NaCl is with the flow velocity of 1.0ml/min, moving phase balance chromatographic column with two column volumes, get Tris neutral fusion rotein solution 5ml after the acidolysis, last sample; Component is collected at the peak, and-25 ℃ frozen;

(2) concentrating and desalination moving phase of recombinant protein: 5mM NEPES, pH7.0, the recombinant neurotoxins freeze-drying of 25mM NaCl gel separation, measure recombinant protein content, recombinant protein is dissolved in the pure water with 1mg/ml, each sample 1.0ml that goes up, ultraviolet and electricity are led detection, the desalination of HiTrap Desalting Superdex G-25 post; Collect protein ingredient, the BCA method is measured protein content, and-25 ℃ frozen;

Images