CN102020710B

CN102020710B - Novel mutant EN-46 of human epidermal growth factor

Info

Publication number: CN102020710B
Application number: CN2010102715180A
Authority: CN
Inventors: 涂桂洪; 王晓晶; 唐洁成; 何颖芝
Original assignee: HUASHENGYUAN GENE ENGINEERING DEVELOPMENT Co Ltd SHENZHEN CITY
Current assignee: HUASHENGYUAN GENE ENGINEERING DEVELOPMENT Co Ltd SHENZHEN CITY
Priority date: 2010-09-03
Filing date: 2010-09-03
Publication date: 2012-09-05
Anticipated expiration: 2030-09-03
Also published as: CN102020710A

Abstract

The invention belongs to the technical field of bioengineering and provides a novel mutant EN-46 of a human epidermal growth factor, in particular to a mutant EN-46 and a nucleic acid sequence of the mutant EN-46 as well as a vector containing the nucleic acid sequence and engineering bacteria containing the vector. The invention also provides a method for preparing C-end frameshift mutant of the human epidermal growth factor, in particular to a method for preparing the mutant EN-46, a composition containing the mutant and application of the composition in preparing medicines, health products or cosmetics. The mutant can achieve complete soluble expression in escherichia coli, the permeability of a cell membrane is enhanced, and expression products are completely secreted in an extracellular culture medium and entirely have the biologicalactivity of the human epidermal growth factor.

Description

New two mutants EN-46 of Urogastrone

Technical field

The present invention relates to a kind of Urogastrone, be specifically related to a kind of Urogastrone's two mutants, Preparation Method And The Use.

Background technology

There is a peptide species in discovery mouse submandibular gland such as U.S. biologist professor Cohen in the period of the 1960-1963, has short widely cel l proliferation, and naming is Urogastron (epidermalgrowth factor is called for short EGF).Shortly after that, scientist has found the similar activity material in people's urine, is called as Urogastrone (hEGF).Research afterwards confirms that further Urogastron extensively is present in people and the mammal body, is that a molecular weight of being made up of 53 amino acid is 6222 micromolecule polypeptide, and iso-electric point is 4.6.Mouse and people's Urogastron has the homology of height.Urogastron has BA widely, takes place and aspect such as fetal development has vital role in cell growth and metabolism, cytodifferentiation and contrary differentiation and in form.

After the seventies in last century; People have carried out a large amount of research to structure and the function of hEGF; Discovery influences the sequence that the active core of hEGF position only comprises at 3 pairs of disulfide linkage of intramolecularly, and N-holds before 6 halfcystines and aminoacid deletion or the change afterwards of 42 halfcystines of C-end do not have substantial influence to its BA.

Confirm that now Urogastron is tissue injury reparation and the important molecular basis of human body regeneration, has been widely used in the clinical medicine applied research since the nineties in last century.China takes the lead in realizing the hEGF large-scale industrial production in the world, and official approval is used for all kinds of wounds of clinical treatment as medicine.

The hEGF suitability for industrialized production mainly adopts recombinant gene at present, and most of is gene host bacterium with intestinal bacteria.Because intestinal bacteria are not modified and mechanism of secretion after not possessing perfect albumen, foreign gene (comprising the hEGF gene) expression product usually is present in the cell paste with insoluble inclusion body form.This brings great trouble for the downstream aftertreatment, and cell needs fragmentation, and inclusion body needs cracking, sex change and repeatability, could obtain activated product at last.Expression product the phenomenon of mispairing usually can occur at sex change, renaturation process, and the last yield of product is extremely low, and quality also is difficult to control.This defective has become the technology barrier of escherichia expression system maximum in the recombinant protein industrialization process.

Summary of the invention

The purpose of this invention is to provide a kind of Urogastrone C-end phase shift mutant, especially two mutants EN-46 and nucleotide sequence thereof, and the carrier and the engineering bacteria that comprise this nucleotide sequence.

Another object of the present invention provides preparation Urogastrone C-end phase shift mutant, the especially preparation method of two mutants EN-46.Be specifically related to a kind of expressed sequence with PCR random mutation technique construction Urogastrone C-end phase shift mutant EN-46.

The present invention also provides compsn and the application in preparation medicine, healthcare products or makeup thereof that contains Urogastrone C-end phase shift mutant EN-46.

The invention has the advantages that this two mutants, especially two mutants EN-46 can realize solubility expression completely in host cell especially intestinal bacteria; The passing through property enhancing of cell membrane; Expression product all is secreted in the outer substratum of born of the same parents, is convenient to the extraction separation purifying, is easy to suitability for industrialized production.Host cell especially this mutant polypeptide of escherichia coli expression has Urogastrone's BA fully, the short cell fission and the proliferation activity of concrete natural human Urogastron.

Do detailed description in the face of the present invention down.

One, obtains the two mutants nucleic acid molecule with PCR random mutation technology

When utilizing the Taq archaeal dna polymerase to carry out DNA amplification in vitro (PCR), base mispairing, disappearance or increase can occur, thereby cause occurring in the PCR product various two mutants.This sudden change be fully at random, have no rule, disappearance or increase a base and will make original template DNA begin the dna sequence dna generation phase shift mutation of back during dna replication dna from disappearance or this base of increasing.People usually utilize the characteristics of this fallibility of PCR to make up the range gene two mutants in experimental study, to study the influence that sudden change is caused the biology of gene function.Utilize above-mentioned principle, it is the PCR amplification in vitro that template is carried out that the present invention adopts the hEGF gene DNA of synthetic, obtains Urogastrone's two mutants.

Described Urogastrone's two mutants comprises Urogastrone C-end phase shift mutant; Preferably, comprise all amino acid phase shift mutants behind 42 halfcystines of Urogastrone C-end.

The amino acid no purpose increased after said Urogastrone's two mutants also comprised 42 halfcystines of C-end, and replacement perhaps lacks one or more, as is no more than 11, preferably is no more than 8,5, more preferably no more than 4, and still keeps its BA; Preferably, comprise 42 halfcystines of C-end after amino acid number reduce, be reduced to 10 by 11 original amino acid, 8,5,4,3,2 or 1; Most preferred, C has appearred in the sequence of this two mutants behind 42 halfcystine codons of coding hEGF C-end ¹²⁷The disappearance of base and cause the phase shift mutation of aminoacid sequence generation subsequently, terminator codon TGA occurs in advance, and the amino acid number behind 42 halfcystines of C-end is reduced to 4 by 11, and aminoacid sequence is by original C ys ⁴²Gln Tyr Arg Asp Leu Lys Trp Trp Glu Leu Arg sports Cys ⁴²Ser Thr ValThr, molecular weight is reduced to 5,036 dalton by 6,222 original dalton, this two mutants called after Urogastrone two mutants EN-46.

The nucleotide sequence of the preferred two mutants EN-46 of the present invention and normal people's Urogastron and aminoacid sequence contrast as follows:

HEGF nucleotide sequence AAT TCC GAC TCT GAA TGC CCG CTG TCT CAC GAC GGT TAC TGC CTA CAC GAT GGT

HEGF aminoacid sequence Asn Ser Asp Ser Glu Cys Pro Leu Ser His Asp Gly Tyr Cys Leu His Asp Gly

EN46 nucleotide sequence AAT TCC GAC TCT GAA TGC CCG CTG TCT CAC GAC GGT TAC TGC CTA CAC GAT GGT

GTT?TGC?ATG?TAT?ATC?GAA?GCT?CTG?GAC?AAA?TAC?GCG?TGC?AAC?TGT?GTT?GTT?GGT?TAC?ATC?GGT?GAA?CGT

Val?Cys?Met?Tyr?Ile?Glu?Ala?Leu?Asp?Lys?Tyr?Ala?Cys?Asn?Cys?Val?Val?Gly?Tyr?Ile?Gly?Glu?Arg

HEGF nucleotide sequence TGC CAG TAC CGT GAC CTG AAA TGG TGG GAA CTG CGT

42 at hEGF C-end Aminoacid sequence Cys behind the Gelucystine ⁴²Gln Tyr Arg Asp Leu Lys Trp Trp Glu Leu Arg

EN46 nucleotide sequence TGC AGT ACC GTG ACC TGA AATGGTGGGACTGCGTTAATAA

42 at EN-46 C-end

Aminoacid sequence Cys behind the Gelucystine ⁴²Ser Thr Val Thr Stop

Sequencing result shows that nucleotide sequence and aminoacid sequence are identical before 42 halfcystines of two mutants EN-46 and normal hEGF C-end, but the aminoacid sequence behind 42 halfcystines of C-end is then different fully with amino acid number.The aminoacid sequence of described two mutants EN-46 is shown in sequence table 2, and its nucleotide sequence is shown in sequence table 1.This two mutants can be realized solubility expression completely in host cell, expression product all is secreted in the outer substratum of born of the same parents.This mutant polypeptide of in host cell, expressing has Urogastrone's BA fully.Wherein said host cell is intestinal bacteria.

Two, make up the expression vector plasmid that contains two mutants

The mutant gene that obtains according to the method described above is connected with escherichia coli outer membrane protein leading peptide (ompA) gene, places T7 promotor (T7pro) and terminator (rrnBT ₁T ₂) between, construct the expression vector plasmid that contains two mutants.

Described carrier is characterized in that containing the controlling element handled that the two mutants EN-46 that is suitable for said Urogastrone expresses, that link with said nucleic acid molecule in the purpose host cell.

Three, the engineering strain that efficiently expresses with expression vector plasmid transformed host cell and screening

Change the above-mentioned expression vector plasmid that builds over to host cell with ordinary method, be preferably intestinal bacteria.The transformant that contains above-mentioned expression framework can filter out the bacterium colony of the two mutants that efficiently expresses.

Preferably, described intestinal bacteria are E.coli JM109 (DE3), the bacterium colony called after E.coli EN-46 that contains high expression level EN-46 that filters out.

Four, the cultivation of engineering bacteria and abduction delivering

(1) the preparation fermentation is with common LB substratum, pH7.0-8.5;

(2) engineering bacteria is seeded in the said substratum, 37 ℃ of cultivations;

(3) be cultured to OD ₆₀₀When reaching 3.0-4.0, add final concentration 12.5-100 μ gIPTG/ml abduction delivering, temperature regulation to 30 ℃ is regulated pH 7.0-8.5 therebetween;

(4) after abduction delivering 4-18 hour, stop fermentation, fermented liquid is collected supernatant through membrane filtration.

Collect supernatant and thalline and carry out the SDS-PAGE gel electrophoresis simultaneously.The result shows that the expression product that major part is tried bacterium colony all is secreted in the substratum with solubility, does not find to have the band of expression in the thalline.

Select the highest bacterium colony of expression amount and amplify fermentation test, further study its optimum process condition.Express stable single bacterium colony through continuous 3 batch fermentations proof, be prepared into the work seed, be stored in-20 ℃ of refrigerators.Described work seed is that engineering strain is E.coli EN-46.

This project bacterial classification has been delivered Chinese typical culture collection center (place: Wuhan City, Wuhan University) preservation, and the engineering bacterial strain of preservation is intestinal bacteria EN-46 Escherichia coli EN-46,

Preservation date: on July 19th, 2010, deposit number is CCTCC M 2010178.

Five, separation and purification two mutants

Adopt micro-filtration, hydrophobic chromatography, anionresin and gel-filtration array mode separation and purification two mutants.The preferred simply three-step approach that adopts as follows: catch the two mutants in the fermented liquid with hydrophobic chromatography earlier, adopt anion-exchange chromatography separation and purification two mutants again, adopt gel permeation chromatography to be further purified two mutants at last.Through simple three step operations, can obtain purity greater than 95%, have the two mutants of Urogastrone's BA, total recovery can reach more than 70%.

Described two mutants is preferably two mutants EN-46.

Six, the compsn that contains two mutants

A kind of compsn comprises the Urogastrone's who treats significant quantity two mutants and verivate or vehicle or thinner or auxiliary substance.Described compsn comprises pharmaceutical composition, Halth-care composition, perhaps make-up composition.Wherein treat significant quantity and be meant the dosage of BA of performance two mutants.Described two mutants comprises the two mutants of aforesaid various ways, preferably two mutants EN-46.Described verivate is meant the multiple modified forms that comprises this two mutants, comprises that the PEG of different molecular weight modifies body.Its consumption can be according to patient's age, body weight, and the severity of disease is adjusted.The per daily dose of wherein said two mutants EN-46 is generally 0.05-5 μ g/cm ²

Described pharmaceutical composition comprises described Urogastrone's two mutants, is preferably two mutants EN-46 and acceptable accessories and forms; Described auxiliary material comprises the thinner that pharmaceutical field is conventional, vehicle, weighting agent; Tackiness agent, wetting agent, disintegrating agent; Absorption enhancer, tensio-active agent, lubricant etc.

The dosage form of this pharmaceutical composition comprises conventional oral prepns and non-gastrointestinal preparation.Oral prepns comprises, solid preparation, and like capsule, tablet, pill, granule; Liquid preparation is like syrup etc.Non-intestinal drug delivery agent comprises injection, spray, and ointments etc. also comprise freeze-dried powder.Comprise some novel drug-delivery preparations in addition, like slow, controlled release preparation, microemulsion formulation, targeting drug administration preparation etc.Described Urogastrone's two mutants is preferably two mutants EN-46.Above-mentioned various formulation all can be according to the ordinary method preparation of pharmaceutical field.

Healthcare products and cosmeceutical compsn and preparation thereof can comprise auxiliary material and dosage form thereof conventional in the field, can not set forth in detail at this according to preparing method's preparation conventional in the field.Seven, two mutants is in preparation medicine, the purposes in healthcare products and the makeup

The two mutants, especially the two mutants EN-46 that prepare through the inventive method have Urogastrone's BA preferably, comprise short cell fission and proliferation activity with natural human Urogastron.Its traumatic wound that can heal is rapidly and efficiently repaired various skin injuries, reduces the formation of scar, with other damages unusual effect is arranged to treating skin burn clinically.In addition, this sudden change physical efficiency promotes the propagation of Eponychium cell, and the ability delaying decrepitude of skin promotes the effect that skin cells is repaired.Therefore Urogastrone's two mutants EN-46 and comprise Urogastrone's two mutants EN-46 can be at interior compsn at the preparation medicine; Application in healthcare products or the makeup; Be included in preparation and promote the application in the various medicine for healing wound, smooth away wrinkles and repair the application in medicine such as acne or the makeup in preparation.The inventor has confirmed EN-46 to the promoting healing effect of the acute and chronic surface of a wound and in the application aspect the aesthetic medicine through specific embodiment, and result of treatment is remarkable.

Description of drawings

The original collection of illustrative plates of order-checking of Fig. 1 two mutants EN-46 DNA

Fig. 2 test tube is expressed the SDS-PAGE electrophoresis result of EN-46 test

1.EN-46 induce 4 hours culture supernatant

2.EN-46 induce 4 hours thalline ultrasonic disruption supernatants

3.EN-46 induce 4 hours thalline ultrasonic disruption depositions

4.hEGF induce 4 hours culture supernatant

5.hEGF induce 4 hours thalline ultrasonic disruption supernatants

6.hEGF induce 4 hours thalline ultrasonic disruption depositions

7. inclusion body hEGF (contrast)

Fig. 35 liter jar fermentor tanks are expressed the SDS-PAGE electrophoresis result of EN-46

1. 3 hours culture supernatant of abduction delivering

2. 3 hours thalline of abduction delivering

3. 18 hours culture supernatant of abduction delivering

4. 18 hours thalline of abduction delivering

5. standard hEGF

Fig. 4 EN-46 purified sample SDS-PAGE electrophoresis result

1. the supernatant of fermented liquid behind 0.45 μ m micro-filtration

2. the wash-out appearance (compound sample) after the hydrophobic chromatography post captures

3. the wash-out appearance after the hydrophobic chromatography post captures (peak point)

4. the wash-out appearance after ion column separates (peak point)

5. the wash-out appearance (compound sample) after ion column separates

6. the consummate appearance behind gel permeation chromatography

7. standard hEGF

The graphic representation of the short cell proliferation of Fig. 5 EN-46 and standard hEGF

Fig. 6 EN-46 is to scalding to the patient Chen's of dark II degree result of treatment

Left figure: before treat with EN-46 the scald back

In figure: scald the back with EN-46 preparation for treating 7 days, be almost recovered

Right figure: scald the back with EN-46 preparation for treating 14 days, return to one's perfect health

Fig. 7 conventional medicament is treated the patient with diabetic feet that two wheat harvesting periods are not got better to be changeed, and uses the result of treatment behind the EN-46 instead

Left figure: before the EN-46 treatment

In figure: after treating for 1 week with EN-46

Right figure: after treating for 2 weeks with EN-46

Fig. 8 EN-46 has obvious repair to the acne local damage

Left figure: before the EN-46 treatment

Right figure:, and do not stay trace with EN-46 treatment 1 week back rehabilitation

Fig. 9 EN-46 has the effect of tangible elimination canthus wrinkle to experimenter A

Trier A:55 year, the women

Left figure: before the EN-46 on probation

Right figure: on probation after 1 month canthus wrinkle obviously shoal

Figure 10 EN-46 has the effect of tangible elimination canthus wrinkle to experimenter B

Trier B:45 year, the women

Left figure: before the EN-46 on probation

Right figure: canthus wrinkle completely dissolve after 1 month on probation

Specific embodiment

Below the present invention is illustrated, be intended to set forth optimum implementation of the present invention, but protection scope of the present invention is not limited to this embodiment and experimental example with embodiment and experimental example.

Embodiment 1 adopts PCR random mutation technology to obtain two mutants EN-46 nucleic acid molecule

Entrust Invitrogen company's synthetic pcr primer thing (primer1 and primer2):

Primer1：5’-CAT? CAT?ATG?AAA?AAG?ACA?GCT?ATC-3’

NdeI

Primer2：5’-CAT? CTG?CAG?TTA?TTA?ACG?CAG?TCC?CAC-3’

PstI

In the PCR reaction system of 50 μ l, add:

H ₂O 37μl

10XPCR damping fluid 5 μ l

4dNTP (each 200 μ M) 4 μ l

Primer1(0.25μM) 1μl

Primer2(0.25μM) 1μl

Template DNA (ompA-EGF) 1 μ l

Taq enzyme 1 μ l

The PCR reaction:

94 ℃ of preheatings 5 minutes, follow procedure: 94 ℃, 30 seconds--50 ℃, 30 seconds--72 ℃, 30 seconds, react 25 circulations.

The PCR reaction

The structure of embodiment 2 two mutants EN-46 expression vector plasmids

The NdeI/PstI endonuclease bamhi of PCR product is connected on Y2K0422 (NdeI/PstI) expression vector.The mutant gene EN-46 that obtains places between strong promoter T7 and the terminator rrnBT1T2.Y2K0422 is the efficient expression vector plasmid that our company makes up and preserves, and this expression vector plasmid has the copy number height, can suppress non-target protein after IPTG induces and express and make target protein obtain the characteristic of high expression level.This expression vector plasmid is also available to have identical or equivalent feature, commercially available expression vector of the same type with Y2K0422 expression vector plasmid and replaces.

PCR product (NdeI/PstI) double digestion fragment

The expression framework of two mutants EN-46

Wherein:

T7pro is the T7 promotor

OmpA is the escherichia coli outer membrane protein leading peptide

EN-46 is a hEGF two mutants of the present invention

RrnBT ₁T ₂It is a Transcription Termination subsequence

The original collection of illustrative plates of dna sequencing of this two mutants EN-46 is seen Fig. 1, and the result shows, C occurred in the sequence behind 42 halfcystine codons of coding C-end ¹²⁷The disappearance of base and cause the phase shift mutation of aminoacid sequence generation subsequently, termination codon TGA occurs in advance, and the amino acid number behind 42 halfcystines of C-end is reduced to 4 by 11.

Embodiment 3 expression vector plasmids transform the host bacterium, cultivation of host bacterium and abduction delivering, and screen the engineering strain that efficiently expresses

1. the expression vector plasmid transforms the host bacterium

Change the above-mentioned plasmid that builds over to intestinal bacteria E.coli JM109 (DE3) with ordinary method, the transformant that contains above-mentioned expression framework is used to screen the bacterium colony of high expression level EN-46.

2. the cultivation of engineering bacteria and abduction delivering and expression product born of the same parents' evaluation

Select some transformant bacterium colonies and in test tube, express test.Express and test: peptone 10-15 with common LB substratum (g/1); Yeast extract 5-15; NaCl 5-10; Na ₂HPO ₄0-10; Penbritin 0.1-0.2, initial pH7.0.

The inoculation test tube is cultured to OD at 37 ℃ ₆₀₀When reaching 3.0-4.0, added 100mM IPTG abduction delivering 3-4 hour, centrifugal, collect supernatant and thalline and carry out the SDS-PAGE gel electrophoresis simultaneously, the gel electrophoresis result sees Fig. 2.Electrophoresis result shows that the title product that EN-46 expresses all is secreted into culture supernatant with solvable mode, and supernatant behind the thalline ultrasonic disruption and deposition all do not find have the target protein band to exist.And in culture supernatant, having only a small amount of title product as the normal hEGF that contrast has an identical expression framework, most of expression product is present in the deposition behind the ultrasonic disruption with the inclusion body mode.

3. select the highest bacterium colony of expression amount and amplify fermentation test

Engineering bacteria with screening in above-mentioned 1, preparation carries out fermentation test in 5 liters of jars.Ferment with common LB substratum (g/1): peptone 10-15; Yeast extract 5-15; NaCl 5-10; Na ₂HPO ₄0-10; Penbritin 0.1-0.2, pH7.0-8.5.

Engineering bacteria is cultured to OD for 37 ℃ ₆₀₀When reaching 3.0-4.0, add final concentration 12.5-100 μ gIPTG/ml abduction delivering, temperature regulation to 30 ℃ is regulated between the pH7.0-8.5 therebetween.Induce sampling after 3-4 hour, centrifugal, collect supernatant and thalline.Continue abduction delivering and stopped fermentation in 10-14 hour, fermented liquid is collected supernatant, thalline with 0.45 μ m membrane filtration.The sample of twice collection in front and back carries out the SDS-PAGE gel electrophoresis, and the gel electrophoresis result sees Fig. 3.5 liter jar fermentation test results reconfirm that EN-46 all is secreted in the substratum with the solubility mode after 18 hours at abduction delivering, and thalline has not been found residual.

4. the fermented supernatant fluid of collecting behind the membrane filtration is waited until next step separation, purification process.

5. express stable single bacterium colony through continuous 3 batch fermentations proof, be prepared into the work seed lot, be stored in-20 ℃ of refrigerators.

The simple three-step approach separation and purification of embodiment 4 usefulness EN-46

The first step is caught the EN-46 in the fermented liquid with hydrophobic chromatography

(1) ferment filtrate of in application example 3, collecting slowly adds 3M (NH ₄) ₂SO ₄To final concentration be 0.3M, catch EN-46 with hydrophobic chromatoghaphy medium;

(2) hydrophobic chromatoghaphy medium: GE company produces Phenyl Sepharose 6 Fast Flow (highsub), and chromatography column is with 0.3M (NH before the last appearance ₄) ₂SO ₄/ 20mM Tris (pH8.2) is balance fully;

(3) the last kind of elder generation that finishes uses lavation buffer solution: 0.3M (NH ₄) ₂SO ₄/ 20mM Tris (pH8.2) thorough washing is to baseline, and then with 0.05M (NH ₄) ₂SO ₄/ 20mM Tris (pH8.2) thorough washing is to baseline;

(4) use elution buffer: the EN-46 of 20mM Tris (pH8.2) elute captured, elutriant are used for the second step ion exchange chromatography and separate;

Second step is with anion-exchange chromatography separation and purification EN-46

(5) it is 100mM NaCl/20mM Tris (pH8.2) that the hydrophobic chromatography elutriant that contains EN-46 is adjusted to final concentration respectively with 4M NaCl and 0.5M Tris (pH8.2);

(6) anion-exchange chromatography medium: GE company produces Q Sepharose High Perfomance, and last appearance is preceding with the abundant balance of 100mM NaCl/20mM Tris (pH8.2) damping fluid;

(7) go up appearance and finish, with 380mM NaCl/20mM Tris (pH8.2) damping fluid thorough washing to baseline;

(8) with 650mM NaCl/20mM Tris (pH8.2) buffer solution elution, elutriant is used for the 3rd step gel permeation chromatography and is further purified;

The 3rd step was further purified EN-46 with gel permeation chromatography

(9) gel permeation chromatography medium: GE company produces Superdex30, and last appearance is preceding with the abundant balance of 20mM phosphoric acid buffer (pH7.6).

(10) the ion exchange chromatography elutriant that contains EN-46 directly is used for appearance, and each appearance 2ml that goes up flows directly into 20mM phosphoric acid buffer (pH7.6) after the last appearance, and middle per sample molecular weight varies in size and makes EN-46 obtain further separation and purification.

Through simple three step operations, can obtain purity greater than 95%, have the EN-46 of hEGF BA, total recovery can reach more than 70%.Purified sample SDS-PAGE electrophoresis result is seen Fig. 4.

Embodiment 5 usefulness mtt assay are measured short cell fission and the proliferation activity of two mutants EN-46

Measure and use cell strain: Balb/3T3, be cultured to logarithmic phase with ordinary method.

(1) is adjusted to 5-8x10 to the logarithmic phase cell with DMEM substratum (containing 10% serum) ⁴Individual cell/ml, every hole adds 100 μ l cell suspensions in 96 orifice plates.37 ℃, 5%CO ₂Overnight cultures;

(2) supernatant discarded adds DMEM substratum (containing 0.5% serum) 100 μ l, and 37 ℃, 5%CO ₂Overnight cultures;

(3) supernatant discarded adds DMEM substratum (containing 0.5% serum and different concns EN-46) 100 μ l, and 37 ℃, 5%CO ₂Cultivated 72 hours;

(4) every hole adds MTT solution (5.0mg/ml) 20 μ l, 37 ℃, 5%CO ₂Incubation 5 hours, supernatant discarded adds 100 μ l10%SDS, and cracking is 20 minutes under the room temperature, measures extinction value (OD value) in wavelength 570nm;

(5) each weaker concn is made the balance controlled trial with standard hEGF simultaneously;

(6) be that X-coordinate, corresponding OD value are the ordinate zou mapping with EN-46, standard hEGF concentration, measure the maximum half proliferative amount of EN-46 and be no more than 10ng/ml, quite active with standard hEGF.

The EN-46 of table different concns and standard hEGF cultivate mtt assay detection OD after 5 days ₅₇₀The result

(concentration unit: ng/ml)

The short cell-proliferation activity graphic representation of EN-46 and standard hEGF is seen Fig. 5.

Embodiment 6 contains the pharmaceutical composition of two mutants EN-46

It is the pharmaceutical composition of main active ingredient with EN-46 that this invention has disclosed a kind of.Said composition is a kind of liquid preparation, can be sprayed directly on the injured surface of a wound.Consisting of of said composition:, add the EN-46 of 0.5-10mg in the phosphate buffer solution of 20mM (pH6.5-7.0), 50-100g glycerine, 1-10g N.F,USP MANNITOL at 1000ml.

Embodiment 7 contains the composite skin care product of two mutants EN-46

It is the composite skin care product of main active ingredient with EN-46 that this invention has disclosed a kind of.Said composition is a kind of gel preparation, can directly spread upon on the skin.Consisting of of said composition:, add the EN-46 of 0.5-5mg in the phosphate buffer solution of 20mM (pH6.5-7.0), 5-10g glycerine, 1-10g N.F,USP MANNITOL, 1-8g carbomer at 1000ml.

Embodiment 8 contains the external use liquid sprays of two mutants EN-46

It is the liquid spray of main active ingredient with EN-46 that the present invention discloses a kind of.This sprays can be sprayed directly on the injured surface of a wound.Consisting of of this liquid spray:, add the EN-46 of 0.5-10mg in the phosphate buffer solution of 20mM (pH6.5-7.0), optimum addition 1-4mg at 1000ml; 50-100g glycerine, optimum addition 60-80g; 1-10g N.F,USP MANNITOL, optimum addition 6-8g.

Embodiment 9 contains the skin-care gel agent of two mutants EN-46

It is the skin-care gel agent of main active ingredient with EN-46 that this invention has disclosed a kind of.This gelifying agent can directly spread upon on the skin, and it consists of: at 1000ml, add the EN-46 of 0.5-5mg in the phosphate buffer solution of 20mM (pH6.5-7.0), optimum addition is 0.8-2mg; 5-10g glycerine, optimum addition are 6-8g; 1-10g N.F,USP MANNITOL, optimum addition are 6-8g; 1-8g carbomer, optimum addition are 2-5g.

The effect that the sprays that embodiment 10 contains two mutants EN-46 has the acceleration of wound reparation, improves healing quality

Observed the effect of EN-46 sprays (evenly spraying the surface of a wound every day 2 times) to trauma repair.Test-results shows that the EN-46 preparation all has tangible promotion epithelial growth, quickens the effect of wound healing all kinds of surface of a wound, and total effective rate surpasses 90%.

One of them case and result of treatment thereof: Chen, 4 years old, to be scalded to dark II degree by boiling water accidentally, therapeutic process only uses the EN-46 liquid preparation, and basic recovery from illness in the 7th day returns to one's perfect health after 14 days, and does not stay any vestige.The result sees Fig. 6.

Embodiment 11 contains the repair of two mutants EN-46 sprays to refractory wounds

Observed of the repair of EN-46 sprays to refractory wounds such as diabetic foot and severe pressure sores.Own control is tested before and after adopting treatment.The surface of a wound squirts the surface of a wound with two mutants EN-46 preparation local uniform after conventional debridement, every day 2 times.Curative effect judging standard: healing is effective more than 30% in 4 weeks.Test-results shows that EN-46 is efficient up to more than 90% to the treatment diabetic foot, and curative ratio is up to 80%; To the curative ratio of severe pressure sore up to more than 80%.

One of them case and result of treatment: patient with diabetic feet, conventional medicament are treated the commentaries on classics of not getting better of two wheat harvesting periods, use the EN-46 preparation instead and return to one's perfect health after two weeks.The result sees Fig. 7.

Embodiment 12 contains the application of two mutants EN-46 gelifying agent aspect medical cosmetology

Observed and contained the application of two mutants EN-46 gelifying agent aspect medical cosmetology.The result shows that it is near half the to use two mutants EN-46 processing laser beautifying and the iatrogenic surface of a wound of various beauty treatment (incomplete statistics 1316 examples) healing time to shorten than control group, does not stay or stay less scar after the healing.Part experimenter's result of treatment, result are seen Fig. 8,9,10.

Claims

1. a Urogastrone two mutants, the aminoacid sequence that it is characterized in that this two mutants is two mutants EN-46 shown in sequence table 2.

2. a Urogastrone two mutants EN-46 is characterized in that its coding nucleotide sequence is shown in sequence table 1.

3. the described two mutants EN-46 of claim 2 is characterized in that this mutant gene can realize solubility expression completely in intestinal bacteria, and expression product all is secreted in the outer substratum of born of the same parents.

4. the described two mutants EN-46 of claim 3 is characterized in that having fully at this mutant polypeptide of expression in escherichia coli Urogastrone's BA.

5. the carrier that contains the encoding sequence of each described two mutants EN-46 of claim 2-4.

6. the described carrier of claim 5 is characterized in that containing the controlling element handled that the two mutants EN-46 that is suitable for said Urogastrone expresses, that link with said nucleic acid molecule in the purpose host cell.

7. the host cell that contains claim 5 or 6 said carriers.

8. the described host cell of claim 7 is characterized by and is that it is intestinal bacteria.

9. the described host cell of claim 8 is characterized in that intestinal bacteria are bacterial strain E.coli EN-46, is preserved in Chinese typical culture collection center, and deposit number is CCTCC M 2010178.

10. compsn is characterized in that containing the arbitrary described Urogastrone's of claim 2-4 who treats significant quantity two mutants EN-46 and vehicle or thinner or auxiliary substance.

11. the described compsn of claim 10 is characterized in that said compsn is pharmaceutical composition, Halth-care composition or make-up composition.

12. the described compsn of claim 11, the dosage form of wherein said pharmaceutical composition are oral prepns or non-gastrointestinal preparation.

13. the described compsn of claim 12 is characterized in that pharmaceutical prepn is injection, sprays, paste, capsule or tablet.

14. the application of the arbitrary described Urogastrone's of claim 2-4 two mutants EN-46 in preparation medicine, healthcare products or makeup.

15. the arbitrary described Urogastrone's of claim 2-4 two mutants EN-46 promotes the application in the various medicine for healing wound in preparation.

16. the arbitrary described Urogastrone's of claim 2-4 two mutants EN-46 smoothes away wrinkles and repairs the medicine of acne or the application in the makeup in preparation.