CN105039597B - A kind of kit and its application for being used to detect influenza virus - Google Patents
A kind of kit and its application for being used to detect influenza virus Download PDFInfo
- Publication number
- CN105039597B CN105039597B CN201510468283.7A CN201510468283A CN105039597B CN 105039597 B CN105039597 B CN 105039597B CN 201510468283 A CN201510468283 A CN 201510468283A CN 105039597 B CN105039597 B CN 105039597B
- Authority
- CN
- China
- Prior art keywords
- sequence
- probe
- primer pair
- influenza
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of kit and its application for being used to detect influenza virus.Contain the primer pair group for being used for detecting influenza virus in kit provided by the present invention, be made up of 4 primer pairs, its sequence is sequence 18 in sequence table.Kit provided by the invention supports high flux, influenza infection can quickly and accurately be detected, for clinic, the testing result that 4 kinds of influenza virus indexs can be obtained in 1 hour is not only faster than the real time fluorescence quantifying PCR method more generally used at present, and also significant for the treatment of quick auxiliary direction and medication.Meanwhile the detection of multi objective can be used for regional epidemiological survey and epidemic situation monitoring, with popularity of the infection in China that study flu virus.
Description
Technical field
The invention belongs to nucleic acid amplification technologies field, is related to a kind of kit and its application for being used to detect influenza virus.
Background technology
Influenza (abbreviation influenza) is ARI caused by influenza virus, has that infectiousness is strong, propagates
Fireballing feature.Its spittle main through the air, interpersonal contact or the contact transmission with contaminated article.
Typically clinical symptoms are：It is anxious to play high fever, significantly overall pain, weak and slight respiratory symptom.General autumn and winter is it
High-incidence season, caused complication and the phenomena of mortality are very serious.The disease is caused by influenza virus, can be divided into first (A), second
(B), antigenic variation often occurs for third (C) three type, influenza A virus, and infectiousness is big, propagates rapidly, and a wide range of stream easily occurs
OK, such as in 1918~1919 years be very popular, the people of the whole world at least 20,000,000~40,000,000 dies from influenza.Influenza B disease
The antigenic variation of poison is smaller, generally only causes the local outburst of influenza.The antigen of influenza virus C is stable, and pathogenicity compared with
It is weak, it is main to invade child and the crowd of hypoimmunity.
Rapid＆Early diagnosis influenza infection can guiding clinical treatment be in time that reasonable selection antiviral antibacterial medicine carries
It is for foundation and significant in terms of abuse of antibiotics is prevented.
The method for detecting common influenza virus at present is more, but all Shortcomings, such as Electronic Speculum detection method complex and expensive, disease
Poison is separately cultured time-consuming extremely length and false negative is more, and generally clinical meaning, ELISA have been lost after cultivation results are taken
Detection is special viral antibody but is once only capable of detecting a kind of virus.And the detection of nucleic acids based on nucleic acid amplification, due to speed
Degree fast (can complete to detect in usual 3 hours), high sensitivity, specificity are good, and goldstandard is increasingly becoming in field of virus detection.
The amplification technique (Nucleic Acid Sequence Based Amplification) of nucleotide sequence is relied on, i.e.,
NASBA amplification techniques, it is to be mediated by pair of primers, be specific in vitro and continuous homogeneous to single stranded RNA progress constant temperature expansion
The process of increasing.Under 41 DEG C of constant temperatures, in terms of reaction speed, template ribonucleic acid can be expanded about 10 by NASBA amplifications 1h9~1012
Times, and common PCR reactions need 2~3h.In terms of detection sensitivity, NASBA, which can be detected, is less than 10gene in solution
Copies/ μ l trace target, and PCR test limit is in 100gene copies/ μ l or so.Therefore, NASBA technologies are either
Amplification efficiency or detection sensitivity are all higher than RT-PCR technology.And because NASBA reaction only needs one 41 DEG C of perseverance
Warm condition, water-bath can meet that reaction requires, it is not necessary to the temperature control device that the Standard PCR such as complicated heating and cooling is relied on, because
The instrument cost of this NASBA technology is very cheap.Combined with corresponding detection technique, NASBA also has easy to operate, specific
Many advantages, such as strong.
The content of the invention
First purpose of the present invention is to provide a kind of primer pair group for being used to detect influenza virus.
The primer pair group provided by the present invention for being used to detect influenza virus, is made up of following 4 primer pairs：
The primer pair 1 being made up of two single strand dnas shown in sequence in sequence table 1 and sequence 2；By sequence in sequence table
The primer pair 2 of two single strand dnas composition shown in row 3 and sequence 4；As two shown in sequence in sequence table 5 and sequence 6
The primer pair 3 of single strand dna composition；Drawn by what two single strand dnas shown in sequence in sequence table 7 and sequence 8 formed
Thing is to 4.
Wherein, the primer pair 1 (InfA_TY) is used to expand influenza A virus；The primer pair 2 (InfA_H1) is used
In amplification influenza A virus H1 hypotypes；The primer pair 3 (InfA_H3) is used to expand influenza A virus H3 hypotypes；It is described
Primer pair 4 (InfB_TY) is used to expand influenza B virus.
Second object of the present invention is to provide a kind of complete single stranded DNA for being used to detect influenza virus.
The complete single stranded DNA provided by the present invention for being used to detect influenza virus, by probe groups and the primer pair group group
Into；The probe groups are made up of following 4 ssDNA probes：SsDNA probe 1 in sequence table shown in sequence 9；Sequence table
SsDNA probe 2 shown in middle sequence 10；SsDNA probe 3 in sequence table shown in sequence 11；The institute of sequence 12 in sequence table
The ssDNA probe 4 shown.
Wherein, the ssDNA probe 1 (InfA_TY_MB) is used for the amplification for monitoring the primer pair 1 in real time；Institute
State the amplification that ssDNA probe 2 (InfA_H1_MB) is used to monitor the primer pair 2 in real time；The ssDNA probe 3
(InfA_H3_MB) it is used for the amplification for monitoring the primer pair 3 in real time；The ssDNA probe 4 (InfB_TY_MB) is used
In the amplification for monitoring the primer pair 4 in real time.
5 ' the ends mark of every ssDNA probe in the probe groups has FAM, and 3 ' ends mark
There is fluorescent quenching group TAMRA.
In the complete single stranded DNA provided by the present invention, each primer pair and its corresponding ssDNA probe can be single
Solely it is packaged in a packaging.As the primer pair 1 and the ssDNA probe 1 are packaged in first packaging；The primer
2 and the ssDNA probe 2 are packaged in second packaging；The primer pair 3 and the ssDNA probe 3 are packaged in
In three packagings；；The primer pair 4 and the ssDNA probe 4 are packaged in the 4th packaging.
Third object of the present invention is to provide a kind of kit for being used to detect influenza virus.
The kit provided by the present invention for being used to detect influenza virus, contains the primer pair group or described complete single-stranded
DNA。
The kit can also contain internal reference primer pair and internal reference probe.The internal reference primer pair is for expanding
House-keeping gene GAPDH mRNA primer pair GAPD_IC in human genome, as two shown in sequence in sequence table 13 and sequence 14
Bar single strand dna forms.The internal reference probe (GAPD_IC_MB) is that the single stranded DNA in sequence table shown in sequence 15 is visited
Pin, for monitoring the amplification of the internal reference primer pair (GAPD_IC) in real time.
5 ' ends of the internal reference probe are marked with fluorescent reporter group FAM, and 3 ' ends are marked with fluorescent quenching group
TAMRA。
Constant-temperature amplification buffer solution and constant-temperature amplification enzyme solutions can also be contained in the kit.
The solvent of the constant-temperature amplification buffer solution is water, and solute and concentration are as follows：200mM pH 8.0 Tris-HCL,
50mM DTT, 10mM dNTP, 10mM rNTP, 80mM MgCl2, 450mM KCl, 15% volumn concentration DMSO, 1M sorb
Alcohol, 20mM tetramethyl ammonium chlorides.
The solvent of the constant-temperature amplification enzyme solutions is water, and solute and concentration are as follows：AMV reverse transcriptase 1U/ μ l, T7 RNA gather
Synthase 5U/ μ l, ribonuclease H 0.5U/ μ l, the μ g/ μ l of pyrophosphatase 0.5U/ μ l, RNase inhibitor 5U/ μ l, BSA 0.5.
Dish-style chip can also be contained in the kit, such as 24 reaction chamber butterfly chips.
In the present invention, the 24 reaction chamber dish-style chip is " the brilliant core of Capitalbio Corporation Co., Ltd.'s production
The supporting dish-style chip of RTisochipTM-A constant-temperature amplification micro-fluidic chips nucleic acids instrument ", its model 1 × 24.
The 1# of the dish-style chip deposits dry following (1)-(6) to 6# reaction chambers respectively：
(1) primer pair 1 and the ssDNA probe 1；(2) primer pair 2 and the ssDNA probe 2；(3)
The primer pair 3 and the ssDNA probe 3；(4) primer pair 4 and the ssDNA probe 4；(5) internal reference
Primer pair and the internal reference probe；(6) negative controls.
The negative controls concretely water without RNase (Rnase-free water).
Wherein, the method for primer and probe being embedded into dish-style chip is：By primer, the spy corresponding with the primer
Pin, agarose mixing, are configured to mixed solution, make the primer, the probe and the agarose in the mixed solution
Final concentration be respectively 0.2 μM, 50nM, 0.1% (weight/mass percentage composition)；Mixed solution described in 1 μ l is taken to click and enter corresponding dish-style
Chip reaction chamber, after being dried in clean super-clean bench, tabletting encapsulation, punching press is made after vacuumizing.
The non-diagnostic mesh of the primer pair group or complete single stranded DNA or kit in detecting or aiding in detection influenza virus
Application fall within protection scope of the present invention.
In the application, by constant-temperature amplification enzyme solutions described in constant-temperature amplification buffer solution described in 15 μ l and 10 μ l, with 25 μ l
It is injected into after the mixing of sample to be tested solution in the dish-style chip, isothermal reaction 1h at 41 DEG C.
In the application, sample to be tested can be used as using Nasopharyngeal swabs；Accordingly, the sample to be tested solution can be from nose
The RNA extracted in throat swab.
In the present invention, the influenza virus is concretely at least one of following：Influenza A virus, Flu-A
Viral H1 hypotypes, influenza A virus H3 hypotypes and influenza B virus.
Kit provided by the invention supports high flux, can quickly and accurately detect influenza infection, for clinical
Speech, can be obtained in 1 hour 4 kinds of influenza virus indexs testing result be not only faster than it is current more generally use it is real-time glimmering
Fluorescent Quantitative PCR method, and it is also significant for the treatment of quick auxiliary direction and medication.Meanwhile the detection of multi objective
Regional epidemiological survey and epidemic situation monitoring are can be used for, with popularity of the infection in China that study flu virus.
Brief description of the drawings
Fig. 1 is dish-style chip and primer sample application cavity schematic diagram.
Fig. 2 is 4 kinds of influenza virus reference material dish-style chip testing result figures.Wherein, A is to contain influenza A virus MP targets
Mark testing results of the recombinant plasmid pUC19-InfA in 1# reaction chambers of gene；B is to contain influenza A virus H1 hypotype targets
Testing results of the recombinant plasmid pUC19-InfA_H1 of gene in 2# reaction chambers；C is to contain influenza A virus H3 hypotype targets
Testing results of the recombinant plasmid pUC19-InfA_H3 of gene in 3# reaction chambers；D is to contain influenza B virus MP target genes
Recombinant plasmid pUC19-InfB 4# reaction chambers testing result.In A-D, E1 represents that template is 101Copy/μ l, with such
Push away, E5 represents that template is 105Copy/μ l；NC represents negative control.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material used, reagent etc., unless otherwise specified, are commercially obtained in following embodiments.
The preparation and its use of embodiment 1, kit for detecting influenza virus
First, for the preparation for the kit for detecting influenza virus
Kit forms provided by the present invention for detecting influenza virus are as follows：
1st, constant-temperature amplification buffer solution
The solvent of constant-temperature amplification buffer solution is water, and solute and concentration are as follows：200mM Tris-HCL (pH 8.0), 50mM
DTT, 10mM dNTP, 10mM rNTP, 80mM MgCl2, 450mM KCl, 15% volumn concentration DMSO, 1M sorbierite,
20mM tetramethyl ammonium chlorides.
2nd, constant-temperature amplification enzyme solutions
The solvent of constant-temperature amplification enzyme solutions is water, and solute and concentration are as follows：AMV reverse transcriptase 1U/ μ l, T7 RNA polymerases
5U/ μ l, ribonuclease H 0.5U/ μ l, the μ g/ μ l of pyrophosphatase 0.5U/ μ l, RNase inhibitor 5U/ μ l, BSA 0.5.
3rd, 24 reaction chamber dish-style chips of primer pair and ssDNA probe are mounted with
The 24 reaction chamber dish-style chip is " the brilliant core RTisochipTM-A perseverances of Capitalbio Corporation Co., Ltd.'s production
The supporting dish-style chip of temperature amplification micro-fluidic chip nucleic acids instrument ", its model 1 × 24, schematic diagram is as shown in Figure 1.
The 1# of the 24 reaction chamber dish-style chip deposits dry following (1)-(6) to 6# reaction chambers respectively：
(1) primer pair 1 and ssDNA probe 1；(2) primer pair 2 and ssDNA probe 2；(3) primer pair 3 and single stranded DNA
Probe 3；(4) primer pair 4 and the DNA probe 4；(5) internal reference primer pair and internal reference probe；(6) negative controls.It is described
Negative controls are specially the water (Rnase-free water) without RNase.
Wherein, the primer pair 1 (InfA_TY) is used to expand influenza A virus, by sequence in sequence table 1 and sequence 2
Shown two single strand dnas composition；The primer pair 2 (InfA_H1) is used to expand influenza A virus H1 hypotypes, by sequence
Sequence 3 and two single strand dnas composition shown in sequence 4 in list；The primer pair 3 (InfA_H3) is used to expand A type
Influenza virus H3 hypotypes, it is made up of two single strand dnas shown in sequence in sequence table 5 and sequence 6；The primer pair 4
(InfB_TY) it is used to expand influenza B virus, as two single strand dna groups shown in sequence in sequence table 7 and sequence 8
Into.The internal reference primer pair (GAPD_IC) is used to expand house-keeping gene GAPDH mRNA in human genome, by sequence in sequence table
Two single strand dnas composition shown in row 13 and sequence 14.
The ssDNA probe 1 (InfA_TY_MB) is used for the amplification for monitoring the primer pair 1 in real time, its nucleosides
Acid sequence is sequence 9 in sequence table；The ssDNA probe 2 (InfA_H1_MB) is used for the expansion for monitoring the primer pair 2 in real time
Increase result, its nucleotides sequence is classified as sequence 10 in sequence table；The ssDNA probe 3 (InfA_H3_MB) is used to monitor in real time
The amplification of the primer pair 3, its nucleotides sequence are classified as sequence 11 in sequence table；(the InfB_TY_ of ssDNA probe 4
MB) it is used for the amplification for monitoring the primer pair 4 in real time, its nucleotides sequence is classified as sequence 12 in sequence table.The internal reference
Probe (GAPD_IC_MB) is used for the amplification for monitoring the internal reference primer pair (GAPD_IC) in real time, its nucleotide sequence
For sequence in sequence table 15.5 ' ends of every ssDNA probe and the internal reference probe (GAPD_IC_MB) are marked
Note has fluorescent reporter group FAM, and 3 ' ends mark has TAMRA.
Wherein, the method for primer and probe being embedded into dish-style chip is：By primer, the spy corresponding with the primer
Pin, agarose mixing, are configured to mixed solution, make the primer, the probe and the agarose in the mixed solution
Final concentration be respectively 0.2 μM, 50nM, 0.1% (weight/mass percentage composition)；Mixed solution described in 1 μ l is taken to click and enter corresponding dish-style
Chip reaction chamber, after being dried in clean super-clean bench, tabletting encapsulation, punching press is made after vacuumizing.
2nd, for the application method for the kit for detecting influenza virus
1st, reaction system is prepared
15 μ l constant-temperature amplifications buffer solutions (see step 1 1), 10 μ l constant-temperature amplifications enzyme solutions (see step 1 2), 25 μ l are taken to treat
This liquid of test sample is mixed into 50 μ l reaction solutions, after vortex concussion uniformly injection be mounted with primer pair and the 24 of ssDNA probe anti-
Chamber dish-style chip (see step 1 3) is answered, seals Quick spin 30s after membrana oralis.
2nd, isothermal amplification reactions and detection
Dish-style chip is placed in rich Isochip-RT constant-temperature amplifications instrument difficult to understand, sets 41 DEG C to react 1 hour, and complete simultaneously
Real-time fluorescence scans.
3rd, result judges
After reaction terminates, the sample to be tested liquid is determined according to the amplification curve of sample in each reaction chamber as follows
In whether contain corresponding influenza virus genome：If the testing sample produces S type amplification curves, the sample to be tested
Contain the genome of corresponding influenza virus in liquid；Conversely, the gene of corresponding influenza virus is not contained in the sample to be tested liquid then
Group.
Embodiment 2, the analysis of the sensitivity and specificity of kit for detecting influenza virus
First, the preparation of reference material RNA nucleic acid
1st, structure includes the plasmid of influenza virus target gene
(1) plasmid containing influenza A virus NP target genes
By 1~1541 section (the influenza A virus MP target gene sequences of influenza A virus NP target gene sequences
Genbank Sequence ID:Gb | KM366530.1 |, Update Date：2014-9-27) it is inserted into pUC19 carriers
Between the multiple cloning sites EcoR V of (day is with biochemical corp's product), recombinant plasmid pUC19-InfA is obtained.
(2) plasmid containing influenza A virus H1 hypotype target genes
By 1~1698 section (the influenza A virus H1 hypotype targets of influenza A virus H1 hypotype target gene sequences
The Genbank Sequence ID of gene order:Gb | GQ475727.1 |, Update Date：2009-8-19) it is inserted into
Between pUC19 carriers (day is with biochemical corp's product) EcoR V, recombinant plasmid pUC19-InfA_H1 is obtained.
(3) plasmid containing influenza A virus H3 hypotype target genes
By 1~1701 section (the influenza A virus H3 hypotype targets of influenza A virus H3 hypotype target gene sequences
The Genbank Sequence ID of gene order:Gb | KJ567658.1 |, Update Date：2014-4-6) it is inserted into
Between the multiple cloning sites EcoR V of pUC19 carriers (day is with biochemical corp's product), recombinant plasmid pUC19-InfA_H3 is obtained.
(4) plasmid containing influenza B virus MP target genes
By 2~1100 sections (the influenza B virus MP target gene sequences of influenza B virus MP target gene sequences
Genbank Sequence ID:Gb | EU305617.1 |, Update Date：2007-12-5) it is inserted into pUC19 carriers
Between the multiple cloning sites EcoR V of (day is with biochemical corp's product), recombinant plasmid pUC19-InfB is obtained.
2nd, the preparation of reference material RNA nucleic acid
For trying recombinant plasmid：4 kinds of recombinant plasmids for containing corresponding influenza virus target gene that step 1 is built.
(1) digestion：First 37 DEG C of digestion 2h of EcoRI restriction endonucleases are used by each for examination recombinant plasmid.
(2) transcribe：By 5 μ l 5 × Transcription Optimized Buffer (Promega), 2U T7 RNA gather
Synthase, 10mM DTT (Promega), 10U recombinant RNAs enzyme inhibitor (Promega), 2mM rNTP, the μ l of digestion products 5 prepare total
Volume is 50 μ l reaction system, 37 DEG C of transcription 4h after shaking uniformly.
(3) digest：System after the completion of transcription is added to 1 μ l DNA digestive ferments (rDnaseI, 5U/ μ l), concussion centrifuges,
37 DEG C of incubation 20min.
(4) purify：Using the RNA purification kits products of Macherey-Nagel companies, (its catalog number is
740948) transcription product RNA is purified as follows：A) RA1-C is prepared2H5OH mixed liquors：With RA1:C2H5OH=1:1 (volume
Than) ratio prepare., it is necessary to add 600 μ l RA1-C in every 100 μ l transcription product2H5OH mixed liquors, i.e. 300 μ l RA1+
300μl C2H5OH solution, need to calculate the volume for matching somebody with somebody mixed liquor according to the pipe number of transcription product herein.If product is insufficient
100 μ l, then the amount of product is mended to 100 μ l with water and (50 μ l Tiangeng Rnase-free H are added in every pipe product2O)。
B) the ready RA1-C by before2H5OH mixed liquors are assigned in 1.5ml centrifuge tubes, two pipes, often the μ l of pipe 600, and 100 μ l products are turned
Enter into corresponding centrifuge tube, totally 700 μ l, fully shaking centrifuge in pipe.C) prepare two adsorption columns, and carry out corresponding mark
Note, 700 μ l product mixtures are transferred in adsorption column (adsorption column maximum capacity is 700 μ l), 1.2 ten thousand rpm centrifugation 2min, are fallen
Fall down a layer solution.D) 700 μ l RA3 is added in adsorption column, 1min is placed, it is sufficiently dispersed in the bottom of adsorption column
Portion, 1.2 ten thousand rpm centrifugation 2min, outwells lower floor's solution.E) 350 μ l RA3 is added in adsorption column, places 2min, 1.2 ten thousand rpm
2min is centrifuged, outwells lower floor's solution.F) 300 μ l RA3 is added in adsorption column, 2min is placed, 1.2 ten thousand rpm centrifugation 2min, falls
Fall down a layer solution.G) after the lid 3min for opening adsorption column, 1.2 ten thousand rpm skies outwell lower floor's solution, repeat this step from 2min
Once.H) it is empty from end after, adsorption column is transferred in corresponding centrifuge tube, opens adsorption column lid and place 15min, make
Ethanol volatilization is complete, and 60 μ l Rnase-H are added in adsorption column2O (carries) elution in kit, place 2min, and 1.2 ten thousand
Rpm centrifuges 2min.I) centrifugation gained template is sucked back in adsorption column, places 2min, 1.2 ten thousand rpm centrifugation 2min, repeat this step
Twice.J) adsorption column is lost, the template in centrifuge tube is taken out into 2 μ l, determines its concentration with Nano drop, and record its concentration
And its 260/280,260/230 ratio.
2nd, for the sensitivity and specificity analysis for the kit for detecting influenza virus
1st, prepared by the reference material template of various concentrations
It is fixed that each RNA templates (the 4 kinds of recombinant plasmids built in corresponding step 1 1) of above-mentioned steps one after purification are calculated
Measure to 1010Copy/μ l, and gradient dilution, obtain 105Copy/μ l, 104Copy/μ l, 103Copy/μ l, 102Copy/μ l, 10 are copied
The template dilution of the various concentrations such as shellfish/μ l.
2nd, reaction system is prepared
15 μ l constant-temperature amplifications buffer solutions are taken (see the step 1) of embodiment 1,10 μ l constant-temperature amplifications enzyme solutions (see the step of embodiment 1
2), the template dilution of 25 μ l concentration is mixed into 50 μ l reaction solutions, after vortex concussion uniformly injection be mounted with primer pair and
24 reaction chamber dish-style chips of ssDNA probe (see the step 3) of embodiment 1, seal Quick spin 30s after membrana oralis.
3rd, isothermal amplification reactions and detection
Dish-style chip is placed in rich Isochip-RT constant-temperature amplifications instrument difficult to understand, sets 41 DEG C to react 1 hour, and complete simultaneously
Real-time fluorescence scans.And result is judged according to the method for the step 23 of embodiment 1.
3rd, result
As a result it is as shown in Figure 2：
(1) for recombinant plasmid pUC19-InfA RNA sample, the 1# reaction chambers pair of 24 reaction chamber dish-style chips
105Copy/μ l, 104Copy/μ l, 103Copy/μ l, 102The testing result of copy/μ l, 10 copies/μ l templates has obvious S
Type amplification curve, it is shown as positive；And 2#-4# reaction chambers are shown as negative without amplification curve.
(2) for recombinant plasmid pUC19-InfA H1 RNA sample, the 2# reaction chambers of 24 reaction chamber dish-style chips
To 105Copy/μ l, 104Copy/μ l, 103Copy/μ l, 102The testing result of copy/μ l, 10 copies/μ l templates has substantially
S type amplification curves, be shown as positive；And 1#, 3#, 4# reaction chamber are shown as negative without amplification curve.
(3) for recombinant plasmid pUC19-InfA_H3 RNA sample, the 3# reaction chambers of 24 reaction chamber dish-style chips
To 105Copy/μ l, 104Copy/μ l, 103Copy/μ l, 102The testing result of copy/μ l, 10 copies/μ l templates has substantially
S type amplification curves, be shown as positive；And 1#, 2# and 4# reaction chamber are shown as negative without amplification curve.
(4) for recombinant plasmid pUC19-InfB RNA sample, the 4# reaction chambers pair of 24 reaction chamber dish-style chips
105Copy/μ l, 104Copy/μ l, 103Copy/μ l, 102The testing result of copy/μ l, 10 copies/μ l templates has obvious S
Type amplification curve, it is shown as positive；And 1#-3# reaction chambers are shown as negative without amplification curve.
In addition, for the RNA sample of 4 kinds of all recombinant plasmids, the 5# reaction chambers of 24 reaction chamber dish-style chips are (interior
Control) and 6# reaction chambers (negative control) without amplification curve.5# reaction chambers (internal reference) why without amplification curve be because
Sample to be tested is the RNA nucleic acid of 4 kinds of recombinant plasmids, does not contain the RNA of house-keeping gene GAPDH in human genome.
It these results suggest that the kit has higher amplification sensitivity and specific amplification.
The detection of embodiment 3, actual clinical sample
First, clinical sample type
The present embodiment use clinical sample from Shenzhen San Yuan in collection Nasopharyngeal swabs sample (in line with this picker from
The principle of hope), adopt swab and deposit in 3mL physiological saline, totally 560.
2nd, in clinical sample viral nucleic acid extraction
Clinical sample viral nucleic acid extraction kit used is QIAamp Viral RNA Mini Kit (Qiagen),
Extracted as follows：
(1) take and the μ l of physiological saline 140 of clinical sample swab are deposited in step 1 in 1.5ml centrifuge tubes；
(2) Buffer AVL (the i.e. 5.6 μ l Carrier RNA mixing that 560 μ l contain Carrier RNA mixed liquors is added
The μ l Buffer of liquid+560 AVL are in centrifuge tube, slight whirlpool 15s；
(3) after the completion of brief centrifugation, (15-25 DEG C) placement 10-20min of room temperature, to ensure Buffer AVL in centrifuge tube
In have abundance time cracked；
(4) 560 μ l ethanol (96-100%, volumn concentration) are added in centrifuge tube, whirlpool mixes 15s, centrifugation；
(5) 630 μ l sample solutions are taken in adsorption column, 2min is placed, it is fully contacted with adsorption column, 8000rpm, from
Heart 1min, change clean collecting pipe；
(6) if sample solution is more than 630 μ l, repeatedly previous step；
(7) 500 μ l AW1 washing lotions are added in adsorption column, 2min is placed, it is fully contacted with adsorption column, 8000rpm
1min is centrifuged, changes clean collecting pipe；
(8) 500 μ l AW2 washing lotions are added in adsorption column, 2min is placed, it is fully contacted with adsorption column,
12000rpm centrifuges 3min, changes clean collecting pipe；
(9) 300 μ l AW2 washing lotions are added in adsorption column, 2min is placed, it is fully contacted with adsorption column,
12000rpm centrifuges 3min, changes clean collecting pipe；
(10) adsorption column lid is opened and places 2min, make that its inside and outside pressure is consistent, and 8000rpm skies are from 1min.It is empty from knot
Shu Yihou, repeat this step once.
(11) it is empty from end after, adsorption column is transferred in 1.5ml centrifuge tubes, open adsorption column lid, place 20-30min,
Make ethanol volatilization complete；
(12) 50 μ l Buffer AVE elution nucleic acid, 8000rpm centrifugation 1min, after centrifugation is completed, by under elution are added
Nucleic acid suck back adsorption column, lose adsorption column after centrifuging 1min.
3rd, the detection of actual clinical sample
1st, reaction system is prepared
15 μ l constant-temperature amplifications buffer solutions (see the step 11 of embodiment 1), 10 μ l constant-temperature amplifications enzyme solutions are taken (see the step of embodiment 1
Rapid 1 2), the clinical sample solution that 25 μ l step 2 are extracted to obtain is mixed into 50 μ l reaction solutions, is injected after vortex concussion uniformly
It is mounted with the 24 reaction chamber dish-style chips (see the step 13 of embodiment 1) of primer pair and ssDNA probe, seals rapid after membrana oralis
Centrifuge 30s.
2nd, isothermal amplification reactions and detection
Dish-style chip is placed in rich Isochip-RT constant-temperature amplifications instrument difficult to understand, sets 41 DEG C to react 1 hour, and complete simultaneously
Real-time fluorescence scans.And result is judged according to the method for the step 23 of embodiment 1.
Experiment sets reliability demonstration of the conventional RT-PCR method for kit testing result of the present invention simultaneously.For examining
It is as shown in table 1 to survey each viral specific RT-PCR primer sequence.
Table 1 is used for the specific RT-PCR primer sequence for detecting 4 kinds of influenza viruses
| Index name | RT-PCR sense primers (5 ' -3 ') | RT-PCR anti-sense primers (5 ' -3 ') |
| Influenza A virus | CTTGTCTTTAGCCAYTCCATGAGAGC | CTAACCGAGGTCGAAACGTAYGTTCT |
| Influenza A virus H1 hypotypes | CATCTAYCATTCCAGTCCACCCCCCT | ACCCCAGAAATAGCHAAAAGACCCAA |
| Influenza A virus H3 hypotypes | GTGCTITTAATCAAAAGTATGTCTCCCG | CACAGTITCTACCAAAAGAAGCCAAC |
| Influenza B virus | TTCAGGTACATGACCATGAGACARTA | TYGGTGGGAAAGAATTTGACCTAGAC |
4th, result
The testing result of kit of the present invention is shown, for each influenza virus, is detected using RT-PCR method positive
Sample example using kit of the present invention detection show positive findings.In addition, for a few sample example, using RT-PCR
Method detection is negative, but uses kit testing result of the present invention as the positive.By carrying out later stage resampling to these sample examples
RT-PCR is detected, it is found that it is positive these sample examples are detected as corresponding influenza virus really.Indicated above, kit of the present invention is to phase
The recall rate of influenza virus is answered to be higher than RT-PCR methods, and its testing result is accurately and reliably.Kit and RT-PCR method inspection of the present invention
The statistical result of flow measurement Influenza Virus clinical sample is referring to table 2.
The statistical result of 2 kit of the present invention of table and RT-PCR methods detection influenza virus clinical sample
Claims (3)
1. the kit for detecting influenza virus, contains probe groups and primer pair group；
The primer pair group, it is made up of following 4 primer pairs：
Sequence 1 and the primer pair 1 shown in sequence 2 in sequence table；
Sequence 3 and the primer pair 2 shown in sequence 4 in sequence table；
Sequence 5 and the primer pair 3 shown in sequence 6 in sequence table；
Sequence 7 and the primer pair 4 shown in sequence 8 in sequence table；
The probe groups are made up of following 4 probes：Probe 1 in sequence table shown in sequence 9；In sequence table shown in sequence 10
Probe 2；Probe 3 in sequence table shown in sequence 11；Probe 4 in sequence table shown in sequence 12；
5 ' the ends mark of each probe in the probe groups has FAM, and 3 ' ends mark has
Group TAMRA；
The kit also contains internal reference primer pair and internal reference probe；Sequence 13 in the internal reference primer pair such as sequence table
Shown in sequence 14；The internal reference probe is the probe shown in sequence 15 in sequence table；5 ' end marks of the internal reference probe
Note has fluorescent reporter group FAM, and 3 ' ends are marked with fluorescent quenching group TAMRA；
Also contain dish-style chip in the kit；
The 1# of the dish-style chip deposits dry as follows respectively to 6# reaction chambers（1）-（6）：
（1）The primer pair 1 and the probe 1；
（2）The primer pair 2 and the probe 2；
（3）The primer pair 3 and the probe 3；
（4）The primer pair 4 and the probe 4；
（5）The internal reference primer pair and the internal reference probe；
（6）Negative controls；
The dish-style chip is 24 reaction chamber dish-style chips.
2. kit according to claim 1, it is characterised in that：In the kit also containing constant-temperature amplification buffer solution and
Constant-temperature amplification enzyme solutions；
The solvent of the constant-temperature amplification buffer solution is water, and solute and concentration are as follows：200mM pH 8.0 Tris-HCL, 50mM
DTT, 10mM dNTP, 10mM rNTP, 80mM MgCl2, 450mM KCl, 15% volumn concentration DMSO, 1M sorbierite,
20mM tetramethyl ammonium chlorides；
The solvent of the constant-temperature amplification enzyme solutions is water, and solute and concentration are as follows：AMV reverse transcriptase 1U/ μ l, T7 RNA polymerize
Enzyme 5U/ μ l, ribonuclease H 0.5U/ μ l, the μ g/ μ l of pyrophosphatase 0.5U/ μ l, RNase inhibitor 5U/ μ l, BSA 0.5.
3. kit according to claim 1 or 2, it is characterised in that：The influenza virus is at least one of following：
Influenza A virus, influenza A virus H1 hypotypes, influenza A virus H3 hypotypes and influenza B virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510468283.7A CN105039597B (en) | 2015-08-03 | 2015-08-03 | A kind of kit and its application for being used to detect influenza virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510468283.7A CN105039597B (en) | 2015-08-03 | 2015-08-03 | A kind of kit and its application for being used to detect influenza virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105039597A CN105039597A (en) | 2015-11-11 |
| CN105039597B true CN105039597B (en) | 2017-11-10 |
Family
ID=54446563
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510468283.7A Active CN105039597B (en) | 2015-08-03 | 2015-08-03 | A kind of kit and its application for being used to detect influenza virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039597B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591494A (en) * | 2016-12-30 | 2017-04-26 | 博奥生物集团有限公司 | Primer combination for identifying influenza A viruses and application of such primer combination |
| CN107034310A (en) * | 2017-01-24 | 2017-08-11 | 南方医科大学 | It is a kind of while detecting the primer sets of a variety of influenza viruses, probe groups and its kit |
| CN109207640B (en) * | 2018-10-23 | 2023-06-02 | 深圳市亿立方生物技术有限公司 | Primer group, probe group and kit for detecting various respiratory viruses and application of primer group, probe group and kit |
| CN110468238A (en) * | 2019-09-11 | 2019-11-19 | 深圳市芯思微生物科技有限公司 | A kind of primed probe group, kit and the application of constant-temperature amplification detection A type and influenza B virus |
| CN111004867B (en) * | 2020-01-03 | 2020-12-18 | 牡丹江医学院 | Influenza A virus detection primer, probe and kit thereof |
| CN111551706B (en) * | 2020-04-29 | 2023-04-07 | 成都微康生物科技有限公司 | Disc-type immunodetection method for one-time sample-adding multi-item joint inspection |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1310565A1 (en) * | 2001-11-09 | 2003-05-14 | Hong Kong DNA Chips Limited | A process for detecting nucleic acid target molecules using an enzyme-linked probe capture assay and a kit therefor |
| CN101603096A (en) * | 2009-05-04 | 2009-12-16 | 北京海康基因芯片开发有限公司 | A kind of method and test kit that detects infectious disease pathogens |
| CN102965451A (en) * | 2012-09-25 | 2013-03-13 | 珠海国际旅行卫生保健中心 | Group A rotavirus real-time isothermal amplification detection kit, primers and probe thereof |
| CN103831140A (en) * | 2014-03-07 | 2014-06-04 | 博奥生物集团有限公司 | Micro-fluidic chip for multi-index detection |
-
2015
- 2015-08-03 CN CN201510468283.7A patent/CN105039597B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1310565A1 (en) * | 2001-11-09 | 2003-05-14 | Hong Kong DNA Chips Limited | A process for detecting nucleic acid target molecules using an enzyme-linked probe capture assay and a kit therefor |
| CN101603096A (en) * | 2009-05-04 | 2009-12-16 | 北京海康基因芯片开发有限公司 | A kind of method and test kit that detects infectious disease pathogens |
| CN102965451A (en) * | 2012-09-25 | 2013-03-13 | 珠海国际旅行卫生保健中心 | Group A rotavirus real-time isothermal amplification detection kit, primers and probe thereof |
| CN103831140A (en) * | 2014-03-07 | 2014-06-04 | 博奥生物集团有限公司 | Micro-fluidic chip for multi-index detection |
Non-Patent Citations (2)
| Title |
|---|
| Development and Evaluation of a Real-Time Nucleic Acid Sequence Based Amplification Assay for Rapid Detection of Influenza A;Catherine Moore，et al;《Journal of Medical Virology》;20041231;第74卷;145-155 * |
| Pyrosequencing on templates generated by asymmetric nucleic acid sequence-based amplification (asymmetric-NASBA);Huning Jia,et al;《Analyst》;20111231;第136卷;5229–5233 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105039597A (en) | 2015-11-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105018648B (en) | A kind of kit and its application for being used to detect Respirovirus | |
| CN105112559B (en) | A kind of kit and its application for being used to detect coronavirus | |
| CN105039597B (en) | A kind of kit and its application for being used to detect influenza virus | |
| CN102732638B (en) | Method for single-tube multiplex fluorescent polymerase chain reaction (PCR) detection of human coronavirus OC43, 229E, NL63, HKU1 and SARS, and primers, probes and kit adopted by the method | |
| CN109576352A (en) | Single tube detects method, probe and its kit of multiple object to be measured nucleic acid sequences | |
| CN105400907A (en) | Kit for nucleic acid combined detection of influenza virus A, influenza virus B and respiratory syncytial virus | |
| CN101942525B (en) | One-tube method with multiplex detection for human Influenza A and B and new Influenza A H1N1 virus and kit | |
| CN103602757B (en) | The foundation of foot and mouth disease, vesicular stomatitis and swine pox multi-fluorescence RT-PCR detection method and application thereof | |
| CN107058623A (en) | A kind of High sensitivity and special blood HBV pgRNA fluorescence quantitative PCR detections systems and detection method | |
| CN101886138A (en) | Three-color fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) combined detection method of enterovirus 71, Coxsackie virus A16 and other subtypes of enterovirus as well as kit thereof | |
| CN106521032A (en) | Nucleic acid amplification technology and application thereof in detection of mosquito-borne viruses | |
| CN103614489B (en) | Constant-temperature amplification detection kit for dengue viruses and detection method | |
| CN105018488B (en) | Kit and its application for detecting Respirovirus | |
| CN111394513A (en) | Fluorescent quantitative PCR detection method for novel coronavirus SARS-CoV-2 and application thereof | |
| CN101948931A (en) | Single-tube multiplex fluorescence PCR (Polymerase Chain Reaction) detection method and kit for 1,2,3-type parainfluenza viruses | |
| CN106086236A (en) | Detect test kit and the method for influenza virus H1, H3, H5, H7 simultaneously | |
| CN105112407B (en) | A kind of kit and its application for being used to detect enterovirus | |
| CN103966356A (en) | Human immunodeficiency virus type 1 one-step fluorescence quantitative RT-PCR detection kit | |
| CN102367488B (en) | Enterovirus triple real-time fluorescent quantitative RT-PCR detection kit | |
| CN107988436A (en) | A kind of PCR system and detection method for detecting pig virus Reproduction Disorder | |
| CN105112558B (en) | The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I | |
| CN105039596B (en) | A kind of kit and its application for being used to detect parainfluenza virus | |
| CN103146846A (en) | Single standard product-based four-color fluorogenic quantitative PCR (Polymerase Chain Reaction) method and kit | |
| CN108411014A (en) | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida | |
| CN108060272A (en) | A kind of quick differentiation pig Delta coronavirus and the multiple PCR detection primer group and kit of pig ridge virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |