CN106521032A

CN106521032A - Nucleic acid amplification technology and application thereof in detection of mosquito-borne viruses

Info

Publication number: CN106521032A
Application number: CN201611089150.XA
Authority: CN
Inventors: 张岩; 盖伟; 邢婉丽; 宋翠丹; 程京
Original assignee: CapitalBio Corp
Current assignee: CapitalBio Corp
Priority date: 2016-11-30
Filing date: 2016-11-30
Publication date: 2017-03-22
Anticipated expiration: 2036-11-30
Also published as: CN106521032B

Abstract

The invention discloses a nucleic acid amplification technology and an application thereof in detection of mosquito-borne viruses. The invention provides a method for detecting whether n kinds of target RNA sequences are contained in a sample to be detected or not. The method sequentially comprises the following steps: 1, extracting the total RNA of the sample to be detected; 2, carrying out reverse transcription recombinase polymerase amplification; and 3, carrying out recombinase polymerase amplification, wherein n is a natural number. The invention also provides a primer probe combination. The combination comprises primers and probes represented by sequence 1 to sequence 18 in a sequence table. A micro-fluidic chip, recombinase polymerase amplification and nucleic acid sequence dependent amplification are combined to effectively solve the problem of detection limit reduction of the micro-fluidic chip. The invention further provides a kit used for detecting the mosquito-borne viruses. The kit can simultaneously complete detection of six varieties of the mosquito-borne viruses one time, and has the advantages of high sensitivity, good specificity, fastness, good convenience, and wide application values.

Description

A kind of nucleic acid amplification technologies and its application in carapuru virus detection

Technical field

The present invention relates to a kind of nucleic acid amplification technologies and its application in carapuru virus detection.

Background technology

Polymerase chain reaction (Polymerase Chain Reaction, PCR) is the most frequently used one of current detection of nucleic acids Detection technique is planted, its testing result is accurate, specificity is high, reproducible.Multiplex PCR is the one kind developed on the basis of PCR The technology of multiple target genes is detected simultaneously can, at least two pairs or more primer in general multi-PRC reaction system, Multiple nucleic acid fragments can be amplified simultaneously in primary first-order equation, be mainly used in detection or mirror while multiple pathogenic microorganisms simultaneously It is fixed.But due to there is a plurality of PCR primer in multiplex PCR, easily produce between primer and interfere, tuple is more, the primer for including More, the probability for producing interference from each other is bigger, and designing and developing more difficult this of process becomes the exploitation of multiplex PCR System Design During subject matter.

In order to avoid carry out in same reaction that multi-primerses design causes it is huge design and develop difficulty, using micro-fluidic Multiple reaction in same PCR pipe is reduced to the reaction of the substance in multiple miniature cavities by the physics point chamber technology of chip, and this is big Simplify greatly the primer amplification system development process of multi objective.Microfluidic chip technology, is a kind of by physics point chamber, is realized high The technology of flux detection, can complete the detection of multiple indexs in one-time detection simultaneously, solve multiple PCR primer well and set A difficult problem in meter, micro-fluidic chip need not design multi-primerses, and which has bigger customization degree of freedom, flux enter as needed Row is adjusted.But, although many flux system developments are enormously simplify by the way of physics point chamber, but while also generate one More serious side effect.I.e. multi-cavity causes the shunting for adding sample form, causes its detection sensitivity to be deteriorated, for example, 24 Hole micro-fluidic chip, limited sample form have respectively enterd 24 reaction receptors, and its test limit have dropped 24 times, this to its Application clinically is a test.

Carapuru virus is widely distributed in the whole world, is a kind of important infectious disease pathogens, general to be propagated by mosquito bite, Spread speed is fast.In recent years, constantly there is related carapuru virus Epidemic outbreak of disease all over the world, mainly agree including zika virus, datum hole Refined virus, dengue virus etc..These virus infection, can cause the similar symptoms such as heating, arthralgia, it is difficult to from clinical manifestation It is upper to judge it is that virus infection.Therefore, the detection of nucleic acids of mosquito matchmaker correlated virus is most important.

The content of the invention

It is an object of the invention to provide a kind of nucleic acid amplification technologies and its application in carapuru virus detection.

Present invention firstly provides a kind of primer combination of probe, is following (a1) or (a2) or (a3)：

(a1) by primed probe group I, primed probe group II, primed probe group III, primed probe group IV, primed probe group V Constitute with primed probe group VI；

(a2) by the primed probe group I, the primed probe group II, the primed probe group III, the primed probe Any two, any three, any four or any five in group IV, the primed probe group V and the primed probe group VI Individual composition；

(a3) the primed probe group I, the primed probe group II, the primed probe group III, the primed probe group IVth, the primed probe group V or the primed probe group VI；

The primed probe group I is made up of primer ZIKV-F, primer ZIKV-R and probe ZIKV-P；

The primer ZIKV-F is following (b1) or (b2)；

(b1) single strand dna shown in the sequence 1 of sequence table；

(b2) sequence 1 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 1 The DNA molecular of identical function；

The primer ZIKV-R is following (b3) or (b4)；

(b3) single strand dna shown in the sequence 2 of sequence table；

(b4) sequence 2 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 2 The DNA molecular of identical function；

The nucleotides sequence of the probe ZIKV-P is classified as (b5) as follows or (b6)；

(b5) single strand dna as shown in the sequence 13 of sequence table；

(b6) sequence 13 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 13 There is the DNA molecular of identical function；

The primed probe group II is made up of primer CHIKV-F, primer CHIKV-R and probe CHIKV-P；

The primer CHIKV-F is following (c1) or (c2)；

(c1) single strand dna shown in the sequence 3 of sequence table；

(c2) sequence 3 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 3 The DNA molecular of identical function；

The primer CHIKV-R is following (c3) or (c4)；

(c3) single strand dna shown in the sequence 4 of sequence table；

(c4) sequence 4 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 4 The DNA molecular of identical function；

The nucleotides sequence of the probe CHIKV-P is classified as (c5) as follows or (c6)；

(c5) single strand dna as shown in the sequence 14 of sequence table；

(c6) sequence 14 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 14 There is the DNA molecular of identical function；

The primed probe group III is made up of primer DENV1-F, primer DENV1-R and probe DENV1-P；

The primer DENV1-F is following (d1) or (d2)；

(d1) single strand dna shown in the sequence 5 of sequence table；

(d2) sequence 5 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 5 The DNA molecular of identical function；

The primer DENV1-R is following (d3) or (d4)；

(d3) single strand dna shown in the sequence 6 of sequence table；

(d4) sequence 6 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 6 The DNA molecular of identical function；

The nucleotides sequence of the probe DENV1-P is classified as (d5) as follows or (d6)；

(d5) single strand dna as shown in the sequence 15 of sequence table；

(d6) sequence 15 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 15 There is the DNA molecular of identical function；

The primed probe group IV is made up of primer DENV2-F, primer DENV2-R and probe DENV2-P；

The primer DENV2-F is following (e1) or (e2)；

(e1) single strand dna shown in the sequence 7 of sequence table；

(e2) sequence 7 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 7 The DNA molecular of identical function；

The primer DENV2-R is following (e3) or (e4)；

(e3) single strand dna shown in the sequence 8 of sequence table；

(e4) sequence 8 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 8 The DNA molecular of identical function；

The nucleotides sequence of the probe DENV2-P is classified as (e5) as follows or (e6)；

(e5) single strand dna as shown in the sequence 16 of sequence table；

(e6) sequence 16 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 16 There is the DNA molecular of identical function；

The primed probe group V is made up of primer DENV3-F, primer DENV3-R and probe DENV3-P；

The primer DENV3-F is following (f1) or (f2)；

(f1) single strand dna shown in the sequence 9 of sequence table；

(f2) sequence 9 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 9 The DNA molecular of identical function；

The primer DENV3-R is following (f3) or (f4)；

(f3) single strand dna shown in the sequence 10 of sequence table；

(f4) sequence 10 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 10 There is the DNA molecular of identical function；

The nucleotides sequence of the probe DENV3-P is classified as (f5) as follows or (f6)；

(f5) single strand dna as shown in the sequence 17 of sequence table；

(f6) sequence 17 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 17 There is the DNA molecular of identical function；

The primed probe group VI is made up of primer DENV4-F, primer DENV4-R and probe DENV4-P；

The primer DENV4-F is following (g1) or (g2)；

(g1) single strand dna shown in the sequence 11 of sequence table；

(g2) sequence 11 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 11 There is the DNA molecular of identical function；

The primer DENV4-R is following (g3) or (g4)；

(g3) single strand dna shown in the sequence 12 of sequence table；

(g4) sequence 12 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 12 There is the DNA molecular of identical function；

The nucleotides sequence of the probe DENV4-P is classified as (g5) as follows or (g6)；

(g5) single strand dna as shown in the sequence 18 of sequence table；

(g6) sequence 18 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 18 There is the DNA molecular of identical function.

In probe described in any of the above, 5 ' ends have fluorophor FAM, and 3 ' ends have quenching group BHQ1.

The present invention also protects a kind of special chip, is by described primed probe group I, primed probe group II, primed probe Group III, primed probe group IV, primed probe group V and primed probe group VI are embedded in the differential responses chamber of micro-fluidic chip respectively In obtain；

The function of the special chip is following (h1) or (h2)：

(h1) it is used for identifying zika virus, Chikungunya virus, I type of dengue virus, II type of dengue virus, dengue fever IV type of virus type iii or dengue virus；

(h2) whether zika virus and/or Chikungunya virus and/or Dengue calentura are contained in being used for detecting sample to be tested IV type of malicious I type and/or II type of dengue virus and/or III type of dengue virus and/or dengue virus.

The primer and probe are specifically embedded in reaction tube by encapsulation reagent.The encapsulation reagent is by 3-10 mass parts fine jades Lipolysaccharide, 1-5 mass parts saponin and 2-6 mass parts hydroxypropyl cellulose composition.The encapsulation reagent is specifically by 5 mass parts agar Sugar, 3 mass parts saponin and 4 mass parts HPMC composition.

It is embedded with the preparation method of the micro-fluidic chip of primer and probe：1. will encapsulation reagent, primer, probe and sterilized water Mixing, (in embedding liquid, the concentration for encapsulating reagent is 0.1g/100ml, and the concentration of primer is 0.4 μM, probe to obtain embedding liquid Concentration is 0.2 μM)；2. micro-fluidic chip is taken, 1 μ l embedding liquid in each reaction chamber, is added；3. take that 2. step obtain is micro-fluidic Chip, is placed in clean super-clean bench and dries, then tabletting encapsulation punching press evacuation.

The present invention also protection includes the test kit first of the primer combination of probe.

The present invention also protection includes the test kit second of the micro-fluid chip.

The test kit second is also combined including primer pair；The primer pair is combined by primer pair I, primer pair II, primer pair IIIth, primer pair IV, primer pair V and primer pair VI are constituted；The primer pair I is made up of primer ZIKV-F and primer ZIKV-R；Institute State primer pair II to be made up of primer CHIKV-F and primer CHIKV-R；The primer pair III is by primer DENV1-F and primer DENV1-R is constituted；The primer pair IV is made up of primer DENV2-F and primer DENV2-R；The primer pair V is by primer DENV3-F and primer DENV3-R compositions；The primer pair VI is made up of primer DENV4-F and primer DENV4-R.

The primer pair combination is specifically in the form of primer mixed liquor.Primer mixture liquid by ZIKV-F, ZIKV-R, CHIKV-F、CHIKV-R、DENV1-F、DENV1-R、DENV2-F、DENV2-R、DENV3-F、DENV3-R、DENV4-F、 DENV4-R and sterilized water composition；In primer mixture liquid, the concentration of ZIKV-F is 0.2 μM, the concentration of ZIKV-R is 0.2 μM, The concentration of CHIKV-F is 0.15 μM, the concentration of CHIKV-R is 0.15 μM, the concentration of DENV1-F is 0.2 μM, DENV1-R it is dense Spend the concentration for 0.2 μM, DENV2-F be 0.15 μM, the concentration of DENV2-R be 0.15 μM, the concentration of DENV3-F be 0.3 μM, The concentration of DENV3-R is 0.3 μM, the concentration of DENV4-F is 0.25 μM, the concentration of DENV4-R is 0.25 μM.

The test kit second also includes also including reaction mixture BQ and enzyme mixation EQ.

Reaction mixture BQ：Tris-HCl buffer of the solvent for pH8.0,200mM；Solute and its concentration are as follows：DTT 50mM、MgCl₂80mM, KCl 450mM, DMSO 15% (volumn concentration), Sorbitol 1M, dNTP 2mM, rNTP 4mM。

Enzyme mixation EQ：Solvent is water；Solute and its concentration are as follows：AMV reverse transcriptase 1U/ μ l, t7 rna polymerase 5U/ μ L, ribonuclease H 0.5U/ μ l, pyrophosphatase 0.5U/ μ l, RNase inhibitor 5U/ μ l, BSA 0.5 μ g/ μ l.

The test kit also includes RT-RPA reaction buffers, RT-RPA enzymes mixed powder and 280mM magnesium acetate aqueous solutions.

The test kit also includes RT-RPA reaction buffers, the reaction tube equipped with RT-RPA enzyme mixed powders and 280mM Magnesium acetate aqueous solution.

The present invention also protects the application of the test kit first, is following (h1) or (h2)：

The present invention also protects the application of the test kit second, is following (h1) or (h2)：

Identify that whether virus to be measured be zika virus, Chikungunya virus, I type of dengue virus, step on using test kit second Leather II type of fever virus, IV type of III type of dengue virus or dengue virus method it is as follows：

(1) reaction tube equipped with RT-RPA enzyme mixed powders is taken, 29.5 μ l RT-RPA reaction bufferings are sequentially added Liquid, 5 μ l primer mixed liquors, 10 μ l solution to be measured and 3 μ l water mix homogeneously, are subsequently adding 2.5 μ l 280mM magnesium acetates water-soluble Liquid is starting reaction；Reaction condition：37℃10min；

(2) reaction tube of step (1) is taken into, following enzyme-deactivating process is carried out:80℃2min；12 DEG C, 3min；

(3) product of 12 μ l reaction mixture BQ, 3 μ l enzyme mixations EQ and 10 μ l steps (2), mix homogeneously, injection are taken Enter to be embedded with the micro-fluidic chip of primer and probe, seal Quick spin 30s after membrana oralis；

(4), after completing step (3), the micro-fluidic chip for being embedded with primer and probe is placed in into brilliant core RTisochip- In A constant-temperature amplification micro-fluidic chip nucleic acids instruments, 41 DEG C of reaction 60min simultaneously complete real-time fluorescence scanning simultaneously.

Determine which kind of virus is virus to be measured be as follows according to the amplification curve of sample in each reaction chamber：If bag The amplification curve for being embedded with sample in the reaction chamber of primed probe group I is S type positive amplification curves, and virus to be measured is zika virus； If the amplification curve for being embedded with sample in the reaction chamber of primed probe group II is S type positive amplification curves, virus to be measured is base Agree refined virus in hole；If the amplification curve for being embedded with sample in the reaction chamber of primed probe group III is S type positive amplification curves, treat It is I type of dengue virus to survey virus；If the amplification curve for being embedded with sample in the reaction chamber of primed probe group IV is that S types are positive Amplification curve, virus to be measured are II type of dengue virus；If being embedded with the amplification of sample in the reaction chamber of primed probe group V Curve is S type positive amplification curves, and virus to be measured is III type of dengue virus；If being embedded with the reaction chamber of primed probe group VI The amplification curve of middle sample is S type positive amplification curves, and virus to be measured is IV type of dengue virus.

Detect in sample to be tested whether contain zika virus and/or Chikungunya virus and/or Dengue using test kit second The method of IV type of I type of fever virus and/or II type of dengue virus and/or III type of dengue virus and/or dengue virus is as follows：

According to the amplification curve of sample in each reaction chamber determine as follows sample to be tested contain it is any or which Plant virus：If the amplification curve for being embedded with sample in the reaction chamber of primed probe group I is S type positive amplification curves, test sample is treated Originally contain zika virus；If the amplification curve for being embedded with sample in the reaction chamber of primed probe group II is that S types positive amplification is bent Line, sample to be tested contain Chikungunya virus；If the amplification curve for being embedded with sample in the reaction chamber of primed probe group III is S Type positive amplification curve, sample to be tested contain I type of dengue virus；If being embedded with sample in the reaction chamber of primed probe group IV Amplification curve be S type positive amplification curves, sample to be tested contains II type of dengue virus；If being embedded with primed probe group V Reaction chamber in the amplification curve of sample be S type positive amplification curves, sample to be tested contains III type of dengue virus；If embedding The amplification curve for having sample in the reaction chamber of primed probe group VI is S type positive amplification curves, and sample to be tested contains Dengue calentura Malicious IV type.

I type of dengue virus concretely DEN-1 Hawaii strain described in any of the above.Dengue virus described in any of the above The concretely DEN-2NGC strains of II type.III type of dengue virus concretely DEN-3H87 strains described in any of the above.Any of the above The dengue virus IV type concretely DEN-4H241 strains.

The present invention also protects in a kind of detection sample to be tested the whether method containing n kind target RNA sequences, include successively as Lower step (reaction principle schematic diagram is shown in Fig. 1)：

(1) extract the total serum IgE of sample to be tested；

(2) carry out reverse transcription recombinase polymeric enzymatic amplification；

(3) carry out recombinase polymeric enzymatic amplification；N is natural number.

N is more than 2 natural number.

The recombinase polymeric enzymatic amplification is carried out in micro-fluid chip, and each reaction chamber of micro-fluid chip is used for detecting A kind of target RNA sequence.

The present invention also protects a kind of for detecting in sample to be tested the whether test kit containing n kind target RNA sequences, including The reagent for carrying out reverse transcription recombinase polymeric enzymatic amplification and the reagent for carrying out recombinase polymeric enzymatic amplification.

The test kit also includes special chip；The special chip is respectively by for detecting the phase of every kind of target RNA The primed probe group of DNA is answered to be embedded in what the differential responses chamber of micro-fluid chip obtained；The primed probe group is by pair of primers With a probe composition.

The reaction condition of reverse transcription recombinase polymeric enzymatic amplification can be：37 DEG C -42 DEG C, 5-30min.

The reaction condition of reverse transcription recombinase polymeric enzymatic amplification is concretely：37 DEG C, 10min.

Reverse transcription recombinase polymeric enzymatic amplification can be the multiplex amplification using the multiple primer pairs for different target sequence, Alternatively using the single amplification of a primer pair for a certain target sequence.The multiplex amplification is concretely adopted and is directed to The sixfold amplification of 6 primer pairs of 6 kinds of target sequence.

After the completion of reverse transcription recombinase polymeric enzymatic amplification, before recombinase polymeric enzymatic amplification is carried out, also including following inactivation step Suddenly：80 DEG C, 2min；12 DEG C, 3min.

The reaction condition of recombinase polymeric enzymatic amplification can be：41 DEG C, 30-60min.

The primer that the primer adopted in reverse transcription recombinase polymeric enzymatic amplification is adopted with recombinase polymeric enzymatic amplification, Ke Yiwei Identical primer can also be different primer.

Should the target sequence containing recombinase polymeric enzymatic amplification in the target sequence of reverse transcription recombinase polymeric enzymatic amplification.

It is for the detection target sequence realized, of the invention by micro-fluidic chip, recombinase polymeric enzymatic amplification and nucleotide sequence Dependent amplification combines, there is provided a kind of method of detection target nucleic acids, first passes through reverse transcription recombinase polymeric enzymatic amplification (carrying out multiplex amplification in same system using the multi-primerses for multi-target fragment) realizes the richness nucleic acid-templated to RNA Collection, then in micro-fluidic chip carries out Nucleic acid sequence amplification and (is respectively directed to each target fragments in each reaction chamber Carry out single amplification), can effectively solve the problems, such as that micro-fluidic chip test limit is reduced, while have taking short, high flux (detection is completed within 1 hour, such as within 30 minutes with the advantage of high detection limit；Can realize simultaneously to multiple target sequence Detection, for example simultaneously realize the detection viral to 6 kinds；Test limit is copied up to unitss, is improve relative to prior art 100 times).

Recombinase polymeric enzymatic amplification is the thermostat extra income grown up on the basis of existing beyond body nucleic acid expands principle Fast amplification of nucleic acid technology, recombinase polymeric enzymatic amplification only need to a pair simple primers and can be achieved with isothermal duplication, but recombinate The amount of the product of enzymatic amplification is not mostly high, it is difficult to be detected.

Nucleic acid sequence amplification is by pair of primers mediation, in vitro specificity continuous homogeneous to single-stranded RNA carries out the process of constant-temperature amplification, is to react under a stationary temperature, and response speed is exceedingly fast, generally the characteristics of maximum An amplified reaction can be just completed in 20 minutes.The technology is usually used in the detection of nucleic acids of RNA viruses, and its detection specificity is good, clever Sensitivity is high, uses it for micro-fluidic chip detection technique, is capable of achieving high flux, the quick detection of RNA viruses, but due to above-mentioned micro- The restriction of fluidic chip so as to which the detection to trace dna is greatly limited.

Further, the invention provides a kind of test kit for detecting carapuru virus.The test kit that the present invention is provided, can Disposably to complete the detection to six kinds of carapuru viruses simultaneously, have the advantages that sensitivity is high, specificity is good, rapid and convenient, tool Have a wide range of applications.

Description of the drawings

Fig. 1 is reaction principle schematic diagram.

Fig. 2 is the result of zika virus standard substance in embodiment 3.

Fig. 3 is the result of Chikungunya virus standard substance in embodiment 3.

Fig. 4 is the result of I type standard substance of dengue virus in embodiment 3.

Fig. 5 is the result of II type standard substance of dengue virus in embodiment 3.

Fig. 6 is the result of III type standard substance of dengue virus in embodiment 3.

Fig. 7 is the result of IV type standard substance of dengue virus in embodiment 3.

Specific embodiment

Below example facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method, if no special instructions, is conventional method.Test material used in following embodiments, if no special instructions, is certainly What routine biochemistry reagent shop was commercially available.Quantitative test in following examples, is respectively provided with three repetitions and tests, as a result make even Average.In embodiment, water used is the water without RNase.BSA is bovine serum albumin.

AMV reverse transcriptases：Promega companies, article No. M5108.T7 rna polymerase：Promega companies, article No. P4074. Ribonuclease H：NEB companies, article No. M0297S.Pyrophosphatase：Sigma companies, article No. I5907.RNase inhibitor： Promega companies, article No. N2611.

TABARTS01kit is commercial kit, sees network addresshttp://www.twistdx.co.uk/products/ general_rd_kits/twistamp_basic_rt/。

Agarose：Baygene companies, article No. 162090.

Ginsenoside：Sigma companies, article No.：65839.

The chemical structural formula of ginsenoside is shown in formula I.

Hydroxypropyl cellulose (average M_w～100000)：Sigma companies, article No. 191884.

The chemical structural formula of hydroxypropyl cellulose is shown in formula II.

Embodiment 1, design and prepare each primer and probe

For detecting that the primer pair of zika virus (Zika Virus) constitutes (5 ' → 3 ') by following two primers：

ZIKV-F (sequence 1 of sequence table)：TGCATWGGAGTCAGCAA；

ZIKV-R (sequence 2 of sequence table)：AATTCTAATACGACTCACTATAGGGAGATAGGATCTTACCTCVGCCA.

For detecting that the primer pair of Chikungunya virus (Chikungunya virus) constitutes (5 ' by following two primers →3’)：

CHIKV-F (sequence 3 of sequence table)：CCGACTCAACCATCCTGGAT；

CHIKV-R (sequence 4 of sequence table)：AATTCTAATACGACTCACTATAGGGAGAGGCARACGCAGTGGTACTT CCT。

For detecting that the primer pair of I type of dengue virus constitutes (5 ' → 3 ') by following two primers：

DENV1-F (sequence 5 of sequence table)：CAAAAGGAAGTCGTGCAATA；

DENV1-R (sequence 6 of sequence table)：AATTCTAATACGACTCACTATAGGGAGACTGAGTGAATTCTCTCTA CTGAACC。

For detecting that the primer pair of II type of dengue virus constitutes (5 ' → 3 ') by following two primers：

DENV2-F (sequence 7 of sequence table)：CAGGTTATGGCACTGTCACGAT；

DENV2-R (sequence 8 of sequence table)：AATTCTAATACGACTCACTATAGGGAGACCATCTGCAGCAACACCA TCTC。

For detecting that the primer pair of III type of dengue virus constitutes (5 ' → 3 ') by following two primers：

DENV3-F (sequence 9 of sequence table)：GGACTGGACACACGCACCCA；

DENV3-R (sequence 10 of sequence table)：

AATTCTAATACGACTCACTATAGGGAGACATGTCTCTACCTTCTCGACTTGTCT。

For detecting that the primer pair of IV type of dengue virus constitutes (5 ' → 3 ') by following two primers：

DENV4-F (sequence 11 of sequence table)：TTGTCCTAATGATGCTGGTCG；

DENV4-R (sequence 12 of sequence table)：AATTCTAATACGACTCACTATAGGGAGATCCACCTGAGACTCCTT CCA。

For detecting the probe of zika virus for ZIKV-P, 13 institute of sequence of the nucleotide sequence such as sequence table of ZIKV-P Show, 5 ' ends have fluorophor FAM, 3 ' ends have quenching group BHQ1.

ZIKV-P：5’-FAM-CGGACGTCAGGTGGGACYTGGGTTGATGTTGTCTTGGGCCTG-BHQ1-3'.

For detecting the probe of Chikungunya virus for CHIKV-P, the sequence of the nucleotide sequence such as sequence table of CHIKV-P Shown in 14,5 ' ends have fluorophor FAM, and 3 ' ends have quenching group BHQ1.

CHIKV-P：5’-FAM-CGGACTCCGACATCATCCTCCTTGCTGGCGCCTG-BHQ1-3'.

For detecting the probe of I type of dengue virus for DENV1-P, the sequence of the nucleotide sequence such as sequence table of DENV1-P Shown in row 15,5 ' ends have fluorophor FAM, and 3 ' ends have quenching group BHQ1.

DENV1-P：5’-FAM-CGGACTATGGTACATGTGGTTGGGAGCACGCGCCTG-BHQ1-3'.

For detecting the probe of II type of dengue virus for DENV2-P, the sequence of the nucleotide sequence such as sequence table of DENV2-P Shown in row 16,5 ' ends have fluorophor FAM, and 3 ' ends have quenching group BHQ1.

DENV2-P：5’-FAM-CGGACCTCTCCGAGAACAGGCCTCGACTTCAAGCCTG-BHQ1-3'.

For detecting the probe of III type of dengue virus for DENV3-P, the sequence of the nucleotide sequence such as sequence table of DENV3-P Shown in row 17,5 ' ends have fluorophor FAM, and 3 ' ends have quenching group BHQ1.

DENV3-P：5’-FAM-CGGACACCTGGATGTCGGCTGAAGGAGCTTGGCCTG-BHQ1-3'.

For detecting the probe of IV type of dengue virus for DENV4-P, the sequence of the nucleotide sequence such as sequence table of DENV4-P Shown in row 18,5 ' ends have fluorophor FAM, and 3 ' ends have quenching group BHQ1.

DENV4-P：5’-FAM-CGGACTTCCTACTCCTACGCATCGCATTCCGGCCTG-BHQ1-3'.

For detecting that the primer pair of reference gene (RNaseP genes) constitutes (5 ' → 3 ') by following two primers：

RNaseP-F (sequence 19)：AGATTTGGACCTGCGAGCG；

RNaseP-R (sequence 20)：AATTCTAATACGACTCACTATAGGGAGAGAGCGGCTGTCTCCACAAGT.

For detecting the probe of reference gene (RNaseP genes)：

RNaseP-P (sequence 21)：5’-FAM-CGGACTTCTGACCTGAAGGCTCTGCGCGGCCTG-BHQ1-3'.

Above in the nucleotide sequence of each primer and probe, W represents A or T, V represent A or G or C, R represent G or A, Y generation Table C or T.

The preparation of embodiment 2, carapuru virus detection kit

First, the composition of test kit

Test kit constitutes (each component independent packaging) by following component：

(1) primer mixture liquid is by ZIKV-F, ZIKV-R, CHIKV-F, CHIKV-R, DENV1-F, DENV1-R, DENV2- F, DENV2-R, DENV3-F, DENV3-R, DENV4-F, DENV4-R and sterilized water composition；In primer mixture liquid, ZIKV-F's Concentration is 0.2 μM, the concentration of ZIKV-R is 0.2 μM, the concentration of CHIKV-F is 0.15 μM, the concentration of CHIKV-R is 0.15 μM, The concentration of DENV1-F is 0.2 μM, the concentration of DENV1-R is 0.2 μM, the concentration of DENV2-F is 0.15 μM, the concentration of DENV2-R For 0.15 μM, DENV3-F concentration be 0.3 μM, the concentration of DENV3-R be 0.3 μM, the concentration of DENV4-F be 0.25 μM, The concentration of DENV4-R is 0.25 μM.

(2) RT-RPA reaction buffers：TwistDx companies, the component of TABARTS01kit.

(3) reaction tube equipped with RT-RPA enzyme mixed powders (for 50 μ l systems)：TwistDx companies, The component of TABARTS01kit.

(4) 280mM magnesium acetates aqueous solution.

(5) reaction mixture BQ：Tris-HCl buffer of the solvent for pH8.0,200mM；Solute and its concentration are as follows： DTT 50mM、MgCl₂80mM, KCl 450mM, DMSO 15% (volumn concentration), Sorbitol 1M, dNTP 2mM are (i.e. The concentration of dATP, dTTP, dCTP and dGTP is 2mM), (i.e. the concentration of rATP, rTTP, rCTP and rGTP is rNTP 4mM 4mM)。

(6) enzyme mixation EQ：Solvent is water；Solute and its concentration are as follows：AMV reverse transcriptase 1U/ μ l, t7 rna polymerase 5U/ μ l, ribonuclease H 0.5U/ μ l, pyrophosphatase 0.5U/ μ l, RNase inhibitor 5U/ μ l, BSA 0.5 μ g/ μ l.

(7) it is embedded with the micro-fluidic chip of primer and probe.

Using the micro-fluidic chip (each hole is a reaction chamber, and the volume of each reaction chamber is 1.4 μ l) in 1 × 24 hole, 0.4 × 10 is embedded with 1# reaction chambers^-6μmol ZIKV-F、0.4×10^-6μm ol ZIKV-R and 0.2 × 10^-6μmol ZIKV- P, is embedded with 0.4 × 10 in 2# reaction chambers^-6μmol CHIKV-F、0.4×10^-6μm ol CHIKV-R and 0.2 × 10^-6μmol CHIKV-P, is embedded with 0.4 × 10 in 3# reaction chambers^-6μmol DENV1-F、0.4×10^-6μm ol DENV1-R and 0.2 × 10^-6μ Mol DENV1-P, are embedded with 0.4 × 10 in 4# reaction chambers^-6μmol DENV2-F、0.4×10^-6μm ol DENV2-R and 0.2 × 10^-6μm ol DENV2-P, are embedded with 0.4 × 10 in 5# reaction chambers^-6μmol DENV3-F、0.4×10^-6μm ol DENV3-R and 0.2×10^-6μm ol DENV3-P, are embedded with 0.4 × 10 in 6# reaction chambers^-6μmol DENV4-F、0.4×10^-6μmol DENV4-R and 0.2 × 10^-6μm ol DENV4-P, are embedded with 0.4 × 10 in 7# reaction chambers^-6μmol RNaseP-F、0.4×10^-6 μm ol RNaseP-R and 0.2 × 10^-6μm ol RNaseP-P, are embedded with negative controls (sterilized water) in 8# reaction chambers.

It is embedded with the preparation method of the micro-fluidic chip of primer and probe：1. will encapsulation reagent, primer, probe and sterilized water Mixing, (in embedding liquid, the concentration for encapsulating reagent is 0.1g/100ml, and the concentration of primer is 0.4 μM, probe to obtain embedding liquid Concentration is 0.2 μM)；Encapsulation reagent is made up of 5 mass parts agaroses, 3 mass parts saponin and 4 mass parts HPMC； 2. micro-fluidic chip is taken, 1 μ l embedding liquid in each reaction chamber, is added；3. the micro-fluidic chip that 2. step obtains is taken, cleaning is placed in Dry in super-clean bench, then tabletting encapsulation punching press evacuation.

Primer mixture liquid, RT-RPA reaction buffers, the reaction tube equipped with RT-RPA enzyme mixed powders and 280mM acetic acid Magnesium aqueous solution is used for reverse transcription recombinase polymeric enzymatic amplification (RT-RPA).

Reaction mixture BQ, enzyme mixation EQ and be embedded with the micro-fluidic chip of primer and probe for nucleotide sequence rely on Property amplification (NASBA).

2nd, the using method of test kit

Solution to be measured：Take biological specimen to be measured viral or to be measured (such as serum), extract nucleic acid, the nucleic acid solution for obtaining or Its diluent is solution to be measured.When virus to be measured is DNA viruses, extracts nucleic acid and refer to extract genomic DNA.Virus to be measured For RNA viruses when, extract nucleic acid refer to extract total serum IgE.Biological specimen to be measured, extracts nucleic acid and refers to extract total serum IgE.

1st, reverse transcription recombinase polymeric enzymatic amplification (pre- to expand)

A reaction tube equipped with RT-RPA enzyme mixed powders is taken, 29.5 μ l RT-RPA reaction buffers, 5 μ are sequentially added L primer mixed liquors, 10 μ l solution to be measured and 3 μ l water mix homogeneously, are subsequently adding 2.5 μ l 280mM magnesium acetates aqueous solutions to open Dynamic reaction.

Reaction condition：37℃10min；80 DEG C, 2min；12 DEG C, 3min.

80 DEG C, the purpose of 2min process is in order to inactivate the enzyme in reaction system, in order to avoid have an impact to subsequent step.

After completing reaction, whole system is named as pre- amplified production.

2nd, Nucleic acid sequence amplification

(1) 12 μ l reaction mixture BQ, 3 μ l enzyme mixations EQ and the pre- amplified productions of 10 μ l is taken, mix homogeneously is injected into bag It is embedded with the micro-fluidic chip of primer and probe, seals Quick spin 30s after membrana oralis.

(2), after completing step (1), the micro-fluidic chip for being embedded with primer and probe is placed in into brilliant core RTisochip- In A constant-temperature amplification micro-fluidic chip nucleic acids instruments, 41 DEG C of reaction 60min simultaneously complete real-time fluorescence scanning simultaneously.

3rd, result judges

After reaction terminates, determine which sample to be tested contains as follows according to the amplification curve of sample in each reaction chamber A kind of or which kind virus：If the amplification curve of sample is S type positive amplification curves in 1# reaction chambers, sample to be tested contains stockaded village Card virus；If the amplification curve of sample is S type positive amplification curves in 2# reaction chambers, sample to be tested contains chikungunya disease Poison；If the amplification curve of sample is S type positive amplification curves in 3# reaction chambers, sample to be tested contains I type of dengue virus；Such as In fruit 4# reaction chambers, the amplification curve of sample is S type positive amplification curves, and sample to be tested contains II type of dengue virus；If 5# In reaction chamber, the amplification curve of sample is S type positive amplification curves, and sample to be tested contains III type of dengue virus；If 6# reacts In chamber, the amplification curve of sample is S type positive amplification curves, and sample to be tested contains IV type of dengue virus.Sample to be tested is biology The blood or tissue of sample, such as human or animal；RNaseP genes be house-keeping gene, almost human or animal institute in a organized way in In all high level expressions, therefore 7# reaction chamber, the amplification curve of sample should be S type positive amplification curves.Sample in 8# reaction chambers Amplification curve should be negative amplification curve.

After reaction terminates, determine which kind of virus to be measured is as follows according to the amplification curve of sample in each reaction chamber Virus：If the amplification curve of sample is S type positive amplification curves in 1# reaction chambers, virus to be measured is zika virus；If 2# In reaction chamber, the amplification curve of sample is S type positive amplification curves, and virus to be measured is Chikungunya virus；If in 3# reaction chambers The amplification curve of sample is S type positive amplification curves, and virus to be measured is I type of dengue virus；If sample in 4# reaction chambers Amplification curve is S type positive amplification curves, and virus to be measured is II type of dengue virus；If the amplification of sample is bent in 5# reaction chambers Line is S type positive amplification curves, and virus to be measured is III type of dengue virus；If the amplification curve of sample is S in 6# reaction chambers Type positive amplification curve, virus to be measured are IV type of dengue virus.In 8# reaction chambers, the amplification curve of sample should be negative amplification Curve.

The contrast of embodiment 3, two kind of nucleic acid amplification method

First, standard substance are prepared

Prepare the RNA1 (single strand RNA molecule, zika virus standard substance) shown in the sequence 22 of sequence table.RNA1 is dissolved in into nothing Bacterium water, then carries out gradient dilution with sterilized water, obtains concentration for 10⁴copies/μl、10³copies/μl、10²copies/μ The RNA1 diluents of l, 10copies/ μ l or 1copies/ μ l.

Prepare the RNA2 (single strand RNA molecule, Chikungunya virus standard substance) shown in the sequence 23 of sequence table.RNA2 is molten In sterilized water, then gradient dilution is carried out with sterilized water, obtain concentration for 10⁴copies/μl、10³copies/μl、 10²The RNA2 diluents of copies/ μ l, 10copies/ μ l or 1copies/ μ l.

Prepare the RNA3 (single strand RNA molecule, I type standard substance of dengue virus) shown in the sequence 24 of sequence table.By RNA3 Sterilized water is dissolved in, then gradient dilution is carried out with sterilized water, obtain concentration for 10⁴copies/μl、10³copies/μl、 10²The RNA3 diluents of copies/ μ l, 10copies/ μ l or 1copies/ μ l.

Prepare the RNA4 (single strand RNA molecule, II type standard substance of dengue virus) shown in the sequence 25 of sequence table.By RNA4 Sterilized water is dissolved in, then gradient dilution is carried out with sterilized water, obtain concentration for 10⁴copies/μl、10³copies/μl、 10²The RNA4 diluents of copies/ μ l, 10copies/ μ l or 1copies/ μ l.

Prepare the RNA5 (single strand RNA molecule, III type standard substance of dengue virus) shown in the sequence 26 of sequence table.By RNA5 Sterilized water is dissolved in, then gradient dilution is carried out with sterilized water, obtain concentration for 10⁴copies/μl、10³copies/μl、 10²The RNA5 diluents of copies/ μ l, 10copies/ μ l or 1copies/ μ l.

Prepare the RNA6 (single strand RNA molecule, IV type standard substance of dengue virus) shown in the sequence 27 of sequence table.By RNA6 Sterilized water is dissolved in, then gradient dilution is carried out with sterilized water, obtain concentration for 10⁴copies/μl、10³copies/μl、 10²The RNA6 diluents of copies/ μ l, 10copies/ μ l or 1copies/ μ l.

2nd, the contrast of two kinds of amplification methods

1st, the method for the present invention (RPA-NASBA methods)

Each diluent of step one preparation is taken as solution to be measured, using the step of embodiment 2 one test kit for preparing Detected according to the step of embodiment 2 two method description.

2nd, existing method (NASBA methods)

Take each diluent of step one preparation, replace the pre- amplified productions of 10 μ l, according to the step of embodiment 2 two 2 Method is detected.

The result of zika virus standard substance is shown in Fig. 2.In Fig. 2, R represents RPA-NASBA methods, and N represents NASBA methods, 1 to 5 according to The secondary diluent for representing nucleic acid concentration from high to low.

The result of Chikungunya virus standard substance is shown in Fig. 3.In Fig. 3, R represents RPA-NASBA methods, and N represents NASBA methods, 1 to 5 represent nucleic acid concentration diluent from high to low successively.

The result of I type standard substance of dengue virus is shown in Fig. 4.In Fig. 4, R represents RPA-NASBA methods, and N represents NASBA methods, and 1 Nucleic acid concentration diluent from high to low is represented successively to 5.

The result of II type standard substance of dengue virus is shown in Fig. 5.In Fig. 5, R represents RPA-NASBA methods, and N represents NASBA methods, and 1 Nucleic acid concentration diluent from high to low is represented successively to 5.

The result of III type standard substance of dengue virus is shown in Fig. 6.In Fig. 6, R represents RPA-NASBA methods, and N represents NASBA methods, and 1 Nucleic acid concentration diluent from high to low is represented successively to 5.

The result of IV type standard substance of dengue virus is shown in Fig. 7.In Fig. 7, R represents RPA-NASBA methods, and N represents NASBA methods, and 1 Nucleic acid concentration diluent from high to low is represented successively to 5.

As a result show, the test limit of micro-fluidic chip can greatly be improved using the nucleic acid amplification method of the present invention, for This six kinds of carapuru virus detection limits at least improve two Concentraton gradient.Illustrating that the present invention is very big improves micro-fluidic chip Minimum detectability, and shorten detection time.

Embodiment 4, accuracy and specificity

Virus difference to be measured is as follows：

Zika virus：Zhang Shuo, Li Dexin；Zika virus and zika virus disease；Viral journal, in January, 2016, volume 32 1 phase, 121-123.

Chikungunya virus：Wang Yujiao, Zhang Yunbo, section new Asia, Wang Yaling, Zhao Guiping；What Chikungunya virus infected examines Disconnected Research progress；《Clinical Laboratory magazine》,2012(7):522-524.

I type of dengue virus (strain of DEN-1 Hawaii)：Shu Liping, Zuo Li, Li Yongnian, Hao Mu, Chen Aying；Universal primer Detection dengue virus NS1 genes and its enzyme action typing；《Guiyang Medical College journal》,2004,29(4):283-286.

II type of dengue virus (DEN-2NGC strains)：Shu Liping, Zuo Li, Li Yongnian, Hao Mu, Chen Aying；Universal primer is examined Survey dengue virus NS1 genes and its enzyme action typing；《Guiyang Medical College journal》,2004,29(4):283-286.

III type of dengue virus (DEN-3H87 strains)：Shu Liping, Zuo Li, Li Yongnian, Hao Mu, Chen Aying；Universal primer is examined Survey dengue virus NS1 genes and its enzyme action typing；《Guiyang Medical College journal》,2004,29(4):283-286.

IV type of dengue virus (DEN-4H241 strains)：Shu Liping, Zuo Li, Li Yongnian, Hao Mu, Chen Aying；Universal primer is examined Survey dengue virus NS1 genes and its enzyme action typing；《Guiyang Medical College journal》,2004,29(4):283-286.

Hepatitis B viruss：Zhang Juan, Chen Jianzong, Zhang Jinping, Jia Xin, Jiang Weifeng；The external resistance of hepatitis B disease of astragaloside The effect of poison；The Fourth Military Medical University, 2008,28 (24):2291-2293.

Epstein-Barr virus (ebb virus)：Wu Fan, Zhai Weiwei, Ge Liuying, Qi Yanwei, Gao Hui；245 human immunities The detection case analysis of nerpes vinrus hominises' 1-4 types in defective viruss the infected's saliva；《West China Journal of Stomatology》,2012, 30(5):514-517。

Morbillivirus L 4 strain：Zhao great Peng, Yao Weimin, Wu Xiaojuan, Qi Fengchun, Wang Chunyi；Morbillivirus L 4 strain genome is complete The measure of sequence；National biological product academic conference, 2007.

Bird flu H5 types virus is specially H5N1 subtype avian influenza virus A/duck/Guangdong/S1322/2010 (DK/ GD/S1322/2010)：Lu Kunpeng, Cui Pengfei, Zhang Fang, Wang Jing, Xiao Hongbo；H5 subtype avian influenza virus HA protein monoclonals resist The preparation and identification of body；《Chinese veterinary science》,2015(5):453-457.

Bird flu H7 types virus is specially H7N2 subtype avian influenza virus (Avian in fluenzavirus, AIV) A/ Chicken/Hebei/1/2002：Wang Chuanbin, Tian Kegong, Wang Hongwei, Sun Ming, meet the elegant tinkling of pieces of jade；China H_7N_2 subtype avian influenzas disease Malicious CK/HB/1/02 strains isolation identification；《CHINA virus》,2005,20(6):632-636.

Human cytomegalic inclusion disease virus：Wang Min, hair Jianping；Technologies Development on Human Cytomegalovirus Detection；《Chinese biological engineering magazine》, 2007,27(2):103-107。

The nucleic acid for extracting each virus to be measured (when virus to be measured is DNA viruses, extracts genomic DNA；Virus to be measured is During RNA viruses, total serum IgE is extracted), as solution to be measured, then using the step of embodiment 2 one test kit for preparing according to enforcement The method description of the step of example 2 two is detected.

The total serum IgE of extraction zika virus, the total serum IgE of Chikungunya virus, the total serum IgE of I type of dengue virus, Dengue calentura The total serum IgE of malicious II type, the total serum IgE of III type of dengue virus, the total serum IgE of IV type of dengue virus, then mix, obtain aggregate sample This (concentration of wherein various viral nucleic acids is 100copies/ μ l), using mixing sample as solution to be measured, then using reality Test kit prepared by the step of applying example 2 one is detected according to the step of embodiment 2 two method description.

Each duplicate detection to be measured 3 times, as a result unanimously.

Testing result is as shown in table 1.It can be seen from the results that the nucleic acid detection method of the present invention, its accuracy height, to non- Without non-specific amplification, its accuracy can reach 100% to target gene.

1 accuracy of table and specific detection result

Sequence table

<120>A kind of nucleic acid amplification technologies and its application in carapuru virus detection

<130> GNCYX161842

<160> 27

<210> 1

<211> 17

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (6)

<223> w = a or t

<400> 1

tgcatwggag tcagcaa 17

<210> 2

<211> 47

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (43)

<223> v = a or g or c

<400> 2

aattctaata cgactcacta tagggagata ggatcttacc tcvgcca 47

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence

<400> 3

ccgactcaac catcctggat 20

<210> 4

<211> 50

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (33)

<223> r = g or a

<400> 4

aattctaata cgactcacta tagggagagg caracgcagt ggtacttcct 50

<210> 5

<211> 20

<212> DNA

<213>Artificial sequence

<400> 5

caaaaggaag tcgtgcaata 20

<210> 6

<211> 53

<212> DNA

<213>Artificial sequence

<400> 6

aattctaata cgactcacta tagggagact gagtgaattc tctctactga acc 53

<210> 7

<211> 22

<212> DNA

<213>Artificial sequence

<400> 7

caggttatgg cactgtcacg at 22

<210> 8

<211> 50

<212> DNA

<213>Artificial sequence

<400> 8

aattctaata cgactcacta tagggagacc atctgcagca acaccatctc 50

<210> 9

<211> 20

<212> DNA

<213>Artificial sequence

<400> 9

ggactggaca cacgcaccca 20

<210> 10

<211> 54

<212> DNA

<213>Artificial sequence

<400> 10

aattctaata cgactcacta tagggagaca tgtctctacc ttctcgactt gtct 54

<210> 11

<211> 21

<212> DNA

<213>Artificial sequence

<400> 11

ttgtcctaat gatgctggtc g 21

<210> 12

<211> 48

<212> DNA

<213>Artificial sequence

<400> 12

aattctaata cgactcacta tagggagatc cacctgagac tccttcca 48

<210> 13

<211> 42

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (18)

<223> y = c or t

<400> 13

cggacgtcag gtgggacytg ggttgatgtt gtcttgggcc tg 42

<210> 14

<211> 34

<212> DNA

<213>Artificial sequence

<400> 14

cggactccga catcatcctc cttgctggcg cctg 34

<210> 15

<211> 36

<212> DNA

<213>Artificial sequence

<400> 15

cggactatgg tacatgtggt tgggagcacg cgcctg 36

<210> 16

<211> 37

<212> DNA

<213>Artificial sequence

<400> 16

cggacctctc cgagaacagg cctcgacttc aagcctg 37

<210> 17

<211> 36

<212> DNA

<213>Artificial sequence

<400> 17

cggacacctg gatgtcggct gaaggagctt ggcctg 36

<210> 18

<211> 36

<212> DNA

<213>Artificial sequence

<400> 18

cggacttcct actcctacgc atcgcattcc ggcctg 36

<210> 19

<211> 19

<212> DNA

<213>Artificial sequence

<400> 19

agatttggac ctgcgagcg 19

<210> 20

<211> 48

<212> DNA

<213>Artificial sequence

<400> 20

aattctaata cgactcacta tagggagaga gcggctgtct ccacaagt 48

<210> 21

<211> 33

<212> DNA

<213>Artificial sequence

<400> 21

cggacttctg acctgaaggc tctgcgcggc ctg 33

<210> 22

<211> 1506

<212> RNA

<213>Artificial sequence

<400> 22

aucaggugca uuggagucag caauagagac uucguggagg gcaugucagg ugggaccugg 60

guugauguug ucuuggaaca uggaggcugc guuaccguga uggcacagga caagccaaca 120

gucgacauag aguuggucac gacgacgguu aguaacaugg ccgagguaag auccuauugc 180

uacgaggcau cgauaucgga cauggcuucg gacagucguu gcccaacaca aggugaagcc 240

uaccuugaca agcaaucaga cacucaauau gucugcaaaa gaacauuagu ggacagaggu 300

uggggaaacg guuguggacu uuuuggcaaa gggagcuugg ugacaugugc caaguuuacg 360

uguucuaaga agaugaccgg gaagagcauu caaccggaaa aucuggagua ucggauaaug 420

cuaucagugc auggcuccca gcauagcggg augauuggau augaaacuga cgaagauaga 480

gcgaaagucg agguuacgcc uaauucacca agagcggaag caaccuuggg aggcuuugga 540

agcuuaggac uugacuguga accaaggaca ggccuugacu uuucagaucu guauuaccug 600

accaugaaca auaagcauug guuggugcac aaagaguggu uucaugacau cccauugccu 660

uggcaugcug gggcagacac cggaacucca cacuggaaca acaaagaggc auugguagaa 720

uucaaggaug cccacgccaa gaggcaaacc gucgucguuc uggggagcca ggaaggagcc 780

guucacacgg cucucgcugg agcucuagag gcugagaugg auggugcaaa gggaaggcug 840

uucucuggcc auuugaaaug ccgccuaaaa auggacaagc uuagauugaa gggcguguca 900

uauuccuugu gcacugcggc auucacauuc accaaggucc cagcugaaac acugcaugga 960

acagucacag uggaggugca guaugcaggg acagauggac ccugcaagau cccaguccag 1020

auggcggugg acaugcagac ccugacccca guuggaaggc ugauaaccgc caaccccgug 1080

auuacugaaa gcacugagaa cucaaagaug auguuggagc uugacccacc auuuggggau 1140

ucuuacauug ucauaggagu uggggacaag aaaaucaccc accacuggca uaggaguggu 1200

agcaccaucg gaaaggcauu ugaggccacu gugagaggcg ccaagagaau ggcaguccug 1260

ggggauacag ccugggacuu cggaucaguc gggggugugu ucaacucacu ggguaagggc 1320

auucaccaga uuuuuggagc agccuucaaa ucacuguuug gaggaauguc cugguucuca 1380

cagauccuca uaggcacgcu gcuagugugg uuagguuuga acacaaagaa uggaucuauc 1440

ucccucacau gcuuggcccu ggggggagug augaucuucc ucuccacggc uguuucugcu 1500

gacgug 1506

<210> 23

<211> 1681

<212> RNA

<213>Artificial sequence

<400> 23

auggcugcgu gagacacacg uagccuacca guuucuuacu gcucuacucu gcaaagcaag 60

agauuaagaa cccaucaugg auccugugua cguggacaua gacgcugaca gcgccuuuuu 120

gaaggcccug caacgugcgu accccauguu ugagguggaa ccuaggcagg ucacaccgaa 180

ugaccaugcu aaugcuagag cguucucgca ucuagcuaua aaacuaauag agcaggaaau 240

ugaucccgac ucaaccaucc uggauauugg uagugcgcca gcaaggagga ugaugucgga 300

caggaaguac cacugcguuu gcccgaugcg cagugcagaa gaucccgaga gacucgccaa 360

uuaugcgaga aagcuagcau cugccgcagg aaaaguccug gacagaaaca ucucuggaaa 420

gaucggggac uuacaagcag uaauggccgu gccagacacg gagacgccaa cauucugcuu 480

acacacagau guaucaugua gacagagagc agacgucgcg auauaccaag acgucuaugc 540

uguacacgca cccacgucgc uauaccacca ggcgauuaaa gggguccgau uggcguacug 600

gguaggguuu gacacaaccc cguucaugua caaugccaug gcgggugccu accccucaua 660

cucgacaaau ugggcagaug agcagguacu gaaggcuaag aacauaggau uauguucaac 720

agaccugacg gaagguagac gaggcaaauu gucuauuaug agaggaaaaa agcuagaacc 780

gugcgaccgu gugcuguucu caguaggguc aacgcucuac ccggaaagcc guaagcuacu 840

uaagagcugg caccuaccau cgguguucca uuuaaagggc aagcucagcu ucacaugccg 900

cugugauaca gugguuucgu gcgaaggcua cgucguuaag agaauaacga ugagcccagg 960

ccuuuacgga aaaaccacag gguaugcggu aacccaccac gcagacggau uccugaugug 1020

caagaccacc gacacgguug acggcgaaag agugucauuc ucggugugca cguacgugcc 1080

ggcgaccauu ugugaucaaa ugaccggcau ccuugcuaca gaagucacgc cggaggaugc 1140

acagaagcug uugguggggc ugaaccagag aauagugguu aacggcagaa cgcaacggaa 1200

uacgaacacc augaaaaacu auaugauucc cguggucgcc caagccuuca guaagugggc 1260

aaaggagugc cggaaagaca uggaagauga aaaacuccug ggggucagag aaagaacacu 1320

gaccugcugc ugucuauggg cauuuaagaa gcagaaaaca cacacggucu acaagaggcc 1380

ugauacccag ucaauucaga agguucaggc cgaguuugac agcuuugugg uaccgagccu 1440

guggucgucc ggguugucaa ucccguugag gacuagaauc aaaugguugu uaagcaaggu 1500

gccaaaaacc gaccugaccc cauacagcgg ggacgcccaa gaagcccggg acgcagaaaa 1560

agaagcagag gaagaacgag aagcagaacu gacucuugaa gcccuaccac cccuucaggc 1620

agcacaggaa gauguucagg ucgaaaucga cguggaacag cuugaggaca gagcgggugc 1680

a 1681

<210> 24

<211> 1101

<212> RNA

<213>Artificial sequence

<400> 24

auggagguga cagccaggug guuauggggu uuucucucua gaaacaaaaa acccagaauc 60

ugcacaagag aggaguucac aagaaaaguc aggucaaacg cagcuauugg agcaguguuc 120

guugaugaaa aucaauggaa cucagcaaaa gaggcagugg aagaugaacg guucugggac 180

cuugugcaca gagagaggga gcuucauaaa caaggaaaau gugccacgug ugucuacaac 240

augaugggaa agagagagaa aaaauuagga gaguucggaa aggcaaaagg aagucgcgca 300

auaugguaca ugugguuggg agcgcgcuuu uuagaguuug aagcccuugg uuucaugaau 360

gaagaucacu gguucagcag agagaauuca cucaguggag uggaaggaga aggacuccac 420

aaacuuggau acauacucag agacauauca aagauuccag ggggaaauau guaugcagau 480

gacacagccg gaugggacac aagaauaaca gaggaugauc uucagaauga ggccaaaauc 540

acugacauca uggaaccuga acaugcccua uuggccacgu caaucuuuaa gcuaaccuac 600

caaaacaagg uaguaagggu gcagagacca gcgaaaaaug gaaccgugau ggaugucaua 660

uccagacgug accagagagg aaguggacag guuggaaccu auggcuuaaa caccuucacc 720

aacauggagg cccaacuaau aagacaaaug gagucugagg gaaucuuuuc acccagcgaa 780

uuggaaaccc caaaucuagc cgaaagaguc cucgacuggu ugaaaaaaca uggcaccgag 840

aggcugaaaa gaauggcaau caguggagau gacugugugg ugaaaccaau cgaugacaga 900

uuugcaacag ccuuaacagc uuugaaugac augggaaagg uaagaaaaga cauaccgcaa 960

ugggaaccuu caaaaggaug gaaugauugg caacaagugc cuuucuguuc acaccauuuc 1020

caccagcuga uuaugaagga ugggagggag auaguggugc caugccgcaa ccaagaugaa 1080

cuuguaggua gggccagagu a 1101

<210> 25

<211> 1085

<212> RNA

<213>Artificial sequence

<400> 25

gucaucagaa ggggccugga aacaugucca gagaauugaa acuuggaucu ugagacaucc 60

aggcuucacc augauggcag caauccuggc auacaccaua ggaacgacac auuuccaaag 120

agcccugauu uucaucuuac ugacagcugu cacuccuuca augacaaugc guugcauagg 180

aaugucaaau agagacuuug uggaaggggu uucaggagga agcuggguug acauagucuu 240

agaacaugga agcuguguga cgacgauggc aaaaaacaaa ccaacauugg auuuugaacu 300

gauaaaaaca gaagccaaac agccugccac ccuaaggaag uacuguauag aggcaaagcu 360

aaccaacaca acaacagaau cucgcugccc aacacaaggg gaacccagcc uaaaugaaga 420

gcaggacaaa agguucgucu gcaaacacuc caugguagac agaggauggg gaaauggaug 480

uggacuauuu ggaaagggag gcauugugac cugugcuaug uucagaugca aaaagaacau 540

ggaaggaaaa guugugcaac cagaaaacuu ggaauacacc auugugauaa caccucacuc 600

aggggaagag caugcagucg gaaaugacac aggaaaacau ggcaaggaaa ucaaaauaac 660

accacagagu uccaucacag aagcagaauu gacagguuau ggcacuguca caauggagug 720

cucuccaaga acgggccucg acuucaauga gaugguguug cugcagaugg aaaauaaagc 780

uuggcuggug cacaggcaau gguuccuaga ccugccguua ccaugguugc ccggagcgga 840

cacacaaggg ucaaauugga uacagaaaga gacauugguc acuuucaaaa auccccaugc 900

gaagaaacag gauguuguug uuuuaggauc ccaagaaggg gccaugcaca cagcacuuac 960

aggggccaca gaaauccaaa ugucaucagg aaacuuacuc uucacaggac aucucaagug 1020

caggcugaga auggacaagc uacagcucaa aggaauguca uacucuaugu gcacaggaaa 1080

guuua 1085

<210> 26

<211> 1208

<212> RNA

<213>Artificial sequence

<400> 26

aguuguuagu cuacguggac cgacaagaac aguuucgacu cggaagcuug cuuaacguag 60

ugcugacagu uuuuuauuag agagcagauc ucugaugaac aaccaacgga agaagacggg 120

aaaaccgucu aucaauaugc ugaaacgcgu gagaaaccgu gugucaacug gaucacaguu 180

ggcgaagaga uucucaaaag gacugcugaa cggccaggga ccaaugaaau ugguuauggc 240

guucauagcu uuccucagau uucuagccau uccaccaaca gcaggagucu uggcuagaug 300

gggaaccuuc aagaagucgg gggccauuaa gguccugaaa ggcuucaaga aggagaucuc 360

aaacaugcug agcauaauca accaacggaa aaagacaucg cucugucuca ugaugauauu 420

gccagcagca cuugcuuucc acuugacuuc acgagaugga gagccgcgca ugauuguggg 480

gaagaaugaa agagguaaau cccuacuuuu uaagacagcc ucuggaauca acaugugcac 540

acucauagcc auggauuugg gagagaugug ugaugacacg gucacuuaca aaugccccca 600

cauuaccgaa guggaaccug aagacauuga cugcuggugc aaccuuacau caacaugggu 660

gacuuaugga acgugcaauc aagcuggaga gcauagacgc gacaagagau caguggcguu 720

agcuccccau gucggcaugg gacuggacac acgcacccaa accuggaugu cggcugaagg 780

agcuuggaga caagucgaga agguagagac augggcccuu aggcacccag gguucaccau 840

acuagcccua uuucucgccc auuacauagg cacuucccug acccagaagg ugguuauuuu 900

cauauuauua augcugguca ccccauccau gacaaugaga ugugugggag uaggaaacag 960

agauuuugug gaagggcuau caggagcuac guggguugac guggugcucg agcacggggg 1020

gugugugacu accauggcua agaacaagcc cacgcuggau auagagcuuc agaagaccga 1080

ggccacccaa cuggcgaccc uaaggaagcu augcauugag gggaaaauua ccaacauaac 1140

aacugacuca agauguccua cccaagggga agcgguuuug ccugaggagc aggaccagaa 1200

cuacgugu 1208

<210> 27

<211> 992

<212> RNA

<213>Artificial sequence

<400> 27

auggauguca ucggaagggg cuuggaagca ugcucagaga guagagagcu ggauacucag 60

aaacccagga uucgcgcucu uggcaggauu uauggcuuau augauugggc aaacaggaau 120

ccagcgaacu gucuucuuug uccuaaugau gcuggucgcc ccauccuacg gaaugcgaug 180

cguaggagua ggaaacagag acuuugugga aggagucuca gguggagcau gggucgaccu 240

ggugcuagaa cauggaggau gcgucacaac cauggcccag ggaaaaccaa ccuuggauuu 300

ugaacugacu aagacaacag ccaaggaagu ggcucuguua agaaccuauu gcauugaagc 360

cucaauauca aacauaacua cggcaacaag auguccaacg caaggagagc cuuaucugaa 420

agaggaacag gaccaacagu acauuugccg gagagaugug guagacagag gguggggcaa 480

uggcuguggc uuguuuggaa aaggaggagu ugugacaugu gcgaaguuuu cauguucggg 540

gaagauaaca ggcaauuugg uccaaauuga gaaccuugaa uacacagugg uuguaacagu 600

ccacaaugga gacacccaug caguaggaaa ugacacaucc aaucauggag uuacagccau 660

gauaacuccc aggucaccau cgguggaagu caaauugccg gacuauggag aacuaacacu 720

cgauugugaa cccaggucug gaauugacuu uaaugagaug auucugauga aaaugaaaaa 780

gaaaacaugg cucgugcaua agcaaugguu uuuggaucug ccucuuccau ggacagcagg 840

agcagacaca ucagagguuc acuggaauua caaagagaga auggugacau uuaagguucc 900

ucaugccaag agacaggaug ugacagugcu gggaucucag gaaggagcca ugcauucugc 960

ccucgcugga gccacagaag uggacuccgg ug 992

Claims

1. primer combination of probe, is following (a1) or (a2) or (a3)：

(a1) by primed probe group I, primed probe group II, primed probe group III, primed probe group IV, primed probe group V and draw Thing probe groups VI are constituted；

(a2) by the primed probe group I, the primed probe group II, the primed probe group III, the primed probe group IV, Any two in the primed probe group V and the primed probe group VI, any three, any four or any five groups Into；

(a3) the primed probe group I, the primed probe group II, the primed probe group III, the primed probe group IV, institute State primed probe group V or the primed probe group VI；

The primer ZIKV-F is following (b1) or (b2)；

(b1) single strand dna shown in the sequence 1 of sequence table；

(b2) sequence 1 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 1 identical The DNA molecular of function；

The primer ZIKV-R is following (b3) or (b4)；

(b3) single strand dna shown in the sequence 2 of sequence table；

(b4) sequence 2 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 2 identical The DNA molecular of function；

(b5) single strand dna as shown in the sequence 13 of sequence table；

(b6) sequence 13 had into phase through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 13 The DNA molecular of congenerous；

The primer CHIKV-F is following (c1) or (c2)；

(c1) single strand dna shown in the sequence 3 of sequence table；

(c2) sequence 3 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 3 identical The DNA molecular of function；

The primer CHIKV-R is following (c3) or (c4)；

(c3) single strand dna shown in the sequence 4 of sequence table；

(c4) sequence 4 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 4 identical The DNA molecular of function；

(c5) single strand dna as shown in the sequence 14 of sequence table；

(c6) sequence 14 had into phase through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 14 The DNA molecular of congenerous；

The primer DENV1-F is following (d1) or (d2)；

(d1) single strand dna shown in the sequence 5 of sequence table；

(d2) sequence 5 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 5 identical The DNA molecular of function；

The primer DENV1-R is following (d3) or (d4)；

(d3) single strand dna shown in the sequence 6 of sequence table；

(d4) sequence 6 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 6 identical The DNA molecular of function；

(d5) single strand dna as shown in the sequence 15 of sequence table；

(d6) sequence 15 had into phase through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 15 The DNA molecular of congenerous；

The primer DENV2-F is following (e1) or (e2)；

(e1) single strand dna shown in the sequence 7 of sequence table；

(e2) sequence 7 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 7 identical The DNA molecular of function；

The primer DENV2-R is following (e3) or (e4)；

(e3) single strand dna shown in the sequence 8 of sequence table；

(e4) sequence 8 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 8 identical The DNA molecular of function；

(e5) single strand dna as shown in the sequence 16 of sequence table；

(e6) sequence 16 had into phase through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 16 The DNA molecular of congenerous；

The primer DENV3-F is following (f1) or (f2)；

(f1) single strand dna shown in the sequence 9 of sequence table；

(f2) sequence 9 is had through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 9 identical The DNA molecular of function；

The primer DENV3-R is following (f3) or (f4)；

(f3) single strand dna shown in the sequence 10 of sequence table；

(f4) sequence 10 had into phase through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 10 The DNA molecular of congenerous；

(f5) single strand dna as shown in the sequence 17 of sequence table；

(f6) sequence 17 had into phase through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 17 The DNA molecular of congenerous；

The primer DENV4-F is following (g1) or (g2)；

(g1) single strand dna shown in the sequence 11 of sequence table；

(g2) sequence 11 had into phase through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 11 The DNA molecular of congenerous；

The primer DENV4-R is following (g3) or (g4)；

(g3) single strand dna shown in the sequence 12 of sequence table；

(g4) sequence 12 had into phase through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 12 The DNA molecular of congenerous；

(g5) single strand dna as shown in the sequence 18 of sequence table；

(g6) sequence 18 had into phase through the replacement and/or disappearance and/or addition of one or several nucleotide and with sequence 18 The DNA molecular of congenerous.

2. a kind of special chip, is by the primed probe group I described in claim 1, primed probe group II, primed probe group IIIth, primed probe group IV, primed probe group V and primed probe group VI are embedded in the differential responses chamber of micro-fluidic chip respectively Obtain；

The function of the special chip is following (h1) or (h2)：

(h1) it is used for identifying zika virus, Chikungunya virus, I type of dengue virus, II type of dengue virus, dengue virus IV type of III type or dengue virus；

(h2) whether contain I type of zika virus and/or Chikungunya virus and/or dengue virus in being used for detecting sample to be tested And/or IV type of II type of dengue virus and/or III type of dengue virus and/or dengue virus.

3. the test kit first of primer combination of probe described in claim 1 is included or including micro-fluid chip described in claim 2 Test kit second.

4. test kit second as claimed in claim 3, it is characterised in that：The test kit is also combined including primer pair；It is described to draw Thing is made up of primer pair I, primer pair II, primer pair III, primer pair IV, primer pair V and primer pair VI to combination；

The primer pair I is made up of the primer ZIKV-F and primer ZIKV-R in the primed probe group I described in claim 1； The primer pair II is made up of the primer CHIKV-F and primer CHIKV-R in the primed probe group II described in claim 1； The primer pair III is made up of the primer DENV1-F and primer DENV1-R in the primed probe group III described in claim 1； The primer pair IV is made up of the primer DENV2-F and primer DENV2-R in the primed probe group IV described in claim 1； The primer pair V is made up of the primer DENV3-F and primer DENV3-R in the primed probe group V in claim 1； The primer pair VI is made up of the primer DENV4-F and primer DENV4-R in the primed probe group VI in claim 1.

5. test kit second as claimed in claim 4, it is characterised in that：The test kit also includes that reaction mixture BQ and enzyme are mixed Close liquid EQ；

Reaction mixture BQ：Tris-HCl buffer of the solvent for pH8.0,200mM；Solute and its concentration are as follows：DTT 50mM、 MgCl₂80mM, KCl 450mM, DMSO 15% (volumn concentration), Sorbitol 1M, dNTP 2mM, rNTP 4mM；

Enzyme mixation EQ：Solvent is water；Solute and its concentration are as follows：AMV reverse transcriptase 1U/ μ l, t7 rna polymerase 5U/ μ l, core Ribonuclease T. H 0.5U/ μ l, pyrophosphatase 0.5U/ μ l, RNase inhibitor 5U/ μ l, BSA 0.5 μ g/ μ l.

6. in claim 3 to 5 arbitrary test kit application, be following (h1) or (h2)：

7. a kind of whether method containing n kind target RNA sequences in detection sample to be tested, in turn includes the following steps：

(1) extract the total serum IgE of sample to be tested；

8. method as claimed in claim 7, it is characterised in that：N is more than 2 natural number；The recombinase polymeric enzymatic amplification Carry out in micro-fluid chip, each reaction chamber of micro-fluid chip is used for detecting a kind of target RNA sequence.

9. a kind of for detecting in sample to be tested the whether test kit containing n kind target RNA sequences, including carrying out reverse transcription restructuring The reagent of enzymatic polymerization enzymatic amplification and the reagent for carrying out recombinase polymeric enzymatic amplification.

10. test kit as claimed in claim 9, it is characterised in that：The test kit also includes special chip；The special core Piece is will to be embedded in the differential responses of micro-fluid chip for the primed probe group for detecting the corresponding DNA of every kind of target RNA respectively What chamber obtained；Each primed probe group is made up of pair of primers and a probe.