CN105039596B - A kind of kit and its application for being used to detect parainfluenza virus - Google Patents

A kind of kit and its application for being used to detect parainfluenza virus Download PDF

Info

Publication number
CN105039596B
CN105039596B CN201510468275.2A CN201510468275A CN105039596B CN 105039596 B CN105039596 B CN 105039596B CN 201510468275 A CN201510468275 A CN 201510468275A CN 105039596 B CN105039596 B CN 105039596B
Authority
CN
China
Prior art keywords
sequence
probe
primer pair
parainfluenza virus
kit
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201510468275.2A
Other languages
Chinese (zh)
Other versions
CN105039596A (en
Inventor
张岩
盖伟
邢婉丽
马桂红
程京
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tsinghua University
CapitalBio Corp
Original Assignee
Tsinghua University
CapitalBio Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tsinghua University, CapitalBio Corp filed Critical Tsinghua University
Priority to CN201510468275.2A priority Critical patent/CN105039596B/en
Publication of CN105039596A publication Critical patent/CN105039596A/en
Application granted granted Critical
Publication of CN105039596B publication Critical patent/CN105039596B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of kit and its application for being used to detect parainfluenza virus.Contain the primer pair group for being used for detecting parainfluenza virus in kit provided by the present invention, be made up of 3 primer pairs, its sequence is sequence 16 in sequence table.Kit provided by the invention supports high flux, parainfluenza virus infection can quickly and accurately be detected, for clinic, the testing result that 3 kinds of viral indexs can be obtained in 1 hour is not only faster than the real time fluorescence quantifying PCR method more generally used at present, and also significant for the treatment of quick auxiliary direction and medication.Meanwhile the detection of multi objective can be used for regional epidemiological survey and epidemic situation monitoring, to study popularity of the parainfluenza virus infection in China.

Description

A kind of kit and its application for being used to detect parainfluenza virus
Technical field
The invention belongs to nucleic acid amplification technologies field, is related to a kind of kit for being used to detect parainfluenza virus and its answers With.
Background technology
Human parainfluenza virus (HPIVs) are one kind virus for often causing children's ALRI, and its is pathogenic only Inferior to Respiratory Syncytial Virus(RSV) (RSV).As RSV, human parainfluenza virus can cause the upper respiratory tract sense of recurrent exerbation Contaminate (such as catch a cold and have a sore throat).It can also cause lower respiratory illness (such as pneumonia, the bronchitis and thin of serious repeated infection Bronchitis), particularly in the elderly and immune deficiency crowd.
Human parainfluenza virus can be divided into 4 types (I types to IV types) from serology.Four kinds of hypotypes have nothing in common with each other clinic and Epidemiologic feature.I types and the most typical Clinical symptoms of II types are to cause children's laryngotracheobronchitis, and I types are this children The main reason for laryngotracheobronchitis, II types take second place.I types and II types can cause the other upper respiratory tract and lower respiratory tract diseases Disease.Type III frequently results in pneumonia and capillary bronchitis.IV types are difficult detection, it may be possible to because it seldom causes serious disease. The incubation period of human parainfluenza virus is typically at 1~7 day or so.
Rapid&Early diagnosis parainfluenza virus infection can guiding clinical treatment be in time reasonable selection antiviral antibacterial Medicine offer foundation is simultaneously significant in terms of abuse of antibiotics is prevented.
The method of detection parainfluenza virus is more at present, but all Shortcomings, such as Electronic Speculum detection method complex and expensive, virus It is separately cultured time-consuming extremely length and false negative is more, clinical meaning, ELISA inspection has generally been lost after cultivation results are taken That surveys is special viral antibody but is once only capable of detecting a kind of virus.And the detection of nucleic acids based on nucleic acid amplification, due to speed Hurry up and (can complete to detect in usual 3 hours), high sensitivity, specificity it is good, be increasingly becoming goldstandard in field of virus detection.
The amplification technique (Nucleic Acid Sequence Based Amplification) of nucleotide sequence is relied on, i.e., NASBA amplification techniques, it is to be mediated by pair of primers, be specific in vitro and continuous homogeneous to single stranded RNA progress constant temperature expansion The process of increasing.Under 41 DEG C of constant temperatures, in terms of reaction speed, template ribonucleic acid can be expanded about 10 by NASBA amplifications 1h9~1012 Times, and common PCR reactions need 2~3h.In terms of detection sensitivity, NASBA, which can be detected, is less than 10gene in solution Copies/ μ l trace target, and PCR test limit is in 100gene copies/ μ l or so.Therefore, NASBA technologies are either Amplification efficiency or detection sensitivity are all higher than RT-PCR technology.And because NASBA reaction only needs one 41 DEG C of perseverance Warm condition, water-bath can meet that reaction requires, it is not necessary to the temperature control device that the Standard PCR such as complicated heating and cooling is relied on, because The instrument cost of this NASBA technology is very cheap.Combined with corresponding detection technique, NASBA also has easy to operate, specific Many advantages, such as strong.
The content of the invention
First purpose of the present invention is to provide a kind of primer pair group for being used to detect parainfluenza virus.
The primer pair group provided by the present invention for being used to detect parainfluenza virus, is made up of following 3 primer pairs:
The primer pair 1 being made up of two single strand dnas shown in sequence in sequence table 1 and sequence 2;By sequence in sequence table The primer pair 2 of two single strand dnas composition shown in row 3 and sequence 4;As two shown in sequence in sequence table 5 and sequence 6 The primer pair 3 of single strand dna composition.
Wherein, the primer pair 1 (PIV1) is used to expand parainfluenza virus I types;The primer pair 2 (PIV2) is used to expand Parainfluenza virus II types;The primer pair 3 (PIV3) is used to expand parainfluenza virus type III.
Second object of the present invention is to provide a kind of complete single stranded DNA for being used to detect parainfluenza virus.
The complete single stranded DNA provided by the present invention for being used to detect parainfluenza virus, by probe groups and the primer pair group Composition;The probe groups are made up of following 3 ssDNA probes:SsDNA probe 1 in sequence table shown in sequence 7;Sequence SsDNA probe 2 in table shown in sequence 8;SsDNA probe 3 in sequence table shown in sequence 9.
Wherein, the ssDNA probe 1 (PIV1_TY_MB) is used for the amplification for monitoring the primer pair 1 in real time;Institute State the amplification that ssDNA probe 2 (PIV2_TY_MB) is used to monitor the primer pair 2 in real time;The ssDNA probe 3 (PIV3_TY_MB) it is used for the amplification for monitoring the primer pair 3 in real time.
5 ' the ends mark of every ssDNA probe in the probe groups has FAM, and 3 ' ends mark There is fluorescent quenching group TAMRA.
In the complete single stranded DNA provided by the present invention, each primer pair and its corresponding ssDNA probe can be single Solely it is packaged in a packaging.As the primer pair 1 and the ssDNA probe 1 are packaged in first packaging;The primer 2 and the ssDNA probe 2 are packaged in second packaging;The primer pair 3 and the ssDNA probe 3 are packaged in In three packagings.
Third object of the present invention is to provide a kind of kit for being used to detect parainfluenza virus.
The kit provided by the present invention for being used to detect parainfluenza virus, contains the primer pair group or the complete list Chain DNA.
The kit can also contain internal reference primer pair and internal reference probe.The internal reference primer pair is for expanding House-keeping gene GAPDH mRNA primer pair GAPD_IC in human genome, as two shown in sequence in sequence table 10 and sequence 11 Bar single strand dna forms.The internal reference probe (GAPD_IC_MB) is that the single stranded DNA in sequence table shown in sequence 12 is visited Pin, for monitoring the amplification of the internal reference primer pair (GAPD_IC) in real time.
5 ' ends of the internal reference probe are marked with fluorescent reporter group FAM, and 3 ' ends are marked with fluorescent quenching group TAMRA。
Constant-temperature amplification buffer solution and constant-temperature amplification enzyme solutions can also be contained in the kit.
The solvent of the constant-temperature amplification buffer solution is water, and solute and concentration are as follows:200mM pH 8.0 Tris-HCL, 50mM DTT, 10mM dNTP, 10mM rNTP, 80mM MgCl2, 450mM KCl, 15% volumn concentration DMSO, 1M sorb Alcohol, 20mM tetramethyl ammonium chlorides.
The solvent of the constant-temperature amplification enzyme solutions is water, and solute and concentration are as follows:AMV reverse transcriptase 1U/ μ l, T7RNA gather Synthase 5U/ μ l, ribonuclease H 0.5U/ μ l, pyrophosphatase 0.5U/ μ l, RNase inhibitor 5U/ μ l, BSA0.5 μ g/ μ l.
Dish-style chip can also be contained in the kit, such as 24 reaction chamber dish-style chips.
In the present invention, the 24 reaction chamber dish-style chip is " the brilliant core of Capitalbio Corporation Co., Ltd.'s production The supporting dish-style chip of RTisochipTM-A constant-temperature amplification micro-fluidic chips nucleic acids instrument ", its model 1 × 24.
The 1# of the dish-style chip deposits dry following (1)-(5) to 5# reaction chambers respectively:
(1) primer pair 1 and the ssDNA probe 1;(2) primer pair 2 and the ssDNA probe 2;(3) The primer pair 3 and the ssDNA probe 3;(4) the internal reference primer pair and the internal reference probe;(5) negative control Product.
The negative controls concretely water without RNase (Rnase-free water).
Wherein, the method for primer and probe being embedded into dish-style chip is:By primer, the spy corresponding with the primer Pin, agarose mixing, are configured to mixed solution, make the primer, the probe and the agarose in the mixed solution Final concentration be respectively 0.2 μM, 50nM, 0.1% (weight/mass percentage composition);Mixed solution described in 1 μ l is taken to click and enter corresponding dish-style Chip reaction chamber, after being dried in clean super-clean bench, tabletting encapsulation, punching press is made after vacuumizing.
The primer pair group or complete single stranded DNA or kit are non-diagnostic in detecting or aiding in detection parainfluenza virus Purpose application falls within protection scope of the present invention.
In the application, by constant-temperature amplification enzyme solutions described in constant-temperature amplification buffer solution described in 15 μ l and 10 μ l, with 25 μ l It is injected into after the mixing of sample to be tested solution in the dish-style chip, isothermal reaction 1h at 41 DEG C.
In the application, sample to be tested can be used as using Nasopharyngeal swabs;Accordingly, the sample to be tested solution can be from nose The RNA extracted in throat swab.
In the present invention, the parainfluenza virus is concretely at least one of following:Parainfluenza virus I types, sidestream Influenza Virus II types and parainfluenza virus type III.
Kit provided by the invention supports high flux, parainfluenza virus infection can be quickly and accurately detected, for clinic For, the testing result that 3 kinds of parainfluenza virus indexs can be obtained in 1 hour is not only faster than the reality more generally used at present When fluorescence quantifying PCR method, and for quick auxiliary direction treatment and medication it is also significant.Meanwhile multi objective Detection can be used for regional epidemiological survey and epidemic situation monitoring, to study prevalence of the parainfluenza virus infection in China Situation.
Brief description of the drawings
Fig. 1 is dish-style chip and primer sample application cavity schematic diagram.
Fig. 2 is 3 kinds of parainfluenza virus reference material dish-style chip testing result figures.Wherein, A is to contain parainfluenza virus I types Testing results of the recombinant plasmid pUC19-PIV1 of target gene in 1# reaction chambers;B is to contain parainfluenza virus II type target bases Testing results of the recombinant plasmid pUC19-PIV2 of cause in 2# reaction chambers;C is the weight containing parainfluenza virus type III target gene Testing results of the group plasmid pUC19-PIV3 in 3# reaction chambers.In A-C, E1 represents that template is 101Copy/μ l, by that analogy, E5 It is 10 to represent template5Copy/μ l;NC represents negative control.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material used, reagent etc., unless otherwise specified, are commercially obtained in following embodiments.
The preparation and its use of embodiment 1, kit for detecting parainfluenza virus
First, for the preparation for the kit for detecting parainfluenza virus
Kit forms provided by the present invention for detecting parainfluenza virus are as follows:
1st, constant-temperature amplification buffer solution
The solvent of constant-temperature amplification buffer solution is water, and solute and concentration are as follows:200mM Tris-HCL (pH 8.0), 50mM DTT, 10mM dNTP, 10mM rNTP, 80mM MgCl2, 450mM KCl, 15% volumn concentration DMSO, 1M sorbierite, 20mM tetramethyl ammonium chlorides.
2nd, constant-temperature amplification enzyme solutions
The solvent of constant-temperature amplification enzyme solutions is water, and solute and concentration are as follows:AMV reverse transcriptase 1U/ μ l, t7 rna polymerase 5U/ μ l, ribonuclease H 0.5U/ μ l, the μ g/ μ l of pyrophosphatase 0.5U/ μ l, RNase inhibitor 5U/ μ l, BSA 0.5.
3rd, 24 reaction chamber dish-style chips of primer pair and ssDNA probe are mounted with
The 24 reaction chamber dish-style chip is " the brilliant core RTisochipTM-A perseverances of Capitalbio Corporation Co., Ltd.'s production The supporting dish-style chip of temperature amplification micro-fluidic chip nucleic acids instrument ", its model 1 × 24, schematic diagram is as shown in Figure 1.
The 1# of the 24 reaction chamber dish-style chip deposits dry following (1)-(5) to 5# reaction chambers respectively:
(1) primer pair 1 and ssDNA probe 1;(2) primer pair 2 and ssDNA probe 2;(3) primer pair 3 and single stranded DNA Probe 3;(4) internal reference primer pair and internal reference probe;(5) negative controls.The negative controls are specially without RNase Water (Rnase-free water).
Wherein, the primer pair 1 (PIV1) is used to expand parainfluenza virus I types, by sequence in sequence table 1 and the institute of sequence 2 The two single strand dnas composition shown;The primer pair 2 (PIV2) is used to expand parainfluenza virus II types, by sequence in sequence table Two single strand dnas composition shown in row 3 and sequence 4;The primer pair 3 (PIV3) is used to expand parainfluenza virus type III, It is made up of two single strand dnas shown in sequence in sequence table 5 and sequence 6.The internal reference primer pair (GAPD_IC) is used for House-keeping gene GAPDH mRNA in human genome are expanded, as two single stranded DNAs shown in sequence in sequence table 10 and sequence 11 point Son composition.
The ssDNA probe 1 (PIV1_TY_MB) is used for the amplification for monitoring the primer pair 1 in real time, its nucleosides Acid sequence is sequence 7 in sequence table;The ssDNA probe 2 (PIV2TY MB) is used for the expansion for monitoring the primer pair 2 in real time Increase result, its nucleotides sequence is classified as sequence 8 in sequence table;The ssDNA probe 3 (PIV3_TY_MB) is used to monitor institute in real time The amplification of primer pair 3 is stated, its nucleotides sequence is classified as sequence 9 in sequence table.The internal reference probe (GAPD_IC_MB) is used In the amplification for monitoring the internal reference primer pair (GAPD_IC) in real time, its nucleotides sequence is classified as sequence 12 in sequence table.Often 5 ' the ends mark of ssDNA probe described in bar and the internal reference probe (GAPD_IC_MB) has FAM, 3 ' ends mark has TAMRA.
Wherein, the method for primer and probe being embedded into dish-style chip is:By primer, the spy corresponding with the primer Pin, agarose mixing, are configured to mixed solution, make the primer, the probe and the agarose in the mixed solution Final concentration be respectively 0.2 μM, 50nM, 0.1% (weight/mass percentage composition);Mixed solution described in 1 μ l is taken to click and enter corresponding dish-style Chip reaction chamber, after being dried in clean super-clean bench, tabletting encapsulation, punching press is made after vacuumizing.
2nd, for the application method for the kit for detecting parainfluenza virus
1st, reaction system is prepared
15 μ l constant-temperature amplifications buffer solutions (see step 1 1), 10 μ l constant-temperature amplifications enzyme solutions (see step 1 2), 25 μ l are taken to treat This liquid of test sample is mixed into 50 μ l reaction solutions, after vortex concussion uniformly injection be mounted with primer pair and the 24 of ssDNA probe anti- Chamber dish-style chip (see step 1 3) is answered, seals Quick spin 30s after membrana oralis.
2nd, isothermal amplification reactions and detection
Dish-style chip is placed in rich Isochip-RT constant-temperature amplifications instrument difficult to understand, sets 41 DEG C to react 1 hour, and complete simultaneously Real-time fluorescence scans.
3rd, result judges
After reaction terminates, according to the amplification curve of sample in each reaction chamber, the sample to be tested is determined as follows Whether the genome of corresponding parainfluenza virus is contained in liquid:If the testing sample produces S type amplification curves, described to treat test sample Contain the genome of corresponding parainfluenza virus in this liquid;Conversely, then corresponding parainfluenza virus is not contained in the sample to be tested liquid Genome.
Embodiment 2, the analysis of the sensitivity and specificity of kit for detecting parainfluenza virus
First, the preparation of reference material RNA nucleic acid
1st, structure includes the plasmid of parainfluenza virus target gene
(1) plasmid containing parainfluenza virus I type target genes
By 464~1296 sections (the parainfluenza virus I type target gene sequences of parainfluenza virus I type target gene sequences Genbank Sequence ID:Gb | JF416791.1 |, Update Date:2014-12-31) it is inserted into pUC19 carriers Between the multiple cloning sites EcoR V of (day is with biochemical corp's product).Obtain recombinant plasmid pUC19-PIV1.
(2) plasmid containing parainfluenza virus II type target genes
By 2568~3629 sections (the parainfluenza virus II type target gene sequences of parainfluenza virus II type target gene sequences The Genbank Sequence ID of row:Gb | DQ072586.1 |, Update Date:2008-9-4) it is inserted into pUC19 carriers Between the multiple cloning sites EcoR V of (day is with biochemical corp's product).Obtain recombinant plasmid pUC19-PIV2.
(3) plasmid containing parainfluenza virus type III target gene
By 211~1190 sections (the parainfluenza virus type III target gene of parainfluenza virus type III target gene sequence The Genbank Sequence ID of sequence:Dbj | AB623488.1 |, Update Date:2014-7-26) it is inserted into pUC19 Between the multiple cloning sites EcoR V of carrier (day is with biochemical corp's product).Obtain recombinant plasmid pUC19-PIV3.
2nd, the preparation of reference material RNA nucleic acid
For trying recombinant plasmid:3 kinds of recombinant plasmids for containing corresponding parainfluenza virus target gene that step 1 is built.
(1) digestion:First 37 DEG C of digestion 2h of EcoRI restriction endonucleases are used by each for examination recombinant plasmid.
(2) transcribe:It polymerize by 5 μ l 5 × Transcription Optimized Buffer (Promega), 2U T7RNA Enzyme, 10mM DTT (Promega), 10U recombinant RNAs enzyme inhibitor (Promega), 2mM rNTP, the μ l of digestion products 5 prepare overall Product is 50 μ l reaction system, 37 DEG C of transcription 4h after shaking uniformly.
(3) digest:System after the completion of transcription is added to 1 μ l DNA digestive ferments (rDnaseI, 5U/ μ l), concussion centrifuges, 37 DEG C of incubation 20min.
(4) purify:Using the RNA purification kits products of Macherey-Nagel companies, (its catalog number is 740948) transcription product RNA is purified as follows:A) RA1-C is prepared2H5OH mixed liquors:With RA1:C2H5OH=1:1 (volume Than) ratio prepare., it is necessary to add 600 μ l RA1-C in every 100 μ l transcription product2H5OH mixed liquors, i.e. 300 μ l RA1+ 300μl C2H5OH solution, need to calculate the volume for matching somebody with somebody mixed liquor according to the pipe number of transcription product herein.If product is insufficient 100 μ l, then the amount of product is mended to 100 μ l with water and (50 μ l Tiangeng Rnase-free H are added in every pipe product2O)。 B) the ready RA1-C by before2H5OH mixed liquors are assigned in 1.5ml centrifuge tubes, two pipes, often the μ l of pipe 600, and 100 μ l products are turned Enter into corresponding centrifuge tube, totally 700 μ l, fully shaking centrifuge in pipe.C) prepare two adsorption columns, and carry out corresponding mark Note, 700 μ l product mixtures are transferred in adsorption column (adsorption column maximum capacity is 700 μ l), 1.2 ten thousand rpm centrifugation 2min, are fallen Fall down a layer solution.D) 700 μ l RA3 is added in adsorption column, 1min is placed, it is sufficiently dispersed in the bottom of adsorption column Portion, 1.2 ten thousand rpm centrifugation 2min, outwells lower floor's solution.E) 350 μ l RA3 is added in adsorption column, places 2min, 1.2 ten thousand rpm 2min is centrifuged, outwells lower floor's solution.F) 300 μ l RA3 is added in adsorption column, 2min is placed, 1.2 ten thousand rpm centrifugation 2min, falls Fall down a layer solution.G) after the lid 3min for opening adsorption column, 1.2 ten thousand rpm skies outwell lower floor's solution, repeat this step from 2min Once.H) it is empty from end after, adsorption column is transferred in corresponding centrifuge tube, opens adsorption column lid and place 15min, make Ethanol volatilization is complete, and 60 μ l Rnase-H are added in adsorption column2O (carries) elution in kit, place 2min, and 1.2 ten thousand Rpm centrifuges 2min.I) centrifugation gained template is sucked back in adsorption column, places 2min, 1.2 ten thousand rpm centrifugation 2min, repeat this step Twice.J) adsorption column is lost, the template in centrifuge tube is taken out into 2 μ l, determines its concentration with Nano drop, and record its concentration And its 260/280,260/230 ratio.
2nd, for the sensitivity and specificity analysis for the kit for detecting parainfluenza virus
1st, prepared by the reference material template of various concentrations
It is fixed that each RNA templates (the 3 kinds of recombinant plasmids built in corresponding step 1 1) of above-mentioned steps one after purification are calculated Measure to 1010Copy/μ l, and gradient dilution, obtain 105Copy/μ l, 104Copy/μ l, 103Copy/μ l, 102Copy/μ l, 10 are copied The template dilution of the various concentrations such as shellfish/μ l.
2nd, reaction system is prepared
15 μ l constant-temperature amplifications buffer solutions are taken (see the step 1) of embodiment 1,10 μ l constant-temperature amplifications enzyme solutions (see the step of embodiment 1 2), the template dilution of 25 μ l concentration is mixed into 50 μ l reaction solutions, after vortex concussion uniformly injection be mounted with primer pair and 24 reaction chamber dish-style chips of ssDNA probe (see the step 3) of embodiment 1, seal Quick spin 30s after membrana oralis.
3rd, isothermal amplification reactions and detection
Dish-style chip is placed in rich Isochip-RT constant-temperature amplifications instrument difficult to understand, sets 41 DEG C to react 1 hour, and complete simultaneously Real-time fluorescence scans.And result is judged according to the method for the step 23 of embodiment 1.
3rd, result
As a result it is as shown in Figure 2:
(1) for recombinant plasmid pUC19-PIV1 RNA sample, the 1# reaction chambers pair of 24 reaction chamber dish-style chips 105Copy/μ l, 104Copy/μ l, 103Copy/μ l, 102The testing result of copy/μ l, 10 copies/μ l templates has obvious S Type amplification curve, it is shown as positive;And 2# and 3# reaction chambers are shown as negative without amplification curve.
(2) for recombinant plasmid pUC19-PIV2 RNA sample, the 2# reaction chambers pair of 24 reaction chamber dish-style chips 105Copy/μ l, 104Copy/μ l, 103Copy/μ l, 102The testing result of copy/μ l, 10 copies/μ l templates has obvious S Type amplification curve, it is shown as positive;And 1# and 3# reaction chambers are shown as negative without amplification curve.
(3) for recombinant plasmid pUC19-PIV3 RNA sample, the 3# reaction chambers pair of 24 reaction chamber dish-style chips 105Copy/μ l, 104Copy/μ l, 103Copy/μ l, 102The testing result of copy/μ l, 10 copies/μ l templates has obvious S Type amplification curve, it is shown as positive;And 1# and 2# reaction chambers are shown as negative without amplification curve.
In addition, for the RNA sample of 3 kinds of all recombinant plasmids, the 4# reaction chambers of 24 reaction chamber dish-style chips are (interior Control) and 5# reaction chambers (negative control) without amplification curve.4# reaction chambers (internal reference) why without amplification curve be because Sample to be tested is the RNA nucleic acid of 3 kinds of recombinant plasmids, does not contain the RNA of house-keeping gene GAPDH in human genome.
It these results suggest that the kit has higher amplification sensitivity and specific amplification.
The detection of embodiment 3, actual clinical sample
First, clinical sample type
The present embodiment use clinical sample from Shenzhen San Yuan in collection Nasopharyngeal swabs sample (in line with this picker from The principle of hope), adopt swab and deposit in 3mL physiological saline, totally 560.
2nd, in clinical sample viral nucleic acid extraction
Clinical sample viral nucleic acid extraction kit used is QIAamp Viral RNA Mini Kit (Qiagen), Extracted as follows:
(1) take and the μ l of physiological saline 140 of clinical sample swab are deposited in step 1 in 1.5ml centrifuge tubes;
(2) Buffer AVL (the i.e. 5.6 μ l Carrier RNA mixing that 560 μ l contain Carrier RNA mixed liquors is added The μ l Buffer of liquid+560 AVL are in centrifuge tube, slight whirlpool 15s;
(3) after the completion of brief centrifugation, (15-25 DEG C) placement 10-20min of room temperature, to ensure Buffer AVL in centrifuge tube In have abundance time cracked;
(4) 560 μ l ethanol (96-100%, volumn concentration) are added in centrifuge tube, whirlpool mixes 15s, centrifugation;
(5) 630 μ l sample solutions are taken in adsorption column, 2min is placed, it is fully contacted with adsorption column, 8000rpm, from Heart 1min, change clean collecting pipe;
(6) if sample solution is more than 630 μ l, repeatedly previous step;
(7) 500 μ l AW1 washing lotions are added in adsorption column, 2min is placed, it is fully contacted with adsorption column, 8000rpm 1min is centrifuged, changes clean collecting pipe;
(8) 500 μ l AW2 washing lotions are added in adsorption column, 2min is placed, it is fully contacted with adsorption column, 12000rpm centrifuges 3min, changes clean collecting pipe;
(9) 300 μ l AW2 washing lotions are added in adsorption column, 2min is placed, it is fully contacted with adsorption column, 12000rpm centrifuges 3min, changes clean collecting pipe;
(10) adsorption column lid is opened and places 2min, make that its inside and outside pressure is consistent, and 8000rpm skies are from 1min.It is empty from knot Shu Yihou, repeat this step once.
(11) it is empty from end after, adsorption column is transferred in 1.5ml centrifuge tubes, open adsorption column lid, place 20-30min, Make ethanol volatilization complete;
(12) 50 μ l Buffer AVE elution nucleic acid, 8000rpm centrifugation 1min, after centrifugation is completed, by under elution are added Nucleic acid suck back adsorption column, lose adsorption column after centrifuging 1min.
3rd, the detection of actual clinical sample
1st, reaction system is prepared
15 μ l constant-temperature amplifications buffer solutions (see the step 11 of embodiment 1), 10 μ l constant-temperature amplifications enzyme solutions are taken (see the step of embodiment 1 Rapid 1 2), the clinical sample solution that 25 μ l step 2 are extracted to obtain is mixed into 50 μ l reaction solutions, is injected after vortex concussion uniformly It is mounted with the 24 reaction chamber dish-style chips (see the step 13 of embodiment 1) of primer pair and ssDNA probe, seals rapid after membrana oralis Centrifuge 30s.
2nd, isothermal amplification reactions and detection
Dish-style chip is placed in rich Isochip-RT constant-temperature amplifications instrument difficult to understand, sets 41 DEG C to react 1 hour, and complete simultaneously Real-time fluorescence scans.And result is judged according to the method for the step 23 of embodiment 1.
Experiment sets reliability demonstration of the conventional RT-PCR method for kit testing result of the present invention simultaneously.For examining It is as shown in table 1 to survey each viral specific RT-PCR primer sequence.
Table 1 is used for the specific RT-PCR primer sequence for detecting 3 kinds of parainfluenza viruses
Index name RT-PCR sense primers (5 ' -3 ') RT-PCR anti-sense primers (5 ' -3 ')
Parainfluenza virus I types GTAGTCTCATTCACAGTGGGYAAGGA ATCTCATTATTACCYGGACCAAGTCT
Parainfluenza virus II types TACAAGACACAACCTCCTGGTATAGCA GGACGCCTAAATATGGACCTCTCCT
Parainfluenza virus type III TCTCTCTGTGTTTTCCCVGGACACCC GACTTAAATCCYAGGATCTCTCATAC
4th, result
The testing result of kit of the present invention is shown, for each parainfluenza virus, sun is detected using RT-PCR method Property sample example using kit of the present invention detection show positive findings.In addition, for a few sample example, using RT- The detection of PCR methods is negative, but uses kit testing result of the present invention as the positive.Adopted again by the way that these sample examples are carried out with the later stage Sample RT-PCR is detected, it is found that it is positive these sample examples are detected as corresponding parainfluenza virus really.It is indicated above, kit of the present invention RT-PCR methods are higher than to the recall rate of corresponding parainfluenza virus, and its testing result is accurately and reliably.Kit and RT- of the present invention The statistical result of PCR methods detection parainfluenza virus clinical sample is referring to table 2.
The statistical result of 2 kit of the present invention of table and RT-PCR methods detection parainfluenza virus clinical sample

Claims (3)

1. the kit for detecting parainfluenza virus, contains probe groups and primer pair group;
The primer pair group, it is made up of following 3 primer pairs:Sequence 1 and the primer pair 1 shown in sequence 2 in sequence table;Sequence table Primer pair 2 shown in middle sequence 3 and sequence 4;Sequence 5 and the primer pair 3 shown in sequence 6 in sequence table;
The probe groups are made up of following 3 probes:Probe 1 in sequence table shown in sequence 7;In sequence table shown in sequence 8 Probe 2;Probe 3 in sequence table shown in sequence 9;
5 ' the ends mark of each probe in the probe groups has FAM, and 3 ' ends mark has Group TAMRA;
The kit also contains internal reference primer pair and internal reference probe;Sequence 10 in the internal reference primer pair such as sequence table Shown in sequence 11;The internal reference probe is the probe shown in sequence 12 in sequence table;5 ' end marks of the internal reference probe Note has fluorescent reporter group FAM, and 3 ' ends are marked with fluorescent quenching group TAMRA;
Also contain dish-style chip in the kit;
The 1# of the dish-style chip deposits dry as follows respectively to 5# reaction chambers(1)-(5):
(1)The primer pair 1 and the probe 1;
(2)The primer pair 2 and the probe 2;
(3)The primer pair 3 and the probe 3;
(4)The internal reference primer pair and the internal reference probe;
(5)Negative controls;
The dish-style chip is 24 reaction chamber dish-style chips.
2. kit according to claim 1, it is characterised in that:In the kit also containing constant-temperature amplification buffer solution and Constant-temperature amplification enzyme solutions;
The solvent of the constant-temperature amplification buffer solution is water, and solute and concentration are as follows:200mM pH 8.0 Tris-HCL, 50mM DTT, 10mM dNTP, 10mM rNTP, 80mM MgCl2, 450mM KCl, 15% volumn concentration DMSO, 1M sorbierite, 20mM tetramethyl ammonium chlorides;
The solvent of the constant-temperature amplification enzyme solutions is water, and solute and concentration are as follows:AMV reverse transcriptase 1U/ μ l, T7 RNA polymerize Enzyme 5U/ μ l, ribonuclease H 0.5U/ μ l, the μ g/ μ l of pyrophosphatase 0.5U/ μ l, RNase inhibitor 5U/ μ l, BSA 0.5.
3. kit according to claim 1 or 2, it is characterised in that:The parainfluenza virus is at least one in following Kind:Parainfluenza virus I types, parainfluenza virus II types and parainfluenza virus type III.
CN201510468275.2A 2015-08-03 2015-08-03 A kind of kit and its application for being used to detect parainfluenza virus Active CN105039596B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510468275.2A CN105039596B (en) 2015-08-03 2015-08-03 A kind of kit and its application for being used to detect parainfluenza virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510468275.2A CN105039596B (en) 2015-08-03 2015-08-03 A kind of kit and its application for being used to detect parainfluenza virus

Publications (2)

Publication Number Publication Date
CN105039596A CN105039596A (en) 2015-11-11
CN105039596B true CN105039596B (en) 2017-11-10

Family

ID=54446562

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510468275.2A Active CN105039596B (en) 2015-08-03 2015-08-03 A kind of kit and its application for being used to detect parainfluenza virus

Country Status (1)

Country Link
CN (1) CN105039596B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109207640B (en) * 2018-10-23 2023-06-02 深圳市亿立方生物技术有限公司 Primer group, probe group and kit for detecting various respiratory viruses and application of primer group, probe group and kit
CN111621585B (en) * 2020-04-16 2021-03-02 大连民族大学 Rapid detection kit for simultaneously detecting multiple transgenic rape lines and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101545015A (en) * 2009-05-11 2009-09-30 北京海康基因芯片开发有限公司 Method for detecting infectious disease pathogens and kit
CN103831140A (en) * 2014-03-07 2014-06-04 博奥生物集团有限公司 Micro-fluidic chip for multi-index detection
CN103993104A (en) * 2014-05-27 2014-08-20 福建省立医院 Primer group and probe group for detecting acute respiratory infectious diseases as well as application method and kit thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101545015A (en) * 2009-05-11 2009-09-30 北京海康基因芯片开发有限公司 Method for detecting infectious disease pathogens and kit
CN103831140A (en) * 2014-03-07 2014-06-04 博奥生物集团有限公司 Micro-fluidic chip for multi-index detection
CN103993104A (en) * 2014-05-27 2014-08-20 福建省立医院 Primer group and probe group for detecting acute respiratory infectious diseases as well as application method and kit thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Pyrosequencing on templates generated by asymmetric nucleic acid sequence-based amplification (asymmetric-NASBA);Huning Jia, et al;《Analyst》;20111231;第136卷;5229–5233 *
Sam Hibbitts,et al.Development and evaluation of NucliSens†Basic Kit NASBA for diagnosis of parainfluenza virus infection with ‘end-point’ and ‘realtime"detetion.《Journal of Virological Methods》.2003,第108卷145-155. *

Also Published As

Publication number Publication date
CN105039596A (en) 2015-11-11

Similar Documents

Publication Publication Date Title
CN105018648B (en) A kind of kit and its application for being used to detect Respirovirus
CN105112559B (en) A kind of kit and its application for being used to detect coronavirus
CN105039597B (en) A kind of kit and its application for being used to detect influenza virus
CN111778357B (en) CRISPR/Cas12 a-based respiratory syncytial virus nucleic acid rapid detection kit and detection method thereof
CN109576352A (en) Single tube detects method, probe and its kit of multiple object to be measured nucleic acid sequences
WO2022057060A1 (en) Method and kit for multiple detection of respiratory virus nucleic acids
CN105018488B (en) Kit and its application for detecting Respirovirus
CN106521032B (en) A kind of nucleic acid amplification technologies and its application in carapuru virus detection
CN105400907A (en) Kit for nucleic acid combined detection of influenza virus A, influenza virus B and respiratory syncytial virus
CN101942525B (en) One-tube method with multiplex detection for human Influenza A and B and new Influenza A H1N1 virus and kit
CN101948931A (en) Single-tube multiplex fluorescence PCR (Polymerase Chain Reaction) detection method and kit for 1,2,3-type parainfluenza viruses
CN112359145A (en) Multiple primers and kit for rapidly detecting influenza A, influenza B and novel coronavirus
CN103074449A (en) Kit for synchronously detecting thirteen diarrhea viruses and detection method of kit
CN105543414A (en) Respiratory syncytial virus A/B subtype multiplex fluorescence quantitative PCR detection primer set and probe set and reagent kit and preparation method thereof
CN107488748A (en) A kind of composition, kit and its detection method for being used to detect 23 kinds of respiratory pathogens
WO2023109031A1 (en) Respiratory pathogen detection kit, and preparation method therefor and use thereof
CN105112407B (en) A kind of kit and its application for being used to detect enterovirus
CN105039596B (en) A kind of kit and its application for being used to detect parainfluenza virus
CN103966356A (en) Human immunodeficiency virus type 1 one-step fluorescence quantitative RT-PCR detection kit
CN107574262A (en) A kind of fluorescence RT RAA primers, probe and detection method for being used to detect A (H 1 N 1) virus
CN108239676A (en) A kind of parainfluenza virus one-step method fluorescence parting RT-PCR detection kit
CN107083446A (en) Diarrhoea pathogenic bacteria multiple gene detection architecture and its kit and application
EP4163397A1 (en) Specimen transport kit for detecting respiratory pathogens and methods for detecting respiratory pathogens using same
CN105936945B (en) A kind of multiple reverse transcription quantitative PCR kit of four kinds of Respirovirus of joint inspection
CN106521035B (en) Gene chip detection kit and method for detecting 16 respiratory pathogens

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant