CN105039597A - Kit used for detecting influenza viruses and application thereof - Google Patents
Kit used for detecting influenza viruses and application thereof Download PDFInfo
- Publication number
- CN105039597A CN105039597A CN201510468283.7A CN201510468283A CN105039597A CN 105039597 A CN105039597 A CN 105039597A CN 201510468283 A CN201510468283 A CN 201510468283A CN 105039597 A CN105039597 A CN 105039597A
- Authority
- CN
- China
- Prior art keywords
- sequence
- primer pair
- probe
- influenza
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kit used for detecting influenza viruses and an application thereof. The kit comprises a primer pair set used for detecting the influenza viruses. The primer pair set is composed of four primer pairs, and the sequences of the primer pair set are the first sequence to the eighth sequence in the sequence table. According to the kit, the high throughput is supported, and influenza virus infections can be rapidly and accurately detected; in the clinical aspect, the detection results of four influenza virus indexes can be obtained in one hour, and the kit is rapider than a real-time fluorescence quantification PCR method commonly adopted at present, and is of great significance in rapid treating and pharmacy guiding assisting. Meanwhile, multi-index detection can be used for regional epidemiology investigating and surveying and regional epidemic surveillance to research the epidemic condition of the influenza virus infections in China.
Description
Technical field
The invention belongs to nucleic acid amplification technologies field, relating to a kind of test kit for detecting influenza virus and application thereof.
Background technology
Influenza (abbreviation influenza) is the acute respiratory infection that influenza virus causes, and has the advantages that infectivity is strong, velocity of propagation is fast.It is mainly through the spittle in air, interpersonal contact or the contact transmission with contaminated article.Typical clinical symptom is: anxious high heat, overall pain, significantly weak and slight respiratory symptom.General autumn and winter season is its high-incidence season, and caused complication and the phenomena of mortality are very serious.This disease is caused by influenza virus, first (A), second (B), third (C) three type can be divided into, often there is antigenic variation in influenza A virus, infectivity is large, propagate rapidly, very easily occur popular on a large scale, such as, in 1918 ~ 1919 years be very popular, the whole world has at least 2,000 ten thousand ~ 4,000 ten thousand people to die from influenza.The antigenic variation of Influenza B virus is less, usually only causes the local of influenza to break out.The antigen of influenza virus C is stablized, and virulence is more weak, the main crowd invading child and hypoimmunity.
Rapid&Early diagnosis influenza infection can in time guiding clinical treatment for choose reasonable antiviral antibacterial medicine provide according to and prevent in abuse of antibiotics significant.
The method of current detection common flow Influenza Virus is more, but all Shortcomings, as Electronic Speculum detection method complex and expensive, Viral isolation is consuming time extremely long and false negative is more, after taking cultivation results, usually lose clinical meaning, what euzymelinked immunosorbent assay (ELISA) detected is special viral antibody but once only can detects a kind of virus.And based on the detection of nucleic acids of nucleic acid amplification, due to speed fast (can complete detection in usual 3 hours), highly sensitive, specificity good, becomes gold standard just gradually in field of virus detection.
Rely on the amplification technique (NucleicAcidSequenceBasedAmplification) of nucleotide sequence, i.e. NASBA amplification technique, is mediated by pair of primers, specificity the homogeneous continuously process of single stranded RNA being carried out to constant-temperature amplification in vitro.Under 41 DEG C of constant temperatures, in speed of response, NASBA increases 1h can by template ribonucleic acid amplification about 10
9~ 10
12doubly, common PCR reaction needed 2 ~ 3h.In detection sensitivity, NASBA can detect the trace target lower than 10genecopies/ μ l in solution, and the detectability of PCR is at 100genecopies/ μ about l.Therefore, NASBA technology is that amplification efficiency or detection sensitivity are all higher than RT-PCR technology.And only needing the constant temperature of 41 DEG C due to the reaction of NASBA, water-bath can meet reaction requirement, and do not need the temperature control device that the Standard PCR such as complicated heating and cooling rely on, therefore the instrument cost of NASBA technology is very cheap.Be combined with corresponding detection technique, NASBA also has the plurality of advantages such as easy and simple to handle, high specificity.
Summary of the invention
First object of the present invention is to provide a kind of primer pair group for detecting influenza virus.
Primer pair group for detecting influenza virus provided by the present invention, is made up of following 4 primer pairs:
The primer pair 1 be made up of two single strand dnas shown in sequence in sequence table 1 and sequence 2; The primer pair 2 be made up of two single strand dnas shown in sequence in sequence table 3 and sequence 4; The primer pair 3 be made up of two single strand dnas shown in sequence in sequence table 5 and sequence 6; The primer pair 4 be made up of two single strand dnas shown in sequence in sequence table 7 and sequence 8.
Wherein, described primer pair 1 (InfA_TY) is for the influenza A virus that increases; Described primer pair 2 (InfA_H1) is for the influenza A virus H1 hypotype that increases; Described primer pair 3 (InfA_H3) is for the influenza A virus H3 hypotype that increases; Described primer pair 4 (InfB_TY) is for the Influenza B virus that increases.
Second object of the present invention is to provide a kind of complete single stranded DNA for detecting influenza virus.
Complete single stranded DNA for detecting influenza virus provided by the present invention, is made up of probe groups and described primer pair group; Described probe groups is made up of following 4 ssDNA probe: the ssDNA probe 1 in sequence table shown in sequence 9; SsDNA probe 2 in sequence table shown in sequence 10; SsDNA probe 3 in sequence table shown in sequence 11; SsDNA probe 4 in sequence table shown in sequence 12.
Wherein, described ssDNA probe 1 (InfA_TY_MB) is for the amplification of primer pair described in Real-Time Monitoring 1; Described ssDNA probe 2 (InfA_H1_MB) is for the amplification of primer pair described in Real-Time Monitoring 2; Described ssDNA probe 3 (InfA_H3_MB) is for the amplification of primer pair described in Real-Time Monitoring 3; Described ssDNA probe 4 (InfB_TY_MB) is for the amplification of primer pair described in Real-Time Monitoring 4.
5 ' end of the every bar ssDNA probe in described probe groups is all marked with fluorescent reporter group FAM, and 3 ' end is all marked with fluorescent quenching group TAMRA.
In described complete single stranded DNA provided by the present invention, the ssDNA probe of each primer pair and correspondence thereof can be packaged in separately in a packaging.As described in primer pair 1 and as described in ssDNA probe 1 be packaged in first packaging in; Described primer pair 2 and described ssDNA probe 2 are packaged in second packaging; Described primer pair 3 and described ssDNA probe 3 are packaged in the 3rd packaging; ; Described primer pair 4 and described ssDNA probe 4 are packaged in the 4th packaging.
3rd object of the present invention is to provide a kind of test kit for detecting influenza virus.
Test kit for detecting influenza virus provided by the present invention, containing described primer pair group or described complete single stranded DNA.
Described test kit also can contain internal reference primer pair and internal reference probe.Described internal reference primer pair is the primer pair GAPD_IC for house-keeping gene GAPDHmRNA in the human genome that increases, and is made up of two single strand dnas shown in sequence in sequence table 13 and sequence 14.Described internal reference probe (GAPD_IC_MB) is the ssDNA probe shown in sequence in sequence table 15, for the amplification of internal reference primer pair (GAPD_IC) described in Real-Time Monitoring.
5 ' end of described internal reference probe is marked with fluorescent reporter group FAM, and 3 ' end is marked with fluorescent quenching group TAMRA.
Also constant-temperature amplification damping fluid and constant-temperature amplification enzyme solution can be contained in described test kit.
The solvent of described constant-temperature amplification damping fluid is water, solute and concentration as follows: the Tris-HCL of 200mMpH8.0,50mMDTT, 10mMdNTP, 10mMrNTP, 80mMMgCl
2, 450mMKCl, 15% volumn concentration DMSO, 1M sorbyl alcohol, 20mM tetramethyl ammonium chloride.
The solvent of described constant-temperature amplification enzyme solution is water, solute and concentration as follows: AMV reversed transcriptive enzyme 1U/ μ l, t7 rna polymerase 5U/ μ l, ribonuclease H 0.5U/ μ l, Pyrophosphate phosphohydrolase 0.5U/ μ l, RNA enzyme inhibitors 5U/ μ l, BSA0.5 μ g/ μ l.
Also dish-style chip can be contained, as 24 reaction chamber butterfly chips in described test kit.
In the present invention, described 24 reaction chamber dish-style chips are the supporting dish-style chip of " the brilliant core RTisochipTM-A constant-temperature amplification micro-fluidic chip foranalysis of nucleic acids instrument " that Capitalbio Corporation Co., Ltd. produces, and its model is 1 × 24.
1# to the 6# reaction chamber of described dish-style chip deposits dry following (1)-(6) respectively:
(1) described primer pair 1 and described ssDNA probe 1; (2) described primer pair 2 and described ssDNA probe 2; (3) described primer pair 3 and described ssDNA probe 3; (4) described primer pair 4 and described ssDNA probe 4; (5) described internal reference primer pair and described internal reference probe; (6) negative controls.
Described negative controls specifically can be the water (Rnase-free water) without RNA enzyme.
Wherein, method primer and probe being embedded into dish-style chip is: primer, the probe corresponding with described primer, agarose are mixed, be mixed with mixing solutions, make described primer, described probe and the final concentration of described agarose in described mixing solutions be respectively 0.2 μM, 50nM, 0.1% (mass percentage); Get mixing solutions described in 1 μ l and click and enter corresponding dish-style chip reaction chamber, after drying in clean super clean bench, compressing tablet encapsulates, and makes after punching press vacuumizes.
Described primer pair group or complete single stranded DNA or test kit are detecting or non-diagnostic object application in auxiliary detection influenza virus also belongs to protection scope of the present invention.
In the application, by constant-temperature amplification enzyme solution described in constant-temperature amplification damping fluid described in 15 μ l and 10 μ l, be injected in described dish-style chip after mixing with 25 μ l sample to be tested solution, isothermal reaction 1h at 41 DEG C.
In the application, can Nasopharyngeal swabs as sample to be tested; Accordingly, described sample to be tested solution can be the RNA extracted from Nasopharyngeal swabs.
In the present invention, described influenza virus specifically can be at least one as follows: influenza A virus, influenza A virus H1 hypotype, influenza A virus H3 hypotype and Influenza B virus.
Test kit provided by the invention supports high-throughput, influenza infection can be detected quickly and accurately, for clinical, the detected result that can obtain 4 kinds of influenza virus indexs in 1 hour not only faster than the real time fluorescence quantifying PCR method comparatively generally adopted at present, and for quick auxiliary direction treatment and medication also significant.Meanwhile, the detection of multi objective also may be used for regional epidemiological survey and epidemic situation monitoring, infects the popularity in China to study flu virus.
Accompanying drawing explanation
Fig. 1 is dish-style chip and primer sample application cavity schematic diagram.
Fig. 2 is 4 kinds of influenza virus reference material dish-style chip detection result figure.Wherein, A is the detected result of the recombinant plasmid pUC19-InfA containing influenza A virus MP target gene at 1# reaction chamber; B is the detected result of the recombinant plasmid pUC19-InfA_H1 containing influenza A virus H1 hypotype target gene at 2# reaction chamber; C is the detected result of the recombinant plasmid pUC19-InfA_H3 containing influenza A virus H3 hypotype target gene at 3# reaction chamber; D is the detected result of the recombinant plasmid pUC19-InfB containing Influenza B virus MP target gene at 4# reaction chamber.In A-D, E1 represents that template is 10
1copy/μ l, by that analogy, E5 represents that template is 10
5copy/μ l; NC represents negative control.
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Embodiment 1, for detecting preparation and the use thereof of the test kit of influenza virus
One, for detecting the preparation of the test kit of influenza virus
Test kit for detecting influenza virus provided by the present invention is composed as follows:
1, constant-temperature amplification damping fluid
The solvent of constant-temperature amplification damping fluid is water, solute and concentration as follows: 200mMTris-HCL (pH8.0), 50mMDTT, 10mMdNTP, 10mMrNTP, 80mMMgCl
2, 450mMKCl, 15% volumn concentration DMSO, 1M sorbyl alcohol, 20mM tetramethyl ammonium chloride.
2, constant-temperature amplification enzyme solution
The solvent of constant-temperature amplification enzyme solution is water, solute and concentration as follows: AMV reversed transcriptive enzyme 1U/ μ l, t7 rna polymerase 5U/ μ l, ribonuclease H 0.5U/ μ l, Pyrophosphate phosphohydrolase 0.5U/ μ l, RNA enzyme inhibitors 5U/ μ l, BSA0.5 μ g/ μ l.
3,24 reaction chamber dish-style chips of primer pair and ssDNA probe are mounted with
Described 24 reaction chamber dish-style chips are the supporting dish-style chip of " the brilliant core RTisochipTM-A constant-temperature amplification micro-fluidic chip foranalysis of nucleic acids instrument " that Capitalbio Corporation Co., Ltd. produces, and its model is 1 × 24, and schematic diagram as shown in Figure 1.
1# to the 6# reaction chamber of described 24 reaction chamber dish-style chips deposits dry following (1)-(6) respectively:
(1) primer pair 1 and ssDNA probe 1; (2) primer pair 2 and ssDNA probe 2; (3) primer pair 3 and ssDNA probe 3; (4) primer pair 4 and described DNA probe 4; (5) internal reference primer pair and internal reference probe; (6) negative controls.Described negative controls is specially the water (Rnase-free water) without RNA enzyme.
Wherein, described primer pair 1 (InfA_TY), for the influenza A virus that increases, is made up of two single strand dnas shown in sequence in sequence table 1 and sequence 2; Described primer pair 2 (InfA_H1), for the influenza A virus H1 hypotype that increases, is made up of two single strand dnas shown in sequence in sequence table 3 and sequence 4; Described primer pair 3 (InfA_H3), for the influenza A virus H3 hypotype that increases, is made up of two single strand dnas shown in sequence in sequence table 5 and sequence 6; Described primer pair 4 (InfB_TY), for the Influenza B virus that increases, is made up of two single strand dnas shown in sequence in sequence table 7 and sequence 8.Described internal reference primer pair (GAPD_IC), for house-keeping gene GAPDHmRNA in the human genome that increases, is made up of two single strand dnas shown in sequence in sequence table 13 and sequence 14.
Described ssDNA probe 1 (InfA_TY_MB) is for the amplification of primer pair described in Real-Time Monitoring 1, and its nucleotides sequence is classified as sequence 9 in sequence table; Described ssDNA probe 2 (InfA_H1_MB) is for the amplification of primer pair described in Real-Time Monitoring 2, and its nucleotides sequence is classified as sequence 10 in sequence table; Described ssDNA probe 3 (InfA_H3_MB) is for the amplification of primer pair described in Real-Time Monitoring 3, and its nucleotides sequence is classified as sequence 11 in sequence table; Described ssDNA probe 4 (InfB_TY_MB) is for the amplification of primer pair described in Real-Time Monitoring 4, and its nucleotides sequence is classified as sequence 12 in sequence table.Described internal reference probe (GAPD_IC_MB) is for the amplification of internal reference primer pair (GAPD_IC) described in Real-Time Monitoring, and its nucleotides sequence is classified as sequence 15 in sequence table.5 ' end of ssDNA probe described in every bar and described internal reference probe (GAPD_IC_MB) is all marked with fluorescent reporter group FAM, and 3 ' end is all marked with fluorescent quenching group TAMRA.
Wherein, method primer and probe being embedded into dish-style chip is: primer, the probe corresponding with described primer, agarose are mixed, be mixed with mixing solutions, make described primer, described probe and the final concentration of described agarose in described mixing solutions be respectively 0.2 μM, 50nM, 0.1% (mass percentage); Get mixing solutions described in 1 μ l and click and enter corresponding dish-style chip reaction chamber, after drying in clean super clean bench, compressing tablet encapsulates, and makes after punching press vacuumizes.
Two, for detecting the using method of the test kit of influenza virus
1, reaction system preparation
Get 15 μ l constant-temperature amplification damping fluids (see step one 1), 10 μ l constant-temperature amplification enzyme solution (see step one 2), 25 μ l sample to be tested liquid are mixed into 50 μ l reaction solns, the 24 reaction chamber dish-style chips (see step one 3) being mounted with primer pair and ssDNA probe are injected, Quick spin 30s after sealing membrana oralis after vortex concussion evenly.
2, isothermal amplification reactions and detection
Dish-style chip is placed in rich Isochip-RT constant-temperature amplification instrument difficult to understand, 41 DEG C of reactions 1 hour is set, and complete real-time fluorescence scanning simultaneously.
3, result judges
After reaction terminates, the genome whether containing corresponding influenza virus in described sample to be tested liquid is determined as follows: if described testing sample produces S type amplification curve, then the genome containing respective streams Influenza Virus in described sample to be tested liquid according to the amplification curve of sample in each reaction chamber; Otherwise, then the genome not containing respective streams Influenza Virus in described sample to be tested liquid.
Embodiment 2, for detecting sensitivity and the specificity analyses of the test kit of influenza virus
One, the preparation of reference material RNA nucleic acid
1, the plasmid including influenza virus target gene is built
(1) plasmid containing influenza A virus NP target gene
By 1 ~ 1541 section (the Genbank SequenceID:gb|KM366530.1| of influenza A virus MP target gene sequence of influenza A virus NP target gene sequence, between the multiple clone site EcoR V UpdateDate:2014-9-27) being inserted into pUC19 carrier (sky with biochemical corp's product), obtain recombinant plasmid pUC19-InfA.
(2) plasmid containing influenza A virus H1 hypotype target gene
By 1 ~ 1698 section (the Genbank SequenceID:gb|GQ475727.1| of influenza A virus H1 hypotype target gene sequence of influenza A virus H1 hypotype target gene sequence, UpdateDate:2009-8-19) be inserted between pUC19 carrier (sky is with biochemical corp's product) EcoR V, obtain recombinant plasmid pUC19-InfA_H1.
(3) plasmid containing influenza A virus H3 hypotype target gene
By 1 ~ 1701 section (the Genbank SequenceID:gb|KJ567658.1| of influenza A virus H3 hypotype target gene sequence of influenza A virus H3 hypotype target gene sequence, between the multiple clone site EcoR V UpdateDate:2014-4-6) being inserted into pUC19 carrier (sky with biochemical corp's product), obtain recombinant plasmid pUC19-InfA_H3.
(4) plasmid containing Influenza B virus MP target gene
By 2 ~ 1100 sections (the Genbank SequenceID:gb|EU305617.1| of Influenza B virus MP target gene sequence of Influenza B virus MP target gene sequence, between the multiple clone site EcoR V UpdateDate:2007-12-5) being inserted into pUC19 carrier (sky with biochemical corp's product), obtain recombinant plasmid pUC19-InfB.
2, the preparation of reference material RNA nucleic acid
For examination recombinant plasmid: 4 kinds of step 1 structure contain the recombinant plasmid of respective streams Influenza Virus target gene.
(1) enzyme is cut: first cut 2h by each for examination recombinant plasmid EcoRI restriction endonuclease 37 DEG C of enzymes.
(2) transcribe: by 5 μ l5 × TranscriptionOptimizedBuffer (Promega), 2UT7RNA polysaccharase, 10mMDTT (Promega), 10U recombinant RNA enzyme inhibitors (Promega), 2mMrNTP, it is the reaction system of 50 μ l that digestion products 5 μ l prepares cumulative volume, vibrations evenly latter 37 DEG C transcribe 4h.
(3) digest: the DNA digestive ferment (rDnaseI, the 5U/ μ l) system after having transcribed being added 1 μ l, shake centrifugal, hatch 20min for 37 DEG C.
(4) purifying: use RNA purification kit product (its catalog number is 740948) the purifying transcription product RNA:a as follows of Macherey-Nagel company) prepare RA1-C
2h
5oH mixed solution: with RA1:C
2h
5the proportions of OH=1:1 (volume ratio).In the transcription product of every 100 μ l, need to add 600 μ lRA1-C
2h
5oH mixed solution, i.e. 300 μ lRA1+300 μ lC
2h
5oH solution, here need according to the pipe number of transcription product calculate join the volume of mixed solution.If product is less than 100 μ l, then the amount of product is mended to 100 μ l with water and (in every pipe product, namely add the sky root Rnase-freeH of 50 μ l
2o).B) ready RA1-C is before incited somebody to action
2h
5oH mixed solution is assigned in 1.5ml centrifuge tube, two pipes, and 100 μ l products are transferred in corresponding centrifuge tube by often pipe 600 μ l, totally 700 μ l in pipe, and fully concussion is centrifugal.C) prepare two adsorption columns, and carry out corresponding mark, be transferred to by 700 μ l product mixture (adsorption column maximum capacity is 700 μ l) in adsorption column, the centrifugal 2min of 1.2 ten thousand rpm, outwells lower floor's solution.D) in adsorption column, add the RA3 of 700 μ l, place 1min, make it can be dispersed in the bottom of adsorption column fully, the centrifugal 2min of 1.2 ten thousand rpm, outwells lower floor's solution.E) in adsorption column, add the RA3 of 350 μ l, place the centrifugal 2min of 2min, 1.2 ten thousand rpm, outwell lower floor's solution.F) in adsorption column, add the RA3 of 300 μ l, place the centrifugal 2min of 2min, 1.2 ten thousand rpm, outwell lower floor's solution.G) after opening the lid 3min of adsorption column, 1.2 ten thousand rpm are empty from 2min, outwell lower floor's solution, repeat this step once.H) sky is after end, and adsorption column is transferred in corresponding centrifuge tube, opens adsorption column lid and places 15min, ethanol is volatilized completely, adds 60 μ lRnase-H in adsorption column
2o (carrying in test kit) wash-out, places the centrifugal 2min of 2min, 1.2 ten thousand rpm.I) centrifugal gained template is sucked back in adsorption column, place the centrifugal 2min of 2min, 1.2 ten thousand rpm, repeat this step twice.J) lose adsorption column, the template in centrifuge tube is taken out 2 μ l, measure its concentration with Nanodrop, and record its concentration and 260/280,260/230 ratio.
Two, for detecting sensitivity and the specificity analyses of the test kit of influenza virus
1, the reference material Template preparation of different concns
By each RNA template (the 4 kinds of recombinant plasmids built in corresponding step one 1) all calculation in quantities to 10 after above-mentioned steps one purifying
10copy/μ l, and gradient dilution, obtain 10
5copy/μ l, 10
4copy/μ l, 10
3copy/μ l, 10
2the template dilution of the different concns such as copy/μ l, 10 copy/μ l.
2, reaction system preparation
Get 15 μ l constant-temperature amplification damping fluids (see embodiment 1 step 1), 10 μ l constant-temperature amplification enzyme solution (see embodiment 1 step 2), 25 μ l concentration template dilution be mixed into 50 μ l reaction solns, the 24 reaction chamber dish-style chips (see embodiment 1 step 3) being mounted with primer pair and ssDNA probe are injected, Quick spin 30s after sealing membrana oralis after vortex concussion evenly.
3, isothermal amplification reactions and detection
Dish-style chip is placed in rich Isochip-RT constant-temperature amplification instrument difficult to understand, 41 DEG C of reactions 1 hour is set, and complete real-time fluorescence scanning simultaneously.And according to the method for embodiment 1 step 23, result is judged.
Three, result
Result is as shown in Figure 2:
(1) for the RNA sample of recombinant plasmid pUC19-InfA, the 1# reaction chamber of 24 reaction chamber dish-style chips is to 10
5copy/μ l, 10
4copy/μ l, 10
3copy/μ l, 10
2the detected result of copy/μ l, 10 copy/μ l templates all has obvious S type amplification curve, is shown as the positive; And 2#-4# reaction chamber is all without amplification curve, be shown as feminine gender.
(2) for the RNA sample of recombinant plasmid pUC19-InfAH1, the 2# reaction chamber of 24 reaction chamber dish-style chips is to 10
5copy/μ l, 10
4copy/μ l, 10
3copy/μ l, 10
2the detected result of copy/μ l, 10 copy/μ l templates all has obvious S type amplification curve, is shown as the positive; And 1#, 3#, 4# reaction chamber is all without amplification curve, be shown as feminine gender.
(3) for the RNA sample of recombinant plasmid pUC19-InfA_H3, the 3# reaction chamber of 24 reaction chamber dish-style chips is to 10
5copy/μ l, 10
4copy/μ l, 10
3copy/μ l, 10
2the detected result of copy/μ l, 10 copy/μ l templates all has obvious S type amplification curve, is shown as the positive; And 1#, 2# and 4# reaction chamber is all without amplification curve, be shown as feminine gender.
(4) for the RNA sample of recombinant plasmid pUC19-InfB, the 4# reaction chamber of 24 reaction chamber dish-style chips is to 10
5copy/μ l, 10
4copy/μ l, 10
3copy/μ l, 10
2the detected result of copy/μ l, 10 copy/μ l templates all has obvious S type amplification curve, is shown as the positive; And 1#-3# reaction chamber is all without amplification curve, be shown as feminine gender.
In addition, for the RNA sample of all 4 kinds of recombinant plasmids, the 5# reaction chamber (internal reference) of 24 reaction chamber dish-style chips and 6# reaction chamber (negative control) are all without amplification curve.Why 5# reaction chamber (internal reference) is because sample to be tested is the RNA nucleic acid of 4 kinds of recombinant plasmids without amplification curve, the RNA not containing house-keeping gene GAPDH in human genome.
These results suggest that this test kit has higher amplification sensitivity and specific amplification.
The detection of embodiment 3, actual clinical sample
One, clinical sample type
The present embodiment adopt clinical sample from Shenzhen San Yuan in the Nasopharyngeal swabs sample (in line with the principle that this picker is voluntary) gathered, swab of adopting is deposited in 3mL physiological saline, and totally 560 is routine.
Two, the extraction of viral nucleic acid in clinical sample
It is QIAampViralRNAMiniKit (Qiagen) that clinical sample viral nucleic acid extracts test kit used, extracts as follows:
(1) get in step one deposit clinical sample swab physiological saline 140 μ l in 1.5ml centrifuge tube;
(2) add 560 μ l to contain the BufferAVL of CarrierRNA mixed solution (namely 5.6 μ lCarrierRNA mixed solution+560 μ lBufferAVL are in centrifuge tube, slight whirlpool 15s;
(3) after brief centrifugation completes, room temperature (15-25 DEG C) places 10-20min, to ensure that BufferAVL has the sufficient time to carry out cracking in centrifuge tube;
(4) 560 μ l ethanol (96-100%, volumn concentration) are added in centrifuge tube, whirlpool mixing 15s, centrifugal;
(5) get 630 μ l sample solutions in adsorption column, place 2min, make it fully contact with adsorption column, 8000rpm, centrifugal 1min, change clean collection tube;
(6) if sample solution is more than 630 μ l, then previous step is repeated;
(7) in adsorption column, add the AW1 washing lotion of 500 μ l, place 2min, make it fully contact with adsorption column, the centrifugal 1min of 8000rpm, changes clean collection tube;
(8) in adsorption column, add the AW2 washing lotion of 500 μ l, place 2min, make it fully contact with adsorption column, the centrifugal 3min of 12000rpm, changes clean collection tube;
(9) in adsorption column, add the AW2 washing lotion of 300 μ l, place 2min, make it fully contact with adsorption column, the centrifugal 3min of 12000rpm, changes clean collection tube;
(10) adsorption column lid is opened placement 2min, make pressure inside and outside it consistent, 8000rpm is empty from 1min.Empty after end, repeat this step once.
(11) sky is after end, is transferred to by adsorption column in 1.5ml centrifuge tube, opens adsorption column lid, places 20-30min, makes ethanol volatilize completely;
(12) add 50 μ lBufferAVE wash-out nucleic acid, the centrifugal 1min of 8000rpm, centrifugal complete after, the nucleic acid under wash-out is sucked back adsorption column, after centrifugal 1min, loses adsorption column.
Three, the detection of actual clinical sample
1, reaction system preparation
Get 15 μ l constant-temperature amplification damping fluids (see embodiment 1 step one 1), 10 μ l constant-temperature amplification enzyme solution (see embodiment 1 step one 2), 25 μ l step 2 extract the clinical sample solution obtained and be mixed into 50 μ l reaction solns, the 24 reaction chamber dish-style chips (see embodiment 1 step one 3) being mounted with primer pair and ssDNA probe are injected, Quick spin 30s after sealing membrana oralis after vortex concussion evenly.
2, isothermal amplification reactions and detection
Dish-style chip is placed in rich Isochip-RT constant-temperature amplification instrument difficult to understand, 41 DEG C of reactions 1 hour is set, and complete real-time fluorescence scanning simultaneously.And according to the method for embodiment 1 step 23, result is judged.
Experiment arranges the reliability demonstration of conventional RT-PCR method for test kit detected result of the present invention simultaneously.Specificity RT-PCR primer sequence for detecting each virus is as shown in table 1.
Table 1 is for detecting the specificity RT-PCR primer sequence of 4 kinds of influenza viruses
| Index name | RT-PCR upstream primer (5 '-3 ') | RT-PCR downstream primer (5 '-3 ') |
| Influenza A virus | CTTGTCTTTAGCCAYTCCATGAGAGC | CTAACCGAGGTCGAAACGTAYGTTCT |
| Influenza A virus H1 hypotype | CATCTAYCATTCCAGTCCACCCCCCT | ACCCCAGAAATAGCHAAAAGACCCAA |
| Influenza A virus H3 hypotype | GTGCTITTAATCAAAAGTATGTCTCCCG | CACAGTITCTACCAAAAGAAGCCAAC |
| Influenza B virus | TTCAGGTACATGACCATGAGACARTA | TYGGTGGGAAAGAATTTGACCTAGAC |
Four, result
The detected result display of test kit of the present invention, for each influenza virus, adopts the sample example of the RT-PCR method detection positive to adopt test kit of the present invention to detect and all shows positive findings.In addition, for a few sample example, adopt RT-PCR method to detect negative, but adopt test kit detected result of the present invention to be positive.Detecting by carrying out later stage resampling RT-PCR to these sample examples, finding that these sample examples are detected as respective streams Influenza Virus really positive.More than show, test kit of the present invention is to the recall rate of respective streams Influenza Virus higher than RT-PCR method, and its detected result accurately and reliably.Test kit of the present invention and RT-PCR method detect the statistics of influenza virus clinical sample see table 2.
Table 2 test kit of the present invention and RT-PCR method detect the statistics of influenza virus clinical sample
Claims (10)
1., for detecting the primer pair group of influenza virus, be made up of following 4 primer pairs:
The primer pair 1 be made up of two single strand dnas shown in sequence in sequence table 1 and sequence 2;
The primer pair 2 be made up of two single strand dnas shown in sequence in sequence table 3 and sequence 4;
The primer pair 3 be made up of two single strand dnas shown in sequence in sequence table 5 and sequence 6;
The primer pair 4 be made up of two single strand dnas shown in sequence in sequence table 7 and sequence 8.
2., for detecting the complete single stranded DNA of influenza virus, be made up of probe groups and primer pair group according to claim 1;
Described probe groups is made up of following 4 ssDNA probe: the ssDNA probe 1 in sequence table shown in sequence 9; SsDNA probe 2 in sequence table shown in sequence 10; SsDNA probe 3 in sequence table shown in sequence 11; SsDNA probe 4 in sequence table shown in sequence 12.
3. complete single stranded DNA according to claim 2, is characterized in that: 5 ' end of the every bar ssDNA probe in described probe groups is all marked with fluorescent reporter group FAM, and 3 ' end is all marked with fluorescent quenching group TAMRA.
4. for detecting the test kit of influenza virus, containing the complete single stranded DNA described in primer pair group according to claim 1 or Claims 2 or 3.
5. test kit according to claim 4, is characterized in that: described test kit is also containing internal reference primer pair and internal reference probe; Described internal reference primer pair is made up of two single strand dnas shown in sequence in sequence table 13 and sequence 14; Described internal reference probe is the ssDNA probe shown in sequence in sequence table 15;
Concrete, 5 ' end of described internal reference probe is marked with fluorescent reporter group FAM, and 3 ' end is marked with fluorescent quenching group TAMRA.
6. the test kit according to claim 4 or 5, is characterized in that: also containing constant-temperature amplification damping fluid and constant-temperature amplification enzyme solution in described test kit;
The solvent of described constant-temperature amplification damping fluid is water, solute and concentration as follows: the Tris-HCL of 200mMpH8.0,50mMDTT, 10mMdNTP, 10mMrNTP, 80mMMgCl
2, 450mMKCl, 15% volumn concentration DMSO, 1M sorbyl alcohol, 20mM tetramethyl ammonium chloride;
The solvent of described constant-temperature amplification enzyme solution is water, solute and concentration as follows: AMV reversed transcriptive enzyme 1U/ μ l, t7 rna polymerase 5U/ μ l, ribonuclease H 0.5U/ μ l, Pyrophosphate phosphohydrolase 0.5U/ μ l, RNA enzyme inhibitors 5U/ μ l, BSA0.5 μ g/ μ l.
7. according to described test kit arbitrary in claim 4-6, it is characterized in that: also containing dish-style chip in described test kit;
1# to the 6# reaction chamber of described dish-style chip deposits dry following (1)-(6) respectively:
(1) primer pair 1 described in claim 1 and the ssDNA probe described in claim 21;
(2) primer pair 2 described in claim 1 and the ssDNA probe described in claim 22;
(3) primer pair 3 described in claim 1 and the ssDNA probe described in claim 23;
(4) primer pair 4 described in claim 1 and the ssDNA probe described in claim 24;
(5) the internal reference primer pair described in claim 5 and described internal reference probe;
(6) negative controls.
8. in claim 1-7 arbitrary described primer pair group or complete single stranded DNA or test kit in the non-diagnostic object application detected or in auxiliary detection influenza virus.
9. application according to claim 8, it is characterized in that: in described application, by constant-temperature amplification enzyme solution described in constant-temperature amplification damping fluid described in 15 μ l and 10 μ l, be injected in described dish-style chip after mixing with 25 μ l sample to be tested solution, isothermal reaction 1h at 41 DEG C.
10., according to arbitrary described primer pair group in 1-9 or complete single stranded DNA or test kit or application, it is characterized in that: described influenza virus be following at least one: influenza A virus, influenza A virus H1 hypotype, influenza A virus H3 hypotype and Influenza B virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510468283.7A CN105039597B (en) | 2015-08-03 | 2015-08-03 | A kind of kit and its application for being used to detect influenza virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510468283.7A CN105039597B (en) | 2015-08-03 | 2015-08-03 | A kind of kit and its application for being used to detect influenza virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105039597A true CN105039597A (en) | 2015-11-11 |
| CN105039597B CN105039597B (en) | 2017-11-10 |
Family
ID=54446563
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510468283.7A Active CN105039597B (en) | 2015-08-03 | 2015-08-03 | A kind of kit and its application for being used to detect influenza virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039597B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591494A (en) * | 2016-12-30 | 2017-04-26 | 博奥生物集团有限公司 | Primer combination for identifying influenza A viruses and application of such primer combination |
| CN107034310A (en) * | 2017-01-24 | 2017-08-11 | 南方医科大学 | It is a kind of while detecting the primer sets of a variety of influenza viruses, probe groups and its kit |
| CN109207640A (en) * | 2018-10-23 | 2019-01-15 | 深圳市亿立方生物技术有限公司 | It is a kind of detect various respiratory road virus primer sets, probe groups and kit and its application |
| CN110468238A (en) * | 2019-09-11 | 2019-11-19 | 深圳市芯思微生物科技有限公司 | A kind of primed probe group, kit and the application of constant-temperature amplification detection A type and influenza B virus |
| CN111004867A (en) * | 2020-01-03 | 2020-04-14 | 牡丹江医学院 | Influenza A virus detection primer, probe and kit thereof |
| CN111551706A (en) * | 2020-04-29 | 2020-08-18 | 成都微康生物科技有限公司 | Disc-type immunodetection chip and method for one-time sample adding and multi-item joint detection |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1310565A1 (en) * | 2001-11-09 | 2003-05-14 | Hong Kong DNA Chips Limited | A process for detecting nucleic acid target molecules using an enzyme-linked probe capture assay and a kit therefor |
| CN101603096A (en) * | 2009-05-04 | 2009-12-16 | 北京海康基因芯片开发有限公司 | A kind of method and test kit that detects infectious disease pathogens |
| CN102965451A (en) * | 2012-09-25 | 2013-03-13 | 珠海国际旅行卫生保健中心 | Group A rotavirus real-time isothermal amplification detection kit, primers and probe thereof |
| CN103831140A (en) * | 2014-03-07 | 2014-06-04 | 博奥生物集团有限公司 | Micro-fluidic chip for multi-index detection |
-
2015
- 2015-08-03 CN CN201510468283.7A patent/CN105039597B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1310565A1 (en) * | 2001-11-09 | 2003-05-14 | Hong Kong DNA Chips Limited | A process for detecting nucleic acid target molecules using an enzyme-linked probe capture assay and a kit therefor |
| CN101603096A (en) * | 2009-05-04 | 2009-12-16 | 北京海康基因芯片开发有限公司 | A kind of method and test kit that detects infectious disease pathogens |
| CN102965451A (en) * | 2012-09-25 | 2013-03-13 | 珠海国际旅行卫生保健中心 | Group A rotavirus real-time isothermal amplification detection kit, primers and probe thereof |
| CN103831140A (en) * | 2014-03-07 | 2014-06-04 | 博奥生物集团有限公司 | Micro-fluidic chip for multi-index detection |
Non-Patent Citations (2)
| Title |
|---|
| CATHERINE MOORE，ET AL: "Development and Evaluation of a Real-Time Nucleic Acid Sequence Based Amplification Assay for Rapid Detection of Influenza A", 《JOURNAL OF MEDICAL VIROLOGY》 * |
| HUNING JIA,ET AL: "Pyrosequencing on templates generated by asymmetric nucleic acid sequence-based amplification (asymmetric-NASBA)", 《ANALYST》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591494A (en) * | 2016-12-30 | 2017-04-26 | 博奥生物集团有限公司 | Primer combination for identifying influenza A viruses and application of such primer combination |
| CN107034310A (en) * | 2017-01-24 | 2017-08-11 | 南方医科大学 | It is a kind of while detecting the primer sets of a variety of influenza viruses, probe groups and its kit |
| CN109207640A (en) * | 2018-10-23 | 2019-01-15 | 深圳市亿立方生物技术有限公司 | It is a kind of detect various respiratory road virus primer sets, probe groups and kit and its application |
| CN110468238A (en) * | 2019-09-11 | 2019-11-19 | 深圳市芯思微生物科技有限公司 | A kind of primed probe group, kit and the application of constant-temperature amplification detection A type and influenza B virus |
| CN111004867A (en) * | 2020-01-03 | 2020-04-14 | 牡丹江医学院 | Influenza A virus detection primer, probe and kit thereof |
| CN111551706A (en) * | 2020-04-29 | 2020-08-18 | 成都微康生物科技有限公司 | Disc-type immunodetection chip and method for one-time sample adding and multi-item joint detection |
| CN111551706B (en) * | 2020-04-29 | 2023-04-07 | 成都微康生物科技有限公司 | Disc-type immunodetection method for one-time sample-adding multi-item joint inspection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105039597B (en) | 2017-11-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105018648A (en) | Kit for detecting respiratory viruses and application thereof | |
| CN105039597A (en) | Kit used for detecting influenza viruses and application thereof | |
| CN105112559B (en) | A kind of kit and its application for being used to detect coronavirus | |
| CN107828633B (en) | Reagent device, reagent and method for extracting and detecting nucleic acid | |
| Olive et al. | Detection and differentiation of picornaviruses in clinical samples following genomic amplification | |
| CN105400907A (en) | Kit for nucleic acid combined detection of influenza virus A, influenza virus B and respiratory syncytial virus | |
| CN105695631B (en) | Human immunodeficiency virus, hepatitis type B virus, Hepatitis C Virus Quick joint inspection kit and its preparation and application | |
| CN103614489B (en) | Constant-temperature amplification detection kit for dengue viruses and detection method | |
| CN106167833B (en) | A kind of while 8 kinds of entomophila encephalitis viruses of detection RT-PCR primers and probe combinations and kit | |
| CN109811055A (en) | Sarcoma fusion detection kit and system | |
| CN103074451A (en) | Kit for synchronously detecting twenty-two respiratory tract pathogens and detection method of kit | |
| CN109517927A (en) | A kind of A type, influenza B virus rapid typing detection reagent box and its application | |
| CN105018488A (en) | Kit used for detecting respiratory viruses and application thereof | |
| CN108239678A (en) | A kind of Respiratory Syncytial Virus(RSV) nucleic acid parting detecting reagent | |
| CN103074448A (en) | Kit for synchronously detecting twenty-three meningitis pathogens and detection method of kit | |
| CN107245531A (en) | Diarrhoeal diseases substance multiple gene detection architecture and its kit and application | |
| CN103074452B (en) | Kit for synchronously detecting fifteen hemorrhagic fever pathogens and detection method of kit | |
| CN105112407A (en) | Kit for detecting enterovirus and application of kit | |
| CN108239676A (en) | A kind of parainfluenza virus one-step method fluorescence parting RT-PCR detection kit | |
| CN103966356A (en) | Human immunodeficiency virus type 1 one-step fluorescence quantitative RT-PCR detection kit | |
| CN105112558B (en) | The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I | |
| CN107083446A (en) | Diarrhoea pathogenic bacteria multiple gene detection architecture and its kit and application | |
| CN105039596A (en) | Kit used for detecting parainfluenza viruses and application thereof | |
| CN108060272A (en) | A kind of quick differentiation pig Delta coronavirus and the multiple PCR detection primer group and kit of pig ridge virus | |
| CN104561375A (en) | Isothermal amplification detection kit and detection method of new bunyavirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |