CN105039589A - Visual gene chip and reagent box for hog cholera virus and/or porcine reproductive and respiratory syndrome virus - Google Patents
Visual gene chip and reagent box for hog cholera virus and/or porcine reproductive and respiratory syndrome virus Download PDFInfo
- Publication number
- CN105039589A CN105039589A CN201510307112.6A CN201510307112A CN105039589A CN 105039589 A CN105039589 A CN 105039589A CN 201510307112 A CN201510307112 A CN 201510307112A CN 105039589 A CN105039589 A CN 105039589A
- Authority
- CN
- China
- Prior art keywords
- gene chip
- probe
- gene
- respiratory syndrome
- chip
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Abstract
The invention discloses a visual gene chip and a reagent box for hog cholera virus and/or porcine reproductive and respiratory syndrome virus. By the visual gene chip manufactured through a specific method, detection results can be seen visually by naked eyes, so that a laser copolymerization scanner which is high in price is not needed, and the visual gene chip is low in cost; the visual gene chip is high in sensitivity, equivalent to existing fluorescent marking methods in sensitivity, high in specificity, short in consumed time, quick in detection and good in clinical application prospect.
Description
Technical field
The present invention relates to a kind of visual gene chip and the test kit that detect Pestivirus suis and/or porcine reproductive and respiratory syndrome virus.
Background technology
The polyinfection of many cause of diseases is the universal phenomenon of current pig farm epidemic disease, the disease symptoms that this three boar of porcine reproductive and respiratory syndrome, swine fever, epidemic encephalitis b of swine virus causes is similar and usually in polyinfection, be 3 kinds of important virus diseases of current harm pig industry, popular the seeming that therefore Early Identification diagnosis also understands epidemic status sick to control these 3 kinds is in time even more important.At present the separation of cause of disease and the serological method of routine are adopted more to these 3 kinds sick diagnosis, but it is longer to take time.External and the domestic isolation identification, immune colloidal gold technique, enzyme linked immunosorbent assay, serum Neutralizing test, polymerase chain reaction etc. all establishing cause of disease recently, but the polyinfection of multiple cause of disease can't be detected more fast.
Biochip technology is the biological new and high technology of new one of rising in recent years, and this technology can simultaneous quantitative or detect thousands of gene informations qualitatively, has non-selectivity, objective, high-throughout feature.After gene chip program launched, many departments, university, key lab and drugmaker take part in the research and development of this project, and China has also set up large quantities of gene chip company in succession.Along with the growth of genomic data and the fast development of molecular biology related discipline, biochip technology obtains fast development and widespread use.But biochip technology development time is shorter, a lot of technology is also in elementary development, become laboratory study or the clinical technology that can generally adopt still has many key issues urgently to be resolved hurrily.(1) the specific raising of gene chip; (2) sensitivity of signal detection is increased; (3) sample preparation and marking operation is simplified; (4) requirement of equipment and manipulation personnel is higher; (5) unification of application standard.
Publication number is: the patent application document of CN104232800A discloses a kind of chip detecting epidemic encephalitis b of swine virus, Pestivirus suis and porcine reproductive and respiratory syndrome virus, it adopts fluorescent dye primer to continue to detect, although it is highly sensitive, but because it needs expensive laser scanning confocal instrument to scan and analytical results, cost is too high, is unfavorable for promoting the use of.
Summary of the invention
In order to solve the problem, the invention provides visual gene chip and the test kit of a kind of new high specificity, highly sensitive detection Pestivirus suis and/or porcine reproductive and respiratory syndrome virus.
The present invention detects the visual gene chip of Pestivirus suis and/or porcine reproductive and respiratory syndrome virus, it is characterized in that: it comprises solid phase carrier and is fixed on the probe on solid phase carrier; Described probe comprises oligonucleotide fragment shown in SEQIDNO:1, oligonucleotide fragment shown in SEQIDNO:2, and oligonucleotide fragment shown in SEQIDNO:3, epidemic encephalitis b of swine virus, Pestivirus suis and porcine reproductive and respiratory syndrome virus.
Wherein, described gene chip is prepared as follows:
(1) prepare probe solution: get probe, with spotting buffer by probe dilution to 200ng/ul, obtain probe solution;
(2) adopt mini sprinkler specking mode, when pressure is 10KPa, by probe solution point sample on amino slide, repeat twice.
Mini sprinkler specking mode: by mini sprinkler by sample spot to on-chip mode.
Wherein, it also comprises position probe, and position probe is the gene fragment shown in SEQIDNO:4.
Present invention also offers the method preparing aforementioned visual gene chip, it is characterized in that: step is as follows:
(1) preparing probe solution: get probe, with being diluted to 200ng/ul, obtaining probe solution;
(2) adopt mini sprinkler specking mode, when pressure is 10KPa, by probe solution point sample on amino slide, repeat twice.
The present invention detects the test kit of Pestivirus suis and/or porcine reproductive and respiratory syndrome virus, it is characterized in that: it comprises aforesaid visual gene chip, amplifing reagent and colouring reagents;
Wherein, amplifing reagent comprises primer pair shown in SEQIDNO:4 ~ 5 and/or 6 ~ 7, for Pestivirus suis and/or the porcine reproductive and respiratory syndrome virus gene of increasing respectively;
Colouring reagents comprises gold mark Streptavidin and silver-colored transfection reagent.
Wherein, described amplifing reagent also comprises primer pair shown in SEQIDNO:8 ~ 9.
Described gold mark Streptavidin is the solution after Nanogold-Streptavidin dilution 10 ~ 40 times.Preferably, described gold mark Streptavidin is the solution that Nanogold-Streptavidin dilutes after 40 times.
Visual gene chip prepared by ad hoc approach of the present invention can accurately detect Pestivirus suis and porcine reproductive and respiratory syndrome virus, with the naked eye intuitively can arrive detected result, do not need expensive laser scanning confocal instrument, with low cost, simultaneously, sensitivity is higher, suitable with the sensitivity of existing fluorescence labeling method, high specificity, consuming time short, detect fast, potential applicability in clinical practice is good.
The embodiment of form by the following examples, is described in further detail foregoing of the present invention.But this should be interpreted as that the scope of the above-mentioned theme of the present invention is only limitted to following embodiment.The technology that all contents recorded based on claims of the present invention realize all belongs to scope of the present invention.
Accompanying drawing explanation
The location position of Fig. 1 point sample instrument
The spray sample parameter of Fig. 2 point sample instrument
Fig. 3 is because of chip array spot sample mode figure
The basic parameter of Fig. 4 Fig. 2-4 gene chip point is arranged.A: slide arranges B: dot matrix arranges C: array arranges D: cleaning arranges E: sample is arranged
The recovery of Fig. 5 plasmid bacterial and qualification result.M:100bpDNALadder; 1:Y11 gene; 2:PS8 gene.M:100bpDNALadder；1：λDNA
The validation checking result of Fig. 6 gene chip.A: the independent results of hybridization of positive quality control; B: all probe hybridization results
The specific detection result of Fig. 7 gene chip.A porcine reproductive and respiratory syndrome virus plasmid hybridization result; B: Pestivirus suis plasmid hybridization result
Fig. 8 gene chip susceptibility detected result
The Detection of Stability result of Fig. 9 gene chip
The selection result of Figure 10 spotting buffer.A: aseptic ultrapure water; B:3 × SSC; C: rich spotting buffer difficult to understand
The optimum result of Figure 11 point sample number of times
The optimum result of Figure 12 gene chip hybridization temperature
The optimum result of Figure 13 hybridization time
The optimum result of Figure 14 Nanogold-Streptavidin extension rate
Embodiment
One, experiment material and instrument
1.1 biomaterial
Porcine reproductive and respiratory syndrome virus (PRRSV) strain, Pestivirus suis (CSFV) strain and epidemic encephalitis b of swine virus (JEV) strain, purchased from China Veterinary Drugs Supervisory Inst..
1.2 main agents
Amino-group substrate:
amino slide glass, purchased from proud biotech inc, Shanghai hundred; Spotting buffer:
spotting buffer, purchased from proud biotech inc, Shanghai hundred, brilliant die chip sampling liquid, purchased from Beijing Boao Biological Co., Ltd; Hybridization buffer:
hybridization buffer, purchased from proud biotech inc, Shanghai hundred; Silver transfection reagent: SilverbufferA, SilverbufferB, purchased from American Sigma company; Gold mark Streptavidin: Nanogold-Streptavidin, purchased from American Nanogold company; Positive quality control (λ DNA) is precious biotechnology (Dalian) company limited product; Mini-scale plasmid extraction agent box is purchased from Omega company.
1.3 key instrument equipment
Air constant-temperature table, Thermo company of the U.S.; AllegraTM64R high speed freezing centrifuge, Thermo company of the U.S.; POWERPacTM electrophoresis apparatus and Horizontal electrophoresis tank, BIO-RAD company of the U.S.; UNIVERSALHOOD gel imaging system, BIO-RAD company of the U.S.; MyCyclerTMPCR instrument, BIO-RAD company of the U.S.; SmartSpecTMPlus nucleic acid-protein instrument, BIO-RAD company of the U.S.; Ultrapure water instrument, MilliQplus, method is domestic; Grads PCR instrument, BIO-RAD company of the U.S.; Hybridization Oven, Thermo company of the U.S.;
smartArrayer
tM16, micro-array chip spotting system: CapitalbioCorporation, Beijing Bo Ao biotech firm;
luxScan
tM10K micro-array chip scanner: CapitalbioCorporation, Beijing Boao Biological Co., Ltd; Multi-example fence, Multi-example fence paste tool, Multi-example fence cover plate, chip hybridization box is Beijing Boao Biological Co., Ltd.
The preparation of the visual gene chip of embodiment 1 the present invention and the method with its detection
1, material and instrument
With aforementioned experiment material and instrument.
The preparation and property of 2 gene chips of the present invention detects
The preparation of 2.1 primers and probe
The viral specific DNA fragment be fixed on amino-group substrate is called probe by this research, and is called target gene with biotin labeled measuring samples.
2.1.1 the synthesis of primer
Primer is synthesized by Shanghai Sheng Gong biotechnology company limited, and wherein reverse primer synthesizes two, and one unmarked, and one 5 ' end vitamin H Biotin mark is modified.
Table 1 target gene amplimer
Table 2 gene location primer
2.1.2 probe gene and gene location
CSFV-PS8(SEQIDNO：1)：
Gene size and sequence: 248bp
TCAATGGAACCTGAGTGACAACGGCACTAATGGTATTCAGCATGCTATGTACCTTAGAGGGGTTAGCAGAAGCTTGCATGGGATCTGGCCGGAAAAAATATGCAAAGGAGTCCCCACCTACCTGGCCACAGACACGGAACTGAAAGAAATACAGGGAATGATGGATGCCAGCGAGGGGACAAACTATACGTGCTGTAAGTTACAGAGACATGAATGGAACAAACATGGATGGTGTAACTGGTACAATA
PRRSV-Y11(SEQIDNO：2):
Gene size and sequence: 155bp
TCACCTCCAGATGCCGTTTGTGCTTGCTAGGCCGCAAGTACATTCTGGCCCCTGCCCACCACGTTGAAAGTGCCGCAGGCTTTCATCCGATTGCGGCAAATGATAACCACGCATTTGTCGTCCGGCGTCCCGGCTCCACTACGGTCAACGGCACA
λDNA：
Gene size and sequence (SEQIDNO:3): 500bp
GTCCTATGACGACAGCTATCTCGATGATGAAGATGCAGACTGGACTGCGACCGGGCAGGGGCAGAAATCTGCCGGAGATACCAGCTTCACGCTGGCGTGGATGCCCGGAGAGCAGGGGCAGCAGGCGCTGCTGGCGTGGTTTAATGAAGGCGATACCCGTGCCTATAAAATCCGCTTCCCGAACGGCACCGCTGGCGTGGATGCCCGGAGAGCAGGGGCAGCAGGCGCTGCTGGCGTGGTTTAATGAAGGCGATACCCGTGCCTATAAAATCCGCTTCCCGAACGGCACCACGGTAACAGCGGCAACCGGCATGACCGTGACGCCTGCCAGCACCTCGGTGGTGAAAGGGCAGAGCACCACGCTGACCGTGGCCTTCCAGCCGGAGGGCGTAACCGACAAGAGCTTTCGTGCGGTGTCTGCGGATAAAACAAAAGCCACCGTGTCGGTCAGTGGTATGACCATCACCGTGAACGGCGTTGCTGCAGGCAAGGTCAACATT
After the probe gene prepared and gene location are diluted to certain multiple, carry out DNA concentration determination with ultraviolet nucleic acid-protein detector.
2.1.3 the preparation of each positive plasmid
Adopting the total RNA extraction reagent box of sky root, with reference to illustrating, extracting the total serum IgE of virus.Illustrate the RNA reverse transcription of virus to be cDNA with precious biological Reverse Transcription box reference, carry out pcr amplification.Probe gene after amplification, adopts OMEGA a small amount of glue to reclaim test kit and carries out glue recovery.Adopt pMD19-TSimpleVector Cloning Kit, carry out the connection restructuring of probe gene, 4 DEG C of connections are spent the night, and connect product and proceed to DH5 α competent cell, finally carry out identifying and conservation, obtain the restructuring carrier T T/Yll, the T/PS8 that save PRRSV-Y11, CSFV-PS8 respectively containing 2.1.2.
2.2 instrument testings and correction
Before point sample, need to carry out location position to point sample instrument, comprise cleaning positions, drain position, evacuate position, first slide locations and sample orifice plate A24 hole site etc. (as Fig. 1), and sample parameter sprayed substantially to it set (as Fig. 2).
Condition in 2.3 gene chip point processes
2.3.1 coremaking sheet point sample mode is put
Mini sprinkler specking mode.
2.3.2 spotting buffer
Rich spotting buffer difficult to understand.
2.3.3 point sample number of times
Spray sample 3 times, through aftertreatment, hybridization, observations.
The preparation of the visual gene chip of 2.4PRRSV-CSFV
2.4.1PRRSV-CSFV the design of visual gene chip dot matrix
Often open gene chip to design altogether and be divided into 4 arrays, 4 arrays are repeat array, separate when needing with hybridization fence, to carry out the Parallel testing of 4 different samples simultaneously.Each array comprises 4 × 3=12 point, and Genechip array spot sample mode figure is shown in Fig. 3.
2.4.2PRRSV-CSFV the some system of visual gene chip
This test uses Bo Ao biotech firm
smartArrayer16 gene chip sample applying instrument specking, first concentration and probe concentration is adjusted to 400ng/ul (adjusting with aseptic ultrapure water), with spotting buffer by probe dilution to 200ng/ul, then probe is added to gently in the 384 corresponding holes of orifice plate and fully mix (in mixed solution, can not bubble be left), 384 orifice plates and chip substrate are put on point sample instrument.The amino slide crossed by equilibrium at room temperature is placed in the module of point sample instrument, before point sample, point sample instrument is once corrected, and carry out point sample (as Fig. 4) according to the arrangement of the detection arrays designed, point sample pressure is 10KPa, and repeats twice (altogether point sample three times).
2.4.3PRRSV-CSFV the point sample aftertreatment of visual gene chip
Point sample aftertreatment mainly comprises the fixing of probe and stores.Select the substrate made being preset as in the baking oven of 80 DEG C and cure 4h, UV-crosslinked 30min, sealing, 4 DEG C of preservations.
The hybridization of 2.5 gene chips
2.5.1 the amplification label of target gene
Three target genes increase respectively as follows:
To dilute the plasmid DNA of 50 times for template, carry out the mark amplification of target gene, the process need lucifuge of application of sample is carried out.
PCR system:
Response procedures is as follows: 95.0 DEG C of sex change 5min; 95.0 DEG C of sex change 30sec, 56.0 DEG C of annealing 30sec, 72.0 DEG C extend 30sec, 35 circulations; 72.0 DEG C extend 8min, 12.0 DEG C of preservations.
2.5.2 the prehybridization of gene chip
Get the gene chip prepared and preserve, in the ultrapure water of boiling, denaturation 5min (upper and lower extracting prevents surface from producing bubble), is then taken out rapid immersion in dehydrated alcohol and is cooled 1min, centrifugal drying.The chip of drying is added upper railings, and fixes with fence paste tool, be placed in hybridization cabin, in chip point sample, district adds prehybridization solution 30ul, is put down gently on it by cover glass, in order to avoid form bubble, make prehybridization solution uniform fold chip region, in wet box chip being placed in sealing at 44 DEG C prehybridization 1h.
The configuration of prehybridization solution: methane amide 5.0ml, 20 × SSC2.5ml, 100 × Denhardt0.5ml, 0.2mol/mlNa
3pO
41.0ml, 10mg/ml salmon sperm dna 0.5ml (salmon sperm dna need sex change to boil 5min after, put into ice immediately and cool), pure water 0.5ml is 0.2nm membrane filtration with bore dia, and mixing packing lml/ pipe, 4 DEG C save backup.
2.5.3 the hybridization of gene chip
Absorb prehybridization solution, the nucleic acid samples of pcr amplification and hybridization buffer are mixed after 95 DEG C of sex change 5min, put in ice immediately and cool 3min, get this mixed solution 50ul and be added to chip region, put down gently on it with cover glass, chip is put into hybridization cabin to hybridize in a wet box, under certain hybridization temperature, hybridize certain hour.After having hybridized, after cover glass removing, clean 3 times, each 2min with warm maleate buffer, low-speed centrifugal is dry.
2.5.4 the optimization of gene chip hybridization temperature
Chip is hybridized 1h, observations respectively in the temperature of 46 DEG C, 48 DEG C, 52 DEG C.
2.5.5 the optimization of gene chip hybridization time
All probes are hybridized, hybridizes 60min respectively, observe comparing result.
The colour developing of 2.6 gene chips and result judge
Add at the chip conversion zone completing hybridization the Nanogold-Streptavidin that 50ul dilutes certain multiple, chip is placed in hybridization cabin, covered, hatches 30min for 37 DEG C.Wash 3 times with warm maleate buffer afterwards, each 2min, low-speed centrifugal is dry.In the environment of lucifuge, add silver-colored transfection reagent (SilverbufferA, the SilverbufferB equal-volume mixing of 200ul to each dot matrix, now with the current), treat chip to occur visual signals clearly, clean chip with ultrapure water, color development stopping, observations.
2.6.1Nanogold-Streptavidin (the gold mark Streptavidin of nanocs company) extension rate
To hybridize positive quality control, Nanogold-Streptavidin ultrapure water is diluted 40 times respectively, hatches with chip at identical conditions, after through silver dye colour developing, observe and comparing result.
2.6.2 the gene chip silver dye time
After adding silver-colored transfection reagent, dyeing 8-10min.
2.7 the performance study of gene chip
2.7.1 the validation checking of gene chip
Separately with positive quality control λ DNA for template, pcr amplification marks, marked product at the standard conditions with gene chip hybridization, observations after washing, centrifugal drying and colour developing, to verify the validity of gene chip positive quality control and negative Quality Control.Again with the plasmid of recombinant plasmid bacterium T/Yll, T/PS8 for template, PCR is amplification label respectively, after marked product mixing at the standard conditions with gene chip through hybridizing, washing, develop the color after centrifugal drying observations, to verify the validity of the whole probe of gene chip.
2.7.2 the specificity research of gene chip
The plasmid DNA of the recombinant plasmid bacterium of porcine reproductive and respiratory syndrome virus and Pestivirus suis is as template, pcr amplification mark is carried out respectively after 50 times of dilutions, by marked product and gene chip after prehybridization, hybridization, washing, centrifugal drying, colour developing observations, to verify the specificity of gene chip.
2.7.3 the Code's Sensitivity of gene chip
Extract the plasmid DNA of the recombinant plasmid bacterium of porcine reproductive and respiratory syndrome virus and Pestivirus suis respectively as template, pcr amplification mark is carried out respectively after 50 times of dilutions, by product 10 times of gradient dilutions, again the marked product after dilution is carried out hybridization check with gene chip respectively, consumption and the hybridization conditions of target gene are just the same, and colour developing is observations also.PCR primer is got 7uL simultaneously and carry out electroresis appraisal, observe and compare the susceptibility of two kinds of methods.
2.7.4 the stability study of gene chip
Random extraction 3 from gene chip prepared by two batches of different times, adopts 2.5 to build and the condition optimized and chip are hybridized, and usage quantity and the hybridization check condition of target nucleic acid are completely the same, is used for verifying that the stability of gene chip is with repeatable.
2.7.5 the preservation period test of gene chip
By the visual gene chip of PRRSV-CSFV prepared, be positioned in chip cartridges, drain sealing with vacuum machine, preserve 30d, 60d, 90d, 120d and 180d respectively, utilize gene location and target gene to carry out hybridization check checking.
3 results and analysis
The preparation of 3.1 probes and purification result
3.1.1 plasmid bacterial recovery and qualification result
Recombinant plasmid bacterium T/Yll, T/PS8 identify through PCR, and the object stripe size amplified is in the same size with expection, Yll:155bp; PS8:248bp; ; Gene location: 500bp (see Fig. 5).
3.2 point sample instrument location position results
By debugging point sample instrument, the design parameter of location position is in table 3.
Table 3 point sample instrument location position result
The performance study result of 3.3 gene chips
3.3.1 the validation checking result of gene chip
Separately with positive quality control λ DNA for template, pcr amplification marks, marked product at the standard conditions with gene chip hybridization, after washing, centrifugal drying and colour developing, result is as Fig. 6, again with recombinant plasmid bacterium T/Yll, T/PS8 for template, PCR respectively amplification label, after marked product mixing at the standard conditions with gene chip through hybridizing, washing, develop the color after centrifugal drying after result as schemed.
3.3.2 the specific detection result of gene chip
Respectively with the plasmid DNA of PRRSV, CSFV for template, carry out pcr amplification mark, by marked product and gene chip after prehybridization, hybridization, washing, centrifugal drying, colour developing observations are as Fig. 7.Corresponding probe has obvious positive signal, to each other no cross reaction, illustrates that the specificity of gene chip is good.
3.3.3 the susceptibility detected result of gene chip
Extract the plasmid DNA of the recombinant plasmid bacterium of porcine reproductive and respiratory syndrome virus and Pestivirus suis respectively as template, pcr amplification mark is carried out respectively after 50 times of dilutions, by product 10 times of gradient dilutions, again the marked product after dilution is carried out hybridization check with gene chip respectively, consumption and the hybridization conditions of target gene are just the same, colour developing and observations as shown in Figure 8.
At first, Y11 and PS8 target gene concentration is respectively 205ng/uL and 183ng/uL, and after dilution, visual biochip technology is being diluted to 10
4time also have obvious signal, now the concentration of target gene is respectively 20.5pg/uL and 18.3pg/uL and the highly sensitive of visual biochip technology is described.
3.3.4 the Detection of Stability result of gene chip
Extract 3 out at random from gene chip prepared by two batches of different times, application positive quality control gene and three kinds of viral probe genes and gene chip carry out hybridization, and usage quantity, the hybridization conditions of its target nucleic acid are completely the same.As shown in Figure 9, for the gene chip that the same batch of gene chip produced and different batches are produced, its detected result meets expection to result, the similar gray value of signal, without fluctuation, positive control spot obviously and negative control spots is not obvious, stability and repeatability good.
3.3.5 the preservation period test-results of gene chip
Extract a visual gene chip of PRRSV-CSFV at 30d, 60d, 90d, 120d and 180d respectively to test to its preservation period, when 180d, chip still can effectively detect.
To sum up, successfully construct that PRRSV-CSFV is visual examines gene chip altogether, the gene chip of preparation is at 48 DEG C of hybridization 60min, Nanogold-Streptavidin dilutes 40 times, effectively PRRSV, CSFV can be detected during silver dye time 8-10min, and specificity is good, sensitivity can reach 20.5pg/uL and 18.3pg/uL, is sealed in 4 DEG C and at least can preserves 180d.
The preparation of comparative example gene chip and use
Condition in 1 gene chip point process
1.1 spotting buffer
All the other conditions, with embodiment 1, only change spotting buffer:
Gene location is carried out purifying, respectively with aseptic ultrapure water, 3 × SSC (20 × SSC:NaCl17.53g, Trisodium Citrate 8.82g, ddH
2o80ml, adjusts pH to 7.0 with NaOH, is settled to 100.0ml, is save backup after 0.2nm membrane filtration with bore dia.3 × SSC dilutes on the basis of 20 × SSC.), rich spotting buffer difficult to understand (damping fluid of the present invention) is diluted to about 200ng/ul, system of select, on substrate, is fixed through aftertreatment, and observation point sample form after Reality simulation hybridization, as Figure 10.
Can obviously be observed by figure, during with aseptic ultrapure water point sample, it is little that probe is fixed, and diffusion effect is bad; After homemade 3 × SSC point sample, the point of gained is even not; After rich spotting buffer difficult to understand and hundred proud spotting buffer point samples, effect is better.
Experimental result illustrates, only selects damping fluid of the present invention just can prepare the present invention's gene chip of good performance.
1.2 point sample number of times
All the other conditions, with embodiment 1, only change point sample number of times:
Spray sample 1-4 time respectively, through aftertreatment, hybridization, result as shown in figure 11.
As seen from the figure, spray sample 1-2 time, it is few that probe is fixed, so the paler colour that develops the color out; During spray sample 3 times (sample number of times is sprayed in the present invention), colour developing obviously, color burn after spray 4 times but while also create displacement a little.
Experimental result explanation, only has the probe solution adopting certain concentration of the present invention, use specified point sample loading mode, at a certain pressure, adopt the present invention's specific point sample number of times just can prepare the present invention's gene chip of good performance, can accurately detect, and point sample number of times increases or reduce, or the change of other parameters all can cause detected result inaccurate.
The crossover process of 2 gene chips
2.1 gene chip hybridization temperature
All the other conditions, with embodiment 1, only change hybridization temperature:
Chip is hybridized the identical time respectively in the temperature of 42 DEG C, 46 DEG C, 48 DEG C, 52 DEG C.
Result shows (Figure 12), and 42 DEG C time, part probe is not hybridized, and chip all can see obvious spot in 46-52 DEG C (hybridization temperature of the present invention), best in the effect of 48 DEG C of hybridization.
Experimental result illustrates, adopts gene chip of the present invention, and only have and adopt the specific hybridization temperature of the present invention, could effectively detect, wherein, 48 DEG C is preferred hybridization temperature, and temperature is too high or too low, cannot effectively detect.
2.2 gene chip hybridization times
All the other conditions, with embodiment 1, only change hybridization time:
All probes are hybridized, hybridizes 30min, 60min (hybridization time of the present invention) and 120min respectively, observe comparing result (Figure 13).
Result shows, when hybridizing 30min, spot is lighter; After hybridization 60min, clear spot is visible; After hybridization 120min, spot is slightly deepened but not obvious, but background value is high.
Experimental result illustrates, adopts gene chip of the present invention, only has employing the present invention specific hybridization time, could effectively detect, overlong time or too short, cannot effectively detect.。
In 3 gene chip process colors
3.1Nanogold-Streptavidin extension rate
All the other conditions, with embodiment 1, only change the extension rate of Nanogold-Streptavidin
To hybridize positive quality control, Nanogold-Streptavidin ultrapure water is diluted respectively 10 times to 80 times, hatches with chip at identical conditions, after through silver dye colour developing, result is as shown in figure 14: when Nanogold-Streptavidin dilutes 10 times, coloration result color is the darkest; When Nanogold-Streptavidin dilution 20 to 40 times, color shoals a little, but still can obviously be identified; When Nanogold-Streptavidin dilution 50 to 60 times, color becomes very shallow, and result of determination may occur error; When Nanogold-Streptavidin dilutes 70 times, color thickens, can not result of determination; When Nanogold-Streptavidin dilutes 80 times, can't see spot completely.
This research finally adopts dilutes 40 times by Nanogold-Streptavidin, has both saved reagent cost, also ensure that visual effect.
Experimental result explanation, the solution after adopting Nanogold-Streptavidin of the present invention dilution 10 ~ 40 is only had effectively to detect, wherein, the solution after preferred Nanogold-Streptavidin dilution 40, adopts the colouring reagents beyond the present invention then cannot effectively detect.
The silver dye time of 3.2 gene chips
All the other conditions, with embodiment 1, only change the silver-colored dye time:
After adding silver-colored transfection reagent, the dyeing of close observation chip and coloring case.
Result shows, and when silver dye colour developing 8-10min (the present invention's silver dye time), develops the color clear, does not have background value and false positive; After 12min, background value raises obviously, and impact judges.
Experimental result illustrates, adopts gene chip of the present invention, only has and adopts the present invention's specific silver-colored dye time, could effectively detect.
Beneficial effect of the present invention is further illustrated below with experimental example:
Experimental example 1PRRSV-CSFV is visual examines genechip detection clinical sample altogether
1 material
1.1 positive and negative sample
1.1.1 positive sample
CSFV: live vaccines of hog cholera (cell source), purchased from Shandong Ya Kang medicine company; PRRSV: porcine reproductive and respiratory syndrome living vaccine (JXA1-R strain), purchased from Zhongmu Stocks Trading Co. company limited.
1.1.2 negative sample
Negative sample takes from the tissue such as lymphoglandula, lungs of the health pig on pig farm, Yaan.
1.2 clinical sample
Year January in January, 2014 to 2015 derives from 102 parts of clinical samples on the ground such as Sichuan Meishan, Mianyang, Leshan, double fluid, Dazhou City, Xichang, Chongqing, is collected in tissue or aborted fetus that clinical manifestation is the ill pig of doubtful pig breeding dysfunction disease.
1.3 main agents
Total RNA extraction reagent box (DP419) purchased from Tian Gen biochemical technology company, TrizolReagent purchased from TAKARA company; 100bpLadderDNAMarker (MD109) is purchased from Tian Gen biochemical corp; PrimeScriptRTreagentKit Reverse Transcription box is purchased from precious biotechnology (Dalian) company limited product.
2 experimental techniques
2.1 chip preparations
Gene chip prepared by embodiment 1.
The extraction of 2.2 viral nucleic acids
Adopt the RNA of sky root to extract test kit, extract the RNA of positive-virus and clinical sample, extracting method is as follows:
1) pathological material of disease of collection is shredded, grind with lysate;
2) get the above-mentioned pathological material of disease solution of 250ul, add 750ul lysate, place 5min-10min in room temperature;
3) 12000r/min, 4 DEG C of centrifugal 5min, draw supernatant and proceed in new EP pipe;
4) add 200 μ L chloroforms, thermal agitation 15s, room temperature places 3min;
5) 12000r/min, 4 DEG C of centrifugal 10min, liquid layered, forwards to liquid colourless for the superiors in new EP pipe;
6) add 0.5 times of volume dehydrated alcohol, mixing, forwards in adsorption column, 12000r/min, 4 DEG C of centrifugal 30s;
7) 500 μ L protein liquid removals are added, 12000r/min, 4 DEG C of centrifugal 30s;
8) add 600 μ L rinsing liquids, leave standstill 2min, 12000r/min, 4 DEG C of centrifugal 30s; Repeat once
9) 12000r/min, 4 DEG C of skies are from 2min;
10) forwarded in RNase-Free centrifuge tube by adsorption column, add 50 μ LRNase-Free ultrapure waters, room temperature leaves standstill 2min, 12000r/min, 4 DEG C of centrifugal 2min.The viral RNA obtained ,-70 DEG C save backup
Use PrimeScriptRTreagentKit Reverse Transcription box to be cDNA by the RNA reverse transcription of extracting, reverse transcription product saves backup in-20 DEG C, and system is as follows:
Response procedures: 37 DEG C, 15min; 85 DEG C, 5sec; 4 DEG C, preserve.
The pcr amplification of 2.3 target genes and mark
With above-mentioned reverse transcription product for template, carry out the amplification of PCR mark, amplification system and program are with chapter 2 2.5.1.
The hybridization of 2.4 gene chips
By the gene chip for preparing after 44 DEG C of prehybridization 1h, absorb and hybridization solution, hybridize 1h with the target gene of above-mentioned mark at 48 DEG C, then hatch 30min with the gold mark Streptavidin of dilution 40 times at 37 DEG C, clean 3 times in warm maleate buffer, each 2min.Dried by chip, each dot matrix adds 200ul silver transfection reagent, and silver dye 8min, cleans color development stopping with ultrapure water, observations.
3 results and analysis
The check and evaluation of the 3.1 known positives and negative sample
Three kinds of sick positive sample and negative sample are extracted RNA respectively, and reverse transcription is cDNA, is that template carries out the amplification of PCR mark with cDNA, and the marked product of amplification and PRRSV-CSFV examine visual gene chip hybridization altogether, silver-coloredly to contaminate.In the assessment of positive detects, all probes are all combined with positive sample, and produce obvious positive signal; In the check and evaluation of negative sample, only have the probe of positive quality control to have obvious positive signal, other probes are all shown as feminine gender.
3.2 clinical samples detect application
The 102 parts of clinical samples in the ground such as Sichuan Meishan, Mianyang, Leshan being extracted reverse transcription after RNA is cDNA, be that template carries out the amplification of PCR mark with cDNA, it is as shown in table 4 that the marked product of amplification and PRRSV-CSFV examine visual gene chip hybridization altogether, silver contaminates rear result: in 102 parts of clinical samples, the recall rate of porcine reproductive and respiratory syndrome virus is 46%, and the recall rate of Pestivirus suis is 38%; There is the phenomenon of polyinfection, the recall rate of wherein porcine reproductive and respiratory syndrome virus and Pestivirus suis polyinfection is 6.8%.The coincidence rate of conventional RT-PCR technology and biochip technology is more than 97.5%.Therefore, swine fever is a kind of disease of serious harm Sichuan province aquaculture, is secondly that porcine reproductive and respiratory syndrome is sick, and swine fever and porcine reproductive and respiratory syndrome disease exist comparatively general polyinfection.
Table 4 clinical sample detected result
Experimental result illustrates, adopts gene chip of the present invention, and whether use according to the inventive method, effectively can detect clinical sample has porcine reproductive and respiratory syndrome virus and Pestivirus suis.
To sum up, test kit of the present invention and gene chip can effectively detect Pestivirus suis and porcine reproductive and respiratory syndrome virus, and high specificity, susceptibility are high, consuming time short, detect fast, have a good application prospect.
Claims (7)
1. detect a visual gene chip for Pestivirus suis and/or porcine reproductive and respiratory syndrome virus, it is characterized in that: it comprises solid phase carrier and is fixed on the probe on solid phase carrier; Described probe comprises oligonucleotide fragment shown in oligonucleotide fragment shown in SEQIDNO:1 and SEQIDNO:2, for detecting Pestivirus suis and/or porcine reproductive and respiratory syndrome virus respectively;
Described gene chip is prepared as follows:
(1) preparing probe solution: get probe, with being diluted to 200ng/ul, obtaining probe solution;
(2) adopt mini sprinkler specking mode, when pressure is 10KPa, by probe solution point sample on amino slide, repeat twice.
2. gene chip according to claim 1, is characterized in that: it also comprises position probe, and position probe is the gene fragment shown in SEQIDNO:3.
3. prepare a method for visual gene chip described in claim 1 or 2, it is characterized in that: step is as follows:
(1) preparing probe solution: get probe, with being diluted to 200ng/ul, obtaining probe solution;
(2) adopt mini sprinkler specking mode, when pressure is 10KPa, by probe solution point sample on amino slide, repeat twice.
4. detect a test kit for Pestivirus suis and/or porcine reproductive and respiratory syndrome virus, it is characterized in that: it comprises visual gene chip, amplifing reagent and colouring reagents described in claim 1 or 2;
Wherein, amplifing reagent comprises primer pair shown in SEQIDNO:4 ~ 5 and/or 6 ~ 7, for Pestivirus suis and/or the porcine reproductive and respiratory syndrome virus gene of increasing respectively;
Colouring reagents comprises gold mark Streptavidin and silver-colored transfection reagent.
5. test kit according to claim 4, is characterized in that: described amplifing reagent also comprises primer pair shown in SEQIDNO:8 ~ 9.
6. test kit according to claim 4, is characterized in that: described gold mark Streptavidin is the solution after Nanogold-Streptavidin dilution 10 ~ 40 times.
7. test kit according to claim 6, is characterized in that: what described gold marked Streptavidin is the solution that Nanogold-Streptavidin dilutes after 40 times.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510307112.6A CN105039589A (en) | 2015-06-05 | 2015-06-05 | Visual gene chip and reagent box for hog cholera virus and/or porcine reproductive and respiratory syndrome virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510307112.6A CN105039589A (en) | 2015-06-05 | 2015-06-05 | Visual gene chip and reagent box for hog cholera virus and/or porcine reproductive and respiratory syndrome virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105039589A true CN105039589A (en) | 2015-11-11 |
Family
ID=54446554
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510307112.6A Pending CN105039589A (en) | 2015-06-05 | 2015-06-05 | Visual gene chip and reagent box for hog cholera virus and/or porcine reproductive and respiratory syndrome virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039589A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104232800A (en) * | 2014-09-29 | 2014-12-24 | 四川农业大学 | Gene chip and kit for detecting porcine japanese encephalitis virus, swine fever virus and porcine reproductive and respiratory syndrome virus |
| CN104293978A (en) * | 2014-09-29 | 2015-01-21 | 四川农业大学 | Gene chip and kit for detecting swine fever viruses (SFVs) and/or porcine reproductive and respiratory syndrome viruses (PRRSVs) |
-
2015
- 2015-06-05 CN CN201510307112.6A patent/CN105039589A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104232800A (en) * | 2014-09-29 | 2014-12-24 | 四川农业大学 | Gene chip and kit for detecting porcine japanese encephalitis virus, swine fever virus and porcine reproductive and respiratory syndrome virus |
| CN104293978A (en) * | 2014-09-29 | 2015-01-21 | 四川农业大学 | Gene chip and kit for detecting swine fever viruses (SFVs) and/or porcine reproductive and respiratory syndrome viruses (PRRSVs) |
Non-Patent Citations (2)
| Title |
|---|
| XUE L等: "Visual DNA microarray for detection of epidermal growth factor receptor (EGFR) gene mutations", 《SCANDINAVIAN JOURNAL OF CLINICAL AND LABORATORY INVESTIGATION》 * |
| 张仙 等: "可视化芯片技术研究进展", 《动物医学进展》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110551853A (en) | Triple PCR detection primer and kit for rapidly distinguishing African swine fever virus wild strain and gene deletion strain | |
| CN104232801B (en) | Detection Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and the kit of porcine rotavirus | |
| CN114134236A (en) | Application of reagent for detecting SNP molecular marker in goat RBP4 genotyping and/or goat molecular marker assisted breeding | |
| CN111334608A (en) | Dual-fluorescence freeze-drying microchip, kit and method for detecting novel coronavirus 2019-nCoV | |
| CN104263857B (en) | A kind of nano PCR kit of quick detection mink enteritis virus and its application | |
| CN111850134A (en) | Specific forward and reverse primers and probe for rainbow trout, detection kit and application of specific forward and reverse primers and probe | |
| CN103952497B (en) | A kind of hepatitis B virus detecting method based on DNAzyme probes | |
| CN111197110A (en) | RPA-FLD method for detecting feline panleukopenia virus | |
| CN105018643A (en) | Visual gene chip and kit used for detecting porcine epidemic encephalitis b viruses and/or hog cholera viruses | |
| CN105039598A (en) | Detection kit for ORF1a2 gene of Middle East respiratory syndrome coronavirus | |
| CN105002284A (en) | Haemophilus paragallinarum fluorogenic quantitative PCR detection method | |
| CN105154584A (en) | HRM (high-resolution melting) label-free probe method, primer and probe for quickly differentiating PRRSV (porcine reproductive and respiratory syndrome virus) classical strains and mutant strains | |
| CN108531648B (en) | Oligonucleotide chip for synchronously detecting 4 porcine diarrheal viruses and application thereof | |
| CN104357584A (en) | Preparation and application of guiding gene chip for HCV infection individual treatment | |
| WO2018040320A1 (en) | Detection method and kit for human fructose bisphosphate aldolase b gene | |
| CN105018642A (en) | Visual gene chip and kit used for detecting porcine epidemic encephalitis b viruses and/or porcine reproductive and respiratory syndrome viruses | |
| CN102286636A (en) | Dengue virus detection and parting method, special chip and kit | |
| CN105039589A (en) | Visual gene chip and reagent box for hog cholera virus and/or porcine reproductive and respiratory syndrome virus | |
| CN105039588A (en) | Gene chip and reagent box for detecting porcine epidemic encephalitis B virus, hog cholera virus and porcine reproductive and respiratory syndrome virus | |
| CN111394434B (en) | CHO host cell DNA residue detection kit adopting TaqMan probe method and application thereof | |
| CN104046701B (en) | A kind of rabbit hemorrhagic disease virus RT-LAMP detection method being not used in diagnostic purpose | |
| CN107513494A (en) | A kind of detection of nucleic acids card and its application method | |
| CN107267666A (en) | A kind of fluorescent quantitation RT PCR detection kits based on pig atypia pestivirus raq gene | |
| CN109136386B (en) | Quantitative PCR method and kit for rapid typing and tracing of yarrowia carotovora | |
| CN111394521A (en) | Gene chip for differential diagnosis of swine fever wild virus and vaccine thereof and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151111 |