CN104293978A - Gene chip and kit for detecting swine fever viruses (SFVs) and/or porcine reproductive and respiratory syndrome viruses (PRRSVs) - Google Patents
Gene chip and kit for detecting swine fever viruses (SFVs) and/or porcine reproductive and respiratory syndrome viruses (PRRSVs) Download PDFInfo
- Publication number
- CN104293978A CN104293978A CN201410515790.7A CN201410515790A CN104293978A CN 104293978 A CN104293978 A CN 104293978A CN 201410515790 A CN201410515790 A CN 201410515790A CN 104293978 A CN104293978 A CN 104293978A
- Authority
- CN
- China
- Prior art keywords
- seq
- gene
- respiratory syndrome
- porcine reproductive
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Abstract
The invention discloses a gene chip and kit for detecting swine fever viruses (SFVs) and/or porcine reproductive and respiratory syndrome viruses (PRRSVs). The gene chip comprises a solid phase carrier and a probe immobilized on the solid phase carrier, wherein the probe comprises any one or two oligonucleotide fragments shown in SEQ ID NO:1 or 2 and/or any one or two oligonucleotide fragments shown in SEQ ID NO:3 or 4. The kit comprises the chip and reagents for amplifying genes of the SFVs and/or the PRRSVs. The gene chip and the detection kit can be used for accurately and effectively detecting the SFVs and the PRRSVs, have strong specificity, high sensitivity and good application prospects, consume short time and are fast in detection.
Description
Technical field
The present invention relates to a kind of gene chip and the test kit that detect Pestivirus suis and/or porcine reproductive and respiratory syndrome virus.
Background technology
The polyinfection of many cause of diseases is the universal phenomenon of current pig farm epidemic disease, the disease symptoms that this two boar of porcine reproductive and respiratory syndrome, swine fever virus causes is similar and usually in polyinfection, be 2 kinds of important virus diseases of current harm pig industry, popular the seeming that therefore Early Identification diagnosis also understands epidemic status sick to control these 2 kinds is in time even more important.At present the separation of cause of disease and the serological method of routine are adopted more to these 3 kinds sick diagnosis, but it is longer to take time.External and the domestic isolation identification, immune colloidal gold technique, enzyme linked immunosorbent assay, serum Neutralizing test, polymerase chain reaction etc. all establishing cause of disease recently, but the polyinfection of multiple cause of disease can't be detected more fast.
Biochip technology is the biological new and high technology of new one of rising in recent years, and this technology can simultaneous quantitative or detect thousands of gene informations qualitatively, has non-selectivity, objective, high-throughout feature.After gene chip program launched, many departments, university, key lab and drugmaker take part in the research and development of this project, and China has also set up large quantities of gene chip company in succession.Along with the growth of genomic data and the fast development of molecular biology related discipline, biochip technology obtains fast development and widespread use.But biochip technology development time is shorter, a lot of technology is also in elementary development, become laboratory study or the clinical technology that can generally adopt still has many key issues urgently to be resolved hurrily.(1) the specific raising of gene chip; (2) sensitivity of signal detection is increased; (3) sample preparation and marking operation is simplified; (4) requirement of equipment and manipulation personnel is higher; (5) unification of application standard.
At present, notification number be CN102234693A patent discloses the gene chip simultaneously detecting Pestivirus suis, porcine reproductive and respiratory syndrome virus and porcine circovirus 2 type, the lowest detection of the various virus of this genechip detection is limited to 1ng/L, and sensitivity is not high.
Summary of the invention
In order to solve the problem, the invention provides a kind of new high specificity, highly sensitive gene chip and the test kit that can detect Pestivirus suis and porcine reproductive and respiratory syndrome virus simultaneously.
Gene chip, refer to and refer to, by different methods, biomolecules (oligonucleotide, cDNA, genomic DNA, polypeptide, antibody, antigen etc.) is bonded to the biomolecules dot matrix that the solid phase mediators such as silicon chip, sheet glass (pearl), plastic sheet (pearl), gel, nylon membrane are formed, its outstanding feature is microminiaturized, integrated, parallelization and high-throughput.
The present invention detects the gene chip of Pestivirus suis and/or porcine reproductive and respiratory syndrome virus, and it comprises solid phase carrier and is fixed on the probe on solid phase carrier; Described probe to comprise shown in SEQ ID NO:1 or 2 any one or two oligonucleotide fragments, and/or any one or two oligonucleotide fragments shown in SEQ ID NO:3 or 4.
Preferably, it also comprises position probe, and position probe is the gene fragment shown in SEQ ID NO:13.
The present invention detects the test kit of Pestivirus suis and/or porcine reproductive and respiratory syndrome virus, and it comprises the reagent of the gene of aforesaid gene chip and amplification Pestivirus suis and/or porcine reproductive and respiratory syndrome virus; Wherein, the reagent of amplification Pestivirus suis gene comprises primer pair shown in SEQ ID NO:5 ~ 6 and/or SEQ ID NO:7 ~ 8; The reagent of amplification porcine reproductive and respiratory syndrome virus gene comprises primer pair shown in SEQ ID NO:9 ~ 10 and/or SEQ ID NO:11 ~ 12.
It also comprises primer pair shown in SEQ ID NO:14 ~ 15.
Preferably, in described primer pair, shown in SEQ ID NO:5,7,9,11, shown in upstream primer and SEQ ID NO:6,8,10,12, the mol ratio of downstream primer is respectively 80:1,80:1,20:1,10:1.
Any one or two oligonucleotide fragments shown in SEQ ID NO:1 or 2, and/or any one or two oligonucleotide fragments shown in SEQ ID NO:3 or 4 detect Pestivirus suis and/or porcine reproductive and respiratory syndrome virus in preparation gene chip in purposes.
Preferably, described gene chip also comprises position probe, and position probe is the gene fragment shown in SEQ ID NO:13.
Any one or two oligonucleotide fragments shown in primer pair and SEQ ID NO:1 or 2 shown in SEQ ID NO:5 ~ 6 and/or SEQ ID NO:7 ~ 8, and/or shown in SEQ ID NO:9 ~ 10 and/or SEQ ID NO:11 ~ 12, primer pair is preparing the purposes in the test kit detecting Pestivirus suis and/or porcine reproductive and respiratory syndrome virus with any one or two oligonucleotide fragments SEQ ID NO:3 or 4 shown; Wherein, primer pair is amplifing reagent; SEQ ID NO:1 ~ 4 are detection probes.
Preferably, described test kit also comprises position probe shown in primer pair shown in SEQ ID NO:14 ~ 15 and SEQ ID NO:13.
Preferably, in described primer pair, shown in SEQ ID NO:5,7,9,11, shown in upstream primer and SEQ ID NO:6,8,10,12, the mol ratio of downstream primer is respectively 80:1,80:1,20:1,10:1.
Gene chip of the present invention and test kit can effectively detect Pestivirus suis and porcine reproductive and respiratory syndrome virus, and susceptibility is high, and the minimal detectable concentration of two-strain is 10
4copies/ μ L, high specificity, consuming time short, detect fast, have a good application prospect.
The embodiment of form by the following examples, is described in further detail foregoing of the present invention.But this should be interpreted as that the scope of the above-mentioned theme of the present invention is only limitted to following embodiment.The technology that all contents recorded based on claims of the present invention realize all belongs to scope of the present invention.
Accompanying drawing explanation
The arranged situation of Fig. 1 DNA microarray;
The optimization of Fig. 2 Erns gene by fluorescence and non-fluorescence primer working concentration;
The optimization of Fig. 3 CSF1 gene by fluorescence and non-fluorescence primer working concentration;
The optimization of Fig. 4 PS9 gene by fluorescence and non-fluorescence primer working concentration;
The optimization of Fig. 5 Y11 gene by fluorescence and non-fluorescence primer working concentration;
Fig. 6 specificity experiments detected result.
Embodiment
One, experiment material and instrument
Strain:
Porcine reproductive and respiratory syndrome virus (PRRSV) strain, Pestivirus suis (CSFV) strain, purchased from China Veterinary Drugs Supervisory Inst..
Reagent:
Total serum IgE extraction agent box is sky root (Beijing) biochemical technology company limited product; PrimeScriptTMRT reagent Kit (Perfect Real Time) is precious biotechnology (Dalian) company limited product; Mini-scale plasmid extracts test kit, in a small amount glue and reclaims test kit, is OMEGA (U.S.) biotech company product.
amino slide glass,
2 × spotting buffer,
pre-hybridization buffer,
hybridization buffer, all purchased from Baiao Science and Technology Co. Ltd., Shanghai; Cy3-dCTP:25nmol, PA53021, Lot300989, Amersham Biosciences, UK; Washing lotion I: 0.1%SDS 2 × SSC; Washing lotion II: 0.1%SDS 0.2 × SSC; Washing lotion III: 0.2 × SSC; Washing lotion 4: distilled water.
Instrument:
Bechtop: SW-CJ-2FD, SuZhou Antai Air Tech Co., Ltd.;
Ultrapure water instrument: Milli Qplus, method is domestic;
Grads PCR instrument: P × 2, Thermo hybaid, the U.S. produces;
High speed freezing centrifuge 3K18 type:
germany produces;
Mini-SUB gel electrophoresis apparatus:
italy produces;
Electrophoresis apparatus: POWER Pac300,
italy produces;
Gel electrophoresis images analytical system 2000 type:
italy produces;
Constant-temperature table: Thermo Forma, the U.S. produces;
Nucleic acid-protein detector: Bio-RAD, SmartSpaee TM 3010;
Hybridization Oven: Thermo, the U.S. produces;
Multi-example fence, Multi-example fence paste tool, Multi-example fence cover plate, chip hybridization box is Beijing Bo Ao biotech firm;
Brilliant core
smartArrayer
tM48, micro-array chip spotting system: Capitalbio Corporation, Beijing Bo Ao biotech firm;
Brilliant core
luxScan
tM10K micro-array chip scanner: Capitalbio Corporation, Beijing Bo Ao biotech firm;
Vacuum machine: SinBo, Hong Kong;
CO
2constant incubator: Thermo, the U.S. produces.
The preparation of embodiment 1 gene chip of the present invention
1, material and instrument
With aforementioned experiment material and instrument.
2, experimental technique
The preparation of 2.1PCR primer, detection probes
(1) cause of disease specific probe is designed: by the Pestivirus suis of including in GenBnak, porcine reproductive and respiratory syndrome virus nucleotide sequence contraposition arrangement analysis, select conservative region sequence: CSFV5 ' UTR, 3 ' UTR, Npro, Erns, E2; PRRSV 5 ' UTR, ORF1b, ORF5, ORF6, ORF7.For conserved sequence design detection probes, select the probe sequence of high specificity.
(2) Auele Specific Primer of designing probe sequence: for above-mentioned conservative probe sequence, utilizes bioinformatics software Primer5 to design Auele Specific Primer.Auele Specific Primer is synthesized by the precious biotech firm in Dalian.
(3) probe preparation: extract Pestivirus suis, porcine reproductive and respiratory syndrome virus with a small amount of virus/liquid sample RNA/DNA extraction agent box, utilize above-mentioned Auele Specific Primer to carry out pcr amplification to three kinds of cause of disease nucleic acid, purifying concentration determination.
PCR amplification system and condition:
Reaction conditions: l) 94 DEG C of sex change 2min; 2) 94 DEG C of sex change 30S, 50 DEG C of annealing 30S, 72 DEG C extend 30S, totally 35 circulations; 3) 72 DEG C extend 10min, 4 DEG C of maintenances.
(4) screening of probe: synthetic probe is dissolved and makes gene chip with gene chip sample applying instrument point on amination glass substrate after appropriate dilution, carry out probe screening by cross experiment, finally obtain detecting special, sensitive probe needed for gene chip for the preparation of the present invention: CSFV CSF1 (5 ' UTR), Erns (Erns); PRRSV PS9 (5 ' UTR), Y11 (ORF6).
(5) the genomic foundation of probe: the CSFV CSF1 (5 ' UTR), the Erns (Erns) that glue are reclaimed purifying; PRRSV PS9 (5 ' UTR), Y11 (ORF6) pMD 18-T Vector connect, and linked system is pMD 18-T Vector 0.5ul, and glue reclaims probe 5.0ul, connecting fluid 4.5ul, total amount 10.0ul.Ligation carries out 16h at 16 DEG C; 10.0ul probe being connected product adds in 200ul competent cell JM109 prepared by Calcium Chloride Method, ice bath 30min after mixing gently, put into ice bath immediately after 42 DEG C of heat-shocked 90s and cool 5min, add 800ul LB liquid nutrient medium, 37 DEG C of slight oscillatory cultivate 3h.Getting 200ul culture coats containing X--Gal, IPTG, LB Agar Plating containing ammonia benzyl, 37 DEG C of overnight incubation, selects white colony and carries out Zengjing Granule and plasmid PCR is identified and send precious biological order-checking.
(6) the genomic preservation of probe: the correct plasmid of order-checking is carried out amplification cultivation, and carries out freeze-drying with 20% skimmed milk as protective material, as-80 DEG C of preservations.
The nucleotide sequence of primer and probe is as follows:
SEQ?ID?NO:1(Erns)
Source gene source: CSFV, Erns, virulent strain
Gene size and sequence: 301bp
tcaatggaac?ctgagtgaca?acggcactaa?tggtattcag?catgctatgt?accttagagg?ggttagcagaagcttgcatg?ggatctggcc?ggaaaaaata?tgcaaaggag?tccccaccta?cctggccaca?gacacggaactgaaagaaat?acagggaatg?atggatgcca?gcgaggggac?aaactatacg?tgctgtaagt?tacagagacatgaatggaac?aaacatggat?ggtgtaactg?gtacaatata?gacccatgga?tacagttgat?gaatagaacccaagcagact?tggcagaagg?c
SEQ?ID?NO:2(CSF1)
Source gene source: CSFV, 5 ' UTR is malicious by force
Gene size and sequence: 143bp
acaggacagt?cgtcagtagt?tcgacgtgag?cagaagccca?cctcgagatg?ctatgtggacgagggcgtgc?ccaagacgca?ccttaaccct?agcgggggtc?gctagggtga?aatcacacca?cgtgatgggagtacgacctg?ata
SEQ?ID?NO:3(PS9)
The source gene source of clone gene: PRRS US, 5'UTRPS9-primer, C14-2 strain isolated
Gene size and sequence: 174bp
cgtataggtg?ttggctctat?gccttggcat?ttgtattgtc?aggagctgtg?accattggca?cagcccaaaacttgccgcac?agaaacaccc?ttctgtgata?gcctccttca?ggggagctta?gggtttgtcc?ctagcaccttgcttccggag?ttgcactgct?ttacggtctc?tcca
SEQ?ID?NO:4(Y11)
Source gene source: C14-2 strain isolated, ORF6, PRRS-US type
Gene size and sequence: 155bp
tcacctccag?atgccgtttg?tgcttgctag?gccgcaagta?cattctggcc?cctgcccacc?acgttgaaag?tgccgcaggc?tttcatccga?ttgcggcaaa?tgataaccac?gcatttgtcg?tccggcgtcc?cggctccactacggtcaacg?gcaca
SEQ?ID?NO:7~8(Erns-primer)
F?5’TCAATGGAACCTGAGTGACAAC3’
R?5’TATTGTGCCAGTTACACCATCC3’
SEQ?ID?NO:9~10(CSF1-primer)
F?5’ACAGGACAGTCGTCAGTAGTTC3’
R?5’TATCAGGTCGTACTCCCATCAC3’
SEQ?ID?NO:11~12(PS9-primer)
F?5’CGTATAGGTGTTGGCTCTATGC3’
R?5’TGGAGAGACCGTAAAGCAGTG3’
SEQ?ID?NO:13~14(Y11-primer)
F?5’TCACCTCCAGATGCCGTTTG3’
R?5’TGTGCCGTTGACCGTAGTG3’
The sequence (SEQ ID NO:13) of gene location (λ DNA)
aaagcgaggc?tttttggcct?ctgtcgtttc?ctttctctgt?ttttgtccgt?ggaatgaaca?atggaagtca
acaaaaagca?gctggctgac?attttcggtg?cgagtatccg?taccattcag?aactggcagg?aacagggaat
gcccgttctg?cgaggcggtg?gcaagggtaa?tgaggtgctt?tatgactctg?ccgccgtcat?aaaatggtat
gccgaaaggg?atgctgaaat?tgagaacgaa?aagctgcgcc?gggaggttga?agaactgcgg?caggccagcg
aggcagatct?ccagccagga?actattgagt?acgaacgcca?tcgacttacg?cgtgcgcagg?ccgacgcaca
ggaactgaag?aatgccagag?actccgctga?agtggtggaa?accgcattct?gtactttcgt?gctgtcgcgg
atcgcaggtg?aaattgccag?tattctcgac?gggctccccc?tgtcggtgca?gcggcgtttt?ccggaactgg
aaaaccgaca
SEQ ID NO:14 ~ 15 (amplimer of gene location complementary sequence)
F:AAAGCGACGCAATGAGGCACT
R:GTTCCACGACCGCAACTGC
The structure of 2.2 standard plasmids
2.2.1 genomic extracting
Total serum IgE extracting adopts the total RNA extraction reagent box of sky root, and with reference to illustrating, concrete operation method is as follows:
1) directly get 200 μ L virus allantoic fluids in 1.5mL centrifuge tube, add 600 μ L lysates, mixing of fully vibrating;
2) homogenised sample is placed 5min at 15-30 DEG C;
3) 4 DEG C, the centrifugal 5min of 12000r/min, is drawn onto supernatant liquor in new centrifuge tube;
4) add 200 μ L chloroforms, acutely vibrate 15sec up and down, and room temperature leaves standstill 3min;
5) 4 DEG C, the centrifugal 10min of 12000r/min, sample can produce layering, forwards in new pipe lightly by aqueous phase colourless for the superiors;
6) add 0.5 times of volume dehydrated alcohol, mixing, transfers in adsorption column, 4 DEG C, the centrifugal 30sec of 12000r/min;
7) 500 μ L protein liquid removals are added, 4 DEG C, the centrifugal 30sec of 12000r/min;
8) add 600 μ L rinsing liquids, leave standstill 2min, 4 DEG C, the centrifugal 30sec of 12000r/min; Repeat once
9) 4 DEG C, the centrifugal 2min of 12000r/min, discards residual liquid;
10) forwarded in RNase-Free centrifuge tube by adsorption column, add 50 μ L RNase-Free ultrapure waters, room temperature leaves standstill 2min, 4 DEG C, the centrifugal 2min of 12000r/min.The viral RNA that namely centrifugate obtain, saves backup or directly carries out reverse transcription at-20 DEG C.
2.2.2 the RT-PCR of probe gene and pcr amplification
With the RNA of extracting for template, with Random 6primers for primer synthesizes cDNA, reaction system is as follows:
RT?Enzyme?Mix | 0.5μL |
Random?6primers | 0.5μL |
5×PrimeScript?RT?Buffer | 2.0μL |
RNA | 2.0μL |
RNase-Free ultrapure water | 5.0μL |
Total | 10.0μL |
CDNA synthesis is carried out by program below: response procedures is 37 DEG C, 15min by after the mixing of above-mentioned system; 85 DEG C, 5sec; 4 DEG C, preserve.
With the cDNA of reverse transcription synthesis for template, carry out PCR reaction, reaction system is as follows:
2×Taq?PCR?MasterMix | 12.5μL |
cDNA/DNA | 2.0μL |
Upstream specific primer (25.0 μm of ol/L) | 0.5μL |
Downstream specific primer (25.0 μm of ol/L) | 0.5μL |
Ultrapure water | 9.5μL |
Total | 25.0μL |
Reaction conditions is as follows:
After PCR, get 7 μ L amplified production sepharoses respectively and carry out electrophoretic analysis.
2.2.3 the glue of probe gene reclaims
The glue of probe gene reclaims, and adopt OMEGA glue recovery test kit in a small amount, carries out reclaimer operation with reference to illustrating, step is as follows:
1) get 20 μ LPCR products and carry out electrophoresis, 6V/cm, 25min, ultraviolet lamp incision glue, weighs.Illustrate according to test kit and carry out glue recovery;
2) add Binding Buffer (XP2) in the ratio of 1:1,55 DEG C of-60 DEG C of water-baths are until glue all melts, and period to turn upside down centrifuge tube every 2-3min;
3) add in adsorption column by liquid, the centrifugal 1min of room temperature 12000r/min, outwells filtrate;
4) add 300Binding Buffer (XP2), the centrifugal 1min of room temperature 12000r/min, outwells filtrate;
5) add 700mL rinsing liquid SPW, the centrifugal 1min of room temperature 12000r/min, outwells filtrate;
6) room temperature 12000r/min is empty from 2min, outwells filtrate;
7) be put in new centrifuge tube by adsorption column, add 30mL elution buffer, room temperature leaves standstill 1min;
8) the centrifugal 2min of room temperature 12000r/min, get 7 μ L recovery products and carry out electrophoresis, checking recovering effect, all the other reclaim products and save backup in-20 DEG C.
2.2.4 the connection restructuring of probe gene
Adopt pMD19-T Simple Vector Cloning Kit, carry out the connection restructuring of probe gene, concrete steps are illustratively carried out.Linked system is as follows:
PMD19-T Simple carrier | 0.5μL |
Glue reclaims PCR primer | 5.0μL |
Solution?I | 4.5μL |
Total | 10.0μL |
4 DEG C of connections are spent the night, and connect product for transforming DH5 α competent cell.
2.2.5 the Making and banking of competent cell
With reference to " Molecular Cloning: A Laboratory guide " Calcium Chloride Method
[56]preparation DH5 α competent cell, the competent cell prepared is packed as 100 μ L/ and manage, is directly used in conversion or in-70 DEG C of preservations.
2.2.6 the conversion of product is connected
100 μ L recipient cells are placed on ice, add 10 μ L wherein and connect product, ice bath 30min; 42 DEG C of water-bath heat-shocked 90s, quick ice bath cooling 5min; Add the LB liquid nutrient medium (without the need to operating) of 600 μ L, 37 DEG C of preheatings immediately on ice, 37 DEG C, 150r/min shaking culture 1h, makes recipient bacterium restore normal growth state; Get 150 μ L cultures and be spread evenly across LB flat board (containing 100mg/mL Amp), dry, cultivate about 12h in 37 DEG C, picking colony is identified.
2.2.7 the qualification of probe plasmid bacterial and preservation
2.2.7.1 the DNA extracting of probe plasmid bacterial
Positive plasmid bacterium is inoculated in 5mL LB (containing 100mg/mL Amp) liquid nutrient medium, 37 DEG C of shaking culture 12h; Extract test kit illustration method by Omega mini-scale plasmid and extract plasmid.Concrete steps are as follows:
1) inhale 1mL bacterium liquid in centrifuge tube, the centrifugal 1min of room temperature 12000r/min, inhales and abandons supernatant;
2) add 250 μ L Solution I (4 DEG C of storages), vibration makes thalline suspend;
3) add 250 μ L Solution II, put upside down mixing lightly, leave standstill 2min;
4) add 350 μ L Solution III, gentleness is put upside down for several times to forming white flock precipitate thing, room temperature 12000r/min, centrifugal 10min;
5) proceed in adsorption column by the liquid of previous step, the centrifugal 1min of room temperature 12000r/min, outwells filtrate;
6) add 500 μ L Buffer HB to it, the centrifugal 1min of room temperature 12000r/min, outwells filtrate;
7) add 700 μ L Buffer Wash Buffer to it, the centrifugal 1min of room temperature 12000r/min, outwells filtrate; Repeat once;
8) room temperature 12000r/min is empty from 2min, is loaded on by pillar in a clean centrifuge tube, adds 30 μ L Elution Buffer to it, and leave standstill the centrifugal 1min of 2min, 12000r/min, the centrifugate of collection is the plasmid DNA of extraction.
2.3.7.2 the PCR qualification of probe plasmid bacterial
Carry out PCR qualification respectively to the probe plasmid bacterial extracted, make negative control with pMD19-T Simple empty vectors, reaction system is as follows simultaneously:
2×Taq?PCR?MasterMix | 7.5μL |
Upstream specific primer (25.0 μm of ol/L) | 0.5μL |
Downstream specific primer (25.0 μm of ol/L) | 0.5μL |
Plasmid (50 times of dilutions) | 2.0μL |
Ultrapure water | 4.5μL |
Total | 15.0μL |
Response procedures is the same.React complete, get the sepharose of 5 μ L in 2.0% respectively and carry out electrophoretic analysis.
2.2.8 the Sequencing and Characterization of probe plasmid bacterial
Adopt the two deoxidation chain termination method of Sanger to carry out sequencing to being accredited as positive probe plasmid bacterial through PCR, sequencing efforts transfers to Shanghai Jie Li Bioisystech Co., Ltd to complete.
Must be checked order correct plasmid bacterial T/Erns, T/CSF1, T/PS9, T/Yll, comprises SEQ ID NO:1 (Erns), SEQ ID NO:2 (CSF1), SEQ ID NO:3 (PS9), SEQ ID NO:4 (Yll) described gene fragment respectively.
2.2.9 the preservation of probe plasmid bacterial
Probe plasmid bacterial enlarged culturing correct for sequencing, then using 20% skim-milk as protective material freeze-drying ,-70 DEG C of preservations.
2.3 chip preparations
(1) design of chip matrix: often open chip and be divided into four districts, four districts are four repeat arrays, separate with hybridization fence, to carry out the hybridization of three different samples simultaneously.Each array parameter is: often row's probe gene and gene location are 12 sampling points, various kinds dot center spacing 650um, and spot diameter is 220um.(Fig. 1)
Gene chip sample applying buffer becomes sampling liquid, Pestivirus suis, porcine reproductive and respiratory syndrome virus rna probe, gene location and negative Quality Control gene quantification will be comprised and be 200ng/ul to working concentration, be heated to 95 DEG C and keep 5min, be then placed in cooled on ice 10min.
By chip design requirement add in 96 (384) hole load sample plate holes dilution sex change good comprise Pestivirus suis, porcine reproductive and respiratory syndrome virus rna probe, gene location, negative Quality Control gene and blank Quality Control damping fluid, seal orifice plate, with gene chip sample applying system (Microarray Printing System, SpotArrayTM 24) contact point sample on amination substrate.Point sample ambient relative humidity is 55%-65%, temperature 15-30 DEG C.
The chip that point makes is statically placed in abundant dried overnight (at least 6h) on point sample instrument, then 60-80 DEG C of hydration-treated 10s is used, immediately in being heated to 80 DEG C of In situPCR instrument are dried, after ultraviolet-crosslinkable 25min, with 0.2%SDS liquid washing 5min, again with centrifugal drying after distilled water quick wash, sealing, room temperature preservation is for subsequent use.
Embodiment 2 detection method
1, nucleic acid extraction
The total RNA extraction reagent box of it root, with reference to specification sheets operation, concrete steps are as follows:
1) that cuts suitable size with scissors organizes pathological material of disease in mortar, add appropriate RZ lysate, be ground to homogenate, get 300 μ l and manage in 1.5ml EP, every 50-100mg tissue adds 1ml RZ lysate RZ, and sample volume should not exceed 1/10th of lysate RZ volume.
2) homogenised sample is placed 5min at 15-30 DEG C;
3) 4 DEG C, the centrifugal 5min of 12000r/min, gets supernatant, proceed to one new in the centrifuge tube of RNase;
4) add 200 μ L chloroforms, acutely vibrate 15sec up and down, and room temperature leaves standstill 3min;
5) 4 DEG C, the centrifugal 10min of 12000r/min, sample can divide three layers, forwards in new pipe lightly by aqueous phase colourless for the superiors;
6) slowly add 0.5 times of volume dehydrated alcohol, be transferred in adsorption column CR3 after mixing, 4 DEG C, the centrifugal 30sec of 12000r/min;
7) in adsorption column CR3, add 500 μ L protein liquid removals, 4 DEG C, the centrifugal 30sec of 12000r/min, abandons waste liquid;
8) in adsorption column CR3, add 600 μ L rinsing liquids, leave standstill 2min, 4 DEG C, the centrifugal 30sec of 12000r/min, abandons waste liquid; Repeat once
9) 4 DEG C, the centrifugal 2min of 12000r/min, discards residual liquid, uncaps and dry 5min;
10) be transferred in RNase-Free centrifuge tube by adsorption column CR3, add 50 μ L RNase-Free ultrapure waters, room temperature leaves standstill 2min, 4 DEG C, the centrifugal 2min of 12000r/min.The viral RNA that namely centrifugate obtain, saves backup in-70 DEG C or directly carries out reverse transcription.
The product TAKARA Reverse Transcription box specification sheets reverse transcription of extraction carried out, concrete system is as follows:
RT?Enzyme?Mix | 0.5μL |
Random?6primers | 0.5μL |
5×PrimeScript?RT?Buffer | 2.0μL |
RNA | 2.0μL |
RNase-Free ultrapure water | 5.0μL |
Total | 10.0μL |
CDNA synthesis is carried out: response procedures is 37 DEG C, 15min by arranging program below after above-mentioned system mixing; 85 DEG C, 5sec; 4 DEG C, preserve.
2, pcr amplification mark
The mark of 2.1 sample of nucleic acid
Primer mark method with mix labelling method
With λ DNA, each probe gene recombination plasmid for template, the primer adding the modification of fluorescein Cy3 mark respectively carries out pcr amplification, and amplification system is as follows:
10×Ex?buffer(Free?Mg 2+) | 5.0ul |
25mmol/LMgC1 2 | 4.0ul |
10.0mmol/L?dNTP?Mixture | 4.0ul |
5U/uL?Ex?Taq | 0.5ul |
The upstream primer of 5 ' end Cy3 mark | 1ul |
The downstream primer of 5 ' end Cy3 mark | 1ul |
CDNA template | 2ul |
dH 2O | Add to 50ul |
Amplification condition is: l) 94 DEG C of sex change 3min; 2) 94 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 30s, totally 35 circulations; 3) 72 DEG C extend 10min, 12 DEG C of maintenances.
The asymmetric labeling technology of 2.2 gene chips
(1) determination of asymmetric PCR primer concentration
With positive plasmid T/Erns, T/CSF1, T/PS9, T/Y11 of building for template, use ddH
2o will not carry out fluorescently-labeled primer (i.e. upstream primer) and will dilute, make R:F concentration ratio be respectively 1 ︰ 1,5 ︰ 1,10 ︰ 1,20 ︰ 1,40:1,50 ︰ 1,60:1,80:1, T/Erns, T/CSF1, T/PS9, T/Y11 are that the asymmetric PCR gradient of template is denoted as Y1-Y9, y1-y6, Z1-Z9, z1-z6 respectively.The positive plasmid prepared using laboratory dilutes 50 times as template.The primer different by concentration carries out pcr amplification respectively, and reaction system is:
10×Ex?buffer(Free?Mg 2+) | 2.5.0ul |
25mmol/LMgC1 2 | 2.0ul |
10.0mmol/L?dNTP?Mixture | 2.0ul |
5U/uL?Ex?Taq | 0.3ul |
The upstream primer of non-fluorescent label | 1ul |
The downstream primer of 5 ' end Cy3 mark | 1ul |
CDNA template | 1ul |
dH 2O | Add to 25ul |
Pcr amplification program is carried out according to step 2.1, and control sample λ DNA fluorescent mark reaction system and program are the same carries out (often kind concentration 25ul system parallel do 3 pipes) with reference to step 2.1.
Asymmetric PCR amplified production, after 95 DEG C, mixes with hybridization buffer, gets this mixed solution 20-40ul and is added to chip region, with the chip hybridization 6h time prepared under 48 DEG C of hybridization temperatures.After hybridization, carry out chip washing, dry, scan.With λ DNA for standard control, in test, same gene is selected with a batch chip for preparation, and often kind of concentration is parallel does 3.After application asymmetric PCR technology marks sample, the hybridization efficiency of chip increases.
As shown in Figure 2-5, in the embodiment of the present invention, the reverse primer of Erns, CSF1, PS9, Y11 gene fragment and forward labeled primer ratio are respectively 80:1 (Fig. 2), 80:1 (Fig. 3), 20:1 (Fig. 4), 10:1 (Fig. 5), carry out asymmetric PCR amplification under this condition, hybridization check signal value and signal to noise ratio are the strongest.
Therefore, in test kit of the present invention, reverse primer and the forward labeled primer mol ratio of Erns, CSF1, PS9, Y11 gene fragment are preferably 80:1,80:1,20:1,10:1.
3, genechip detection
The gene chip of embodiment 1 is adopted to detect.
The prehybridization of chip: get the DNA microarray that preparation is preserved, in 95-100 DEG C of distilled water, sex change 1-2min. upper and lower extracting is therebetween in order to avoid form bubble in surface of glass slide, put centrifugal drying after cooling fast in 95% ethanol of precooling immediately, microarray is placed in hybridization cabin, add prehybridization solution 25ul in microarray detection zone, cover glass is put down gently on it, in order to avoid form bubble, make prehybridization solution uniform fold microarray detection zone, in wet box chip being placed in sealing at 44 DEG C prehybridization lh.
The hybridization of chip: absorb prehybridization solution, asymmetric PCR is utilized to mark the nucleic acid samples of amplification after 95 DEG C of sex change 5min, put in ice immediately and cool 3min, mix with the hybridization buffer of a certain amount of precooling again, get this mixed solution 50ul and be added to microarray detection zone, put down gently on it with cover glass, microarray put into hybridization cabin in a wet box lucifuge hybridization, under 40,44,48,52 DEG C of hybridization temperatures, hybridize 1,2,3,4,5, the 6h time.Result shows, and hybridizes 3h hybridization time condition optimum under 48 DEG C of hybridization temperatures.
Examine the dry behaviour of washing of chip altogether: after hybridization, remove the cover glass of chip gently, be placed on by chip on slide frame, analyze washing 5min by warm washing lotion 1, washing lotion 2, washing lotion 3, washing lotion 4, washing lotion 5 immediately. scanning analysis after centrifugal drying.Washing process completes in hint.
The common inspection chip gene chip scanning instrument of scanning analysis centrifugal drying
4000 Scanning Detction.Sweep parameter is Laserpower 95%, PMT550, resolving power 10um, and scanning result preserves image with 16 TIFF and BMP forms.
Data export and process: the yin and yang attribute judging sample according to result.
Embodiment 3 specific test
One, test method
Adopt gene chip prepared by embodiment 1, according to the method for embodiment 2, (reverse primer and the forward labeled primer mol ratio of Erns, CSF1, PS9, Y11 are 80:1,80:1,20:1,10:1, hybridization temperature is 48 DEG C, hybridization time is 3h), detect CSFV, PRRSV, PPV, PCV-2, to verify the specificity of gene chip of the present invention and test kit.
Two, result
As shown in Figure 6, the inventive method effectively can detect PRRSV, CSFV to experimental result respectively or simultaneously, and can not detect other virus, and e.g., PPV, PCV-2, show the high specificity of gene chip and test kit, can not detect other virus.
Experimental result illustrates, the high specificity of test kit of the present invention and gene chip.
Embodiment 4 sensitivity test
One, test method
4 kinds of plasmids prepared by Example 1, nucleic acid-protein instrument measures the OD of each plasmid
260, be converted into the copy number of DNA, do 10 respectively
1, 10
2, 10
3, 10
4, 10
5, 10
6, 10
7, 10
8, 10
9after doubling dilution, adopt gene chip prepared by embodiment 1, detect (reverse primer and the forward labeled primer mol ratio of Erns, CSF1, PS9, Y11 are 80:1,80:1,20:1,10:1, and hybridization temperature is 48 DEG C, and hybridization time is 3h) according to the method for embodiment 2.
Two, result
Result is as shown in table 1 ~ 2:
Table 1 gene chip sensitivity Detection result
Table 2 gene chip sensitivity Detection result
Can find out, when plasmid is diluted to 10
3times time, signal to noise ratio start decline, when being diluted to 10
8times time, observe hybridization spot faint, but still detect that fluorescent signal is greater than 1000, now, the concentration of template is respectively: T/Yll, 2.20 × 10
4copies/ul; T/PS9,3.54 × 10
4copies/ μ L; T/Erns, 1.89 × 10
4copies/ul; T/CSF1,3.68 × 10
4copies/ μ L, illustrates that the minimal detectable concentration of PRRSV, CSFV is 10
4copies/ul.
Experimental result illustrates, adopt test kit of the present invention and genechip detection, the minimal detectable concentration of PRRSV, CSFV is 10
4copies/ul, highly sensitive.
Embodiment 5 adopts genechip detection pathological material of disease of the present invention
One, detection method
1, the taking and pre-treatment of pathological material of disease:
1) the taking of pathological material of disease: gather the swine fever of clinical censorship, porcine reproductive and respiratory syndrome morbidity each 3 of pig (measured containing corresponding virus, this laboratory is preserved), gather position and comprise the tissues such as lung, spleen, kidney, the heart, liver, lymphoglandula.
2) pre-treatment of pathological material of disease: the process of the dirty tissue of device: the pathological material of disease sterilizing PBS gathered is ground, add the dual anti-of final concentration 1000 units/ml, 30 minutes are acted at 37 DEG C, multigelation 3 times also uses ultrasonication, and centrifugal, supernatant liquor added volume fraction 50% chloroform give with 15 minutes, period not failure of oscillation shake, centrifugal, get supernatant 0.45um filtering with microporous membrane ,-20 DEG C of preservations.
2, from 186 parts of clinical samples, 70 parts are randomly drawed, adopt gene chip prepared by embodiment 1, detect according to the method for embodiment 2 that (reverse primer and the forward labeled primer mol ratio of Erns, CSF1, PS9, Y11 are 80:1,80:1,20:1,10:1, hybridization temperature is 48 DEG C, and hybridization time is 3h).
Two, detected result
Table 3 Pestivirus suis Simple infection
Sample | microarrays |
Lung | 2/10 |
Lymphoglandula | 2/10 |
Total recall rate | 20%(4/20) |
Table 4 porcine reproductive and respiratory syndrome virus Simple infection
Sample | microarrays |
Lung | 9/10 |
Lymphoglandula | 7/10 |
Total recall rate | 80%(15/20) |
Table 5 polyinfection
Classification | microarrays | Recall rate |
PRRSV+CSFV | 5/10 | 50% |
Adopt test kit and gene chip, in 20 increment product, total recall rate of swine fever sample is 20%; In 20 increment product, total recall rate of porcine reproductive and respiratory syndrome is 80%; In 10 increment product, the recall rate of swine fever and porcine reproductive and respiratory syndrome polyinfection is 50%.
Experimental result illustrates, test kit of the present invention and gene chip can effectively detect Pestivirus suis and porcine reproductive and respiratory syndrome virus.
To sum up, test kit of the present invention and gene chip can effectively detect Pestivirus suis and porcine reproductive and respiratory syndrome virus, and high specificity, susceptibility are high, consuming time short, detect fast, have a good application prospect.
Claims (10)
1. detect a gene chip for Pestivirus suis and/or porcine reproductive and respiratory syndrome virus, it is characterized in that: it comprises solid phase carrier and is fixed on the probe on solid phase carrier; Described probe to comprise shown in SEQ ID NO:1 or 2 any one or two oligonucleotide fragments, and/or any one or two oligonucleotide fragments shown in SEQ ID NO:3 or 4.
2. gene chip according to claim 1, is characterized in that: it also comprises position probe, and position probe is the gene fragment shown in SEQ ID NO:13.
3. detect a test kit for Pestivirus suis and/or porcine reproductive and respiratory syndrome virus, it is characterized in that: it comprises the reagent of the gene of the gene chip described in claim 1 or 2 and increase Pestivirus suis and/or porcine reproductive and respiratory syndrome virus; Wherein, the reagent of amplification Pestivirus suis gene comprises primer pair shown in SEQ ID NO:5 ~ 6 and/or SEQ ID NO:7 ~ 8; The reagent of amplification porcine reproductive and respiratory syndrome virus gene comprises primer pair shown in SEQ ID NO:9 ~ 10 and/or SEQ ID NO:11 ~ 12.
4. test kit according to claim 3, is characterized in that: it also comprises primer pair shown in SEQ ID NO:14 ~ 15.
5. test kit according to claim 3, it is characterized in that: in described primer pair, shown in SEQ ID NO:5,7,9,11, shown in upstream primer and SEQ ID NO:6,8,10,12, the mol ratio of downstream primer is respectively 80:1,80:1,20:1,10:1.
Any one or two oligonucleotide fragments shown in 6.SEQ ID NO:1 or 2, and/or any one or two oligonucleotide fragments shown in SEQ ID NO:3 or 4 detect Pestivirus suis and/or porcine reproductive and respiratory syndrome virus in preparation gene chip in purposes.
7. purposes according to claim 6, is characterized in that: described gene chip also comprises position probe, and position probe is the gene fragment shown in SEQ ID NO:13.
Any one or two oligonucleotide fragments shown in primer pair and SEQ ID NO:1 or 2 shown in 8.SEQ ID NO:5 ~ 6 and/or SEQ ID NO:7 ~ 8, and/or shown in SEQ ID NO:9 ~ 10 and/or SEQ ID NO:11 ~ 12, primer pair is preparing the purposes in the test kit detecting Pestivirus suis and/or porcine reproductive and respiratory syndrome virus with any one or two oligonucleotide fragments SEQ ID NO:3 or 4 shown; Wherein, primer pair is amplifing reagent; SEQ ID NO:1 ~ 4 are detection probes.
9. purposes according to claim 8, is characterized in that: described test kit also comprises position probe shown in primer pair shown in SEQ ID NO:14 ~ 15 and SEQ ID NO:13.
10. purposes according to claim 8, it is characterized in that: in described primer pair, shown in SEQ ID NO:5,7,9,11, shown in upstream primer and SEQ ID NO:6,8,10,12, the mol ratio of downstream primer is respectively 80:1,80:1,20:1,10:1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410515790.7A CN104293978A (en) | 2014-09-29 | 2014-09-29 | Gene chip and kit for detecting swine fever viruses (SFVs) and/or porcine reproductive and respiratory syndrome viruses (PRRSVs) |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410515790.7A CN104293978A (en) | 2014-09-29 | 2014-09-29 | Gene chip and kit for detecting swine fever viruses (SFVs) and/or porcine reproductive and respiratory syndrome viruses (PRRSVs) |
Publications (1)
Publication Number | Publication Date |
---|---|
CN104293978A true CN104293978A (en) | 2015-01-21 |
Family
ID=52313924
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410515790.7A Pending CN104293978A (en) | 2014-09-29 | 2014-09-29 | Gene chip and kit for detecting swine fever viruses (SFVs) and/or porcine reproductive and respiratory syndrome viruses (PRRSVs) |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104293978A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105039589A (en) * | 2015-06-05 | 2015-11-11 | 四川农业大学 | Visual gene chip and reagent box for hog cholera virus and/or porcine reproductive and respiratory syndrome virus |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103981286A (en) * | 2014-05-19 | 2014-08-13 | 广西壮族自治区兽医研究所 | GeXP rapid detection kit for identifying eight types of porcine viral diseases and primer group thereof |
-
2014
- 2014-09-29 CN CN201410515790.7A patent/CN104293978A/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103981286A (en) * | 2014-05-19 | 2014-08-13 | 广西壮族自治区兽医研究所 | GeXP rapid detection kit for identifying eight types of porcine viral diseases and primer group thereof |
Non-Patent Citations (4)
Title |
---|
XIN-GANG XU ET AL.: "Development of multiplex PCR for simultaneous detection of six swine DNA and RNA viruses", 《JOURNAL OF VIROLOGICAL METHODS》 * |
姜来生: "猪繁殖与呼吸综合征、猪瘟、流行性乙型脑炎联合检测芯片的初步构建", 《中国优秀硕士学位论文全文数据库(农业科技辑)》 * |
曹三杰: "鸡新城疫、鸡传染性支气管炎基因芯片的构建及其检测技术研究", 《中国博士学位论文全文数据库(农业科技辑)》 * |
肖驰: "猪繁殖与呼吸道综合征、猪瘟和猪圆环病毒病诊断DNA微阵列的构建及其检测技术研究", 《中国博士学位论文全文数据库(农业科技辑)》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105039589A (en) * | 2015-06-05 | 2015-11-11 | 四川农业大学 | Visual gene chip and reagent box for hog cholera virus and/or porcine reproductive and respiratory syndrome virus |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104232800A (en) | Gene chip and kit for detecting porcine japanese encephalitis virus, swine fever virus and porcine reproductive and respiratory syndrome virus | |
CN103911443B (en) | The gene chip of a kind of detection 11 kinds of Common infectious dysentery substances and application thereof | |
CN104232802B (en) | Detect the test kit of avian infectious laryngotracheitis virus, newcastle disease virus and avian infectious bronchitis virus | |
CN104293981A (en) | Gene chip and kit for detecting swine epidemic encephalitis B viruses (SEEBVs) and/or swine fever viruses (SFVs) | |
CN104293976A (en) | Gene chip and kit for detecting pig epidemic type B encephalitis virus and/or pig porcine reproductive and respiratory syndrome virus | |
CN104293977B (en) | The genetic chip of detection Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus and kit | |
CN103014144B (en) | Method for detecting gene chips of SS2 (streptococcus suis serotype 2) and application method thereof | |
CN105063760A (en) | Gene chip for identification of seven swine disease pathogens and detection method thereof | |
CN104673936A (en) | RT-qPCR detection method and primers and TaqMan probe for detecting swine transmissible gastroenteritis virus N gene | |
CN103276099A (en) | Primer and kit for fluorescent quatititive PCR (polymerase chain reaction) detection of helicobacter pylori | |
CN105543410A (en) | Method for detecting pig viral diseases on basis of TEM-PCR and gene chip | |
CN105803114A (en) | Porcine bocavirus detection and parting enrichment multiple PCR rapid diagnostic kit | |
CN104862423B (en) | The visualization genetic chip and kit of porcine pseudorabies virus, pig parvoviral and porcine circovirus 2 type | |
CN104357584A (en) | Preparation and application of guiding gene chip for HCV infection individual treatment | |
CN104293979B (en) | Avian infectious bronchitis virus and/or the genetic chip of avian infectious laryngotracheitis virus and kit | |
CN104232803B (en) | Detect gene chip and the test kit of newcastle disease virus, avian infectious bronchitis virus and avian infectious laryngotracheitis virus | |
CN104293978A (en) | Gene chip and kit for detecting swine fever viruses (SFVs) and/or porcine reproductive and respiratory syndrome viruses (PRRSVs) | |
CN103060446B (en) | Use of CD157 gene | |
CN105296675A (en) | Nucleic acid detecting kit for influenza B viruses and preparation method of nucleic acid detecting kit | |
CN104293980A (en) | Kit for detecting porcine epidemic type b encephalitis virus, hog cholera virus and porcine reproductive and respiratory syndrome virus | |
CN105861750A (en) | Gene chip and kit for detecting human papilloma virus types in high-throughput manner | |
CN205616891U (en) | High flux detects genetic chip of people's nipple cancer virus somatotype | |
CN111961763A (en) | Novel gene chip for detecting coronavirus | |
CN105256041A (en) | Specific nucleotide for aeromonas hydrophila O44, O24, O25 and O28 and application thereof | |
CN104390949A (en) | Photonic-crystal microsphere flow-type chip, and preparation method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150121 |