CN105018595B - Strong winter habit Chinese cabbage type winter rape free proline content molecular labeling and QTL site - Google Patents
Strong winter habit Chinese cabbage type winter rape free proline content molecular labeling and QTL site Download PDFInfo
- Publication number
- CN105018595B CN105018595B CN201510211287.7A CN201510211287A CN105018595B CN 105018595 B CN105018595 B CN 105018595B CN 201510211287 A CN201510211287 A CN 201510211287A CN 105018595 B CN105018595 B CN 105018595B
- Authority
- CN
- China
- Prior art keywords
- winter
- strong
- chinese cabbage
- rape
- qfre
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses strong winter habit Chinese cabbage type winter rape free proline content molecular labeling and QTL site, its screening step to include：（1）Using the superpower cold-resistant winter rape of the strong winter habit of parent ' Gansu Province oil 7 ' more for bagging selfing and strong cold-resistant winter rape ' Gansu Province oil 9 ' hybridization structure F2 for segregating population；（2）The leaf DNA of two parents and F2 for segregating population is extracted using CTAB methods；（3）Polymorphism primer screening is carried out using two parent DNA of SSR and InDel primer pairs；（4）Genotype data is obtained by F2 segregating populations and builds genetic linkage map and qtl analysis；（5）The QTL site of 3 strong winter habit Chinese cabbage type winter rape free proline content is obtained, is respectively designated as Qfre.gsau 2A, Qfre.gsau 3A and Qfre.gsau 6A；6 molecular labeling BrID10709, BrID101165, BrID90131, BrID10157, BrID10397,8C0419s 1 chain with strong winter habit Chinese cabbage type winter rape free proline content.
Description
Technical field
The invention belongs to molecular biology and Biotechnology in Genetic Breeding field, and in particular to a kind of strong winter habit Chinese cabbage type winter rape
Free proline content gene QTL site, also relates to the molecular labeling with free proline content gene linkage.
Background technology
Turnip type rape is long in China's cultivation history, and germ plasm resource is enriched, and is one of important oil crops in China.But
Based on spring habit, strong winter habit Chinese cabbage type winter rape germplasm lacks turnip type rape, is particularly suitable for the winter oil of North Dry Han Qu plantations
Vegetable kind lacks.Northern China weather severe cold, winter rape possesses excellent winter resistance ability safe overwintering, therefore cold-tolerance breeding is
The key of northern winter rape development.It is time-consuming and laborious using conventional breeding methods selection and breeding cold-resistant material, and efficiency of selection is relatively low, if
It by molecular mark, can be eliminated in seedling stage, not only save production cost but also greatly improve efficiency of selection.
Under normal operation, free proline content is very low for plant, but runs into arid, low temperature and saline and alkaline when adverse circumstance, trip
Will largely it be accumulated from proline, and it is related with resistance to accumulate index.Therefore the height of free proline content is to weigh
One of index of stress resistance of plant power.Research on free proline content is very much, and studies that to think that it meets quantitative
The genetic characteristics of shape.But control it research of related gene of synthesis less.In recent years dissociate in strong winter habit Chinese cabbage type winter rape
The research of proline content is a lot of, but there is not been reported for the research positioned to its molecular labeling and QTL.This research is determined by QTL
Position, it is intended to the QTL site and molecular labeling of Proline are filtered out, it is white for the clone of Proline gene and strong winter habit
The molecular marker assisted selection of dish type winter rape cold-tolerance breeding.
The content of the invention
The shortcomings that technical problems to be solved by the invention are and are directed in the prior art provides the 3 strong winter habit Chinese cabbage type winter
The QTL site of rape free proline content, the effect value in 3 sites is all higher, and strong winter habit Chinese cabbage type winter rape is swum
Play an important role from proline content regulation and control, can be used as positional cloning and molecular marker assisted selection.
The present invention also provides 6 points chain with the QTL site of strong winter habit Chinese cabbage type winter rape oil free proline content
The genetic distance of son mark, these marks and QTL site is relatively near and is that the SSR and InDel of based on PCR technology are marked, thus
It is reliable and easy to use, facility will be provided to strong winter habit Chinese cabbage type winter rape cold-tolerance breeding.
Adopted the following technical scheme that to solve the technical problem of the present invention：
The molecular labeling of strong winter habit Chinese cabbage type winter rape free proline content QTL site, its screening include following step
Suddenly：
（1）Build segregating population：Using the superpower cold-resistant winter rape of the strong winter habit of parent ' Gansu Province oil No. 7 ' more for bagging selfing and
Strong cold-resistant winter rape ' Gansu Province oil 9 ' configuration cross combination, first familiar generation selfing produce F2 for segregating population.The reality that the present invention uses
Material is tested to be provided by genetics breeding of rape seminar of Gansu Agriculture University.
（2）Rape leaf DNA is extracted：Using CTAB methods extraction parent ' Gansu Province oil 7 ' and ' Gansu Province oil 9 ' and F2 generation separation
The leaf DNA of colony.
（3）Primer Source and synthesis：315 pairs of primers are synthesized by Shanghai biotechnology Co., Ltd, Primer Source in
The rape micro-satellite primers sequence and Brassica Database website http that www.UK crop.net are delivered://
All primers on 10 chromosomes announced on brassicadb.org/, wherein SSR primers 51 are right, InDel primer 2s 64
It is right.
（4）Polymorphism primer screens：PCR amplification is carried out using the two parent DNA of primer pair of synthesis, is filtered out with polymorphic
Property primer, the process be related to PCR amplification, polyacrylamide gel electrophoresis, silver staining, photograph and etc..
（5）Polymorphism primer detects in F2 generations：The polymorphism primer filtered out is detected in F2 generations, obtains gene
Type data, the process with（4）Step is essentially identical.
（6）Genetic linkage map is built and QTL positioning：According to F2 for genotype data, QTL IciMapping V3.3 are utilized
Software carries out genetic linkage map structure and QTL positioning.
3 QTL sites of strong winter habit Chinese cabbage type winter rape free proline content are obtained by screening step, are named respectively
For：Qfre.gsau-2A, Qfre.gsau-3A and Qfre.gsau-6A, with 3 strong winter habit Chinese cabbage type winter rape Proline
6 chain molecular labelings of the QTL site of content, are respectively：BrID10709、BrID101165、BrID90131、
BrID10157, BrID10397,8C0419-1,6 chain with strong winter habit Chinese cabbage type winter rape free proline content QTL site
Molecule labelled series difference it is as follows：
BrID10709-F：TGAGGAAGAAACAAGTAGCTG
BrID10709-R：ATGATGTGCTCGTGTGTTAT
BrID101165-F：TAAGGCCTGTTATTTGGAAG
BrID101165-R：AACTCGCCCTAACAACAATA
BrID90131-F：GGAGGCCTCTTAGGCTTGTT
BrID90131-R ：ATGAAAGGTGGTGAAGCCAA
BrID10157-F：TGTTGAAGTCCTGATCATTG
BrID10157-R：GCTGGTTTGATAAAACTGCT
BrID10397-F：GACTGAAATAAGGCACTAGAAG
BrID10397-R：GACTGAAATAAGGCACTAGAAG
8C0419-1-F：TCGAGCCCCTAGAAAAAGAGAAAG
8C0419-1-R：TGGCGCCGGAGGACAAG
Qfre.gsau-2A sites are located on 2A chromosomes, chain with molecular labeling BrID10709 and BrID101165, can
Explain 54.5464 phenotypic variation, additive effect 31.1092, dominant effect -312.7443.
Qfre.gsau-3A is located on 3A chromosomes, chain with molecular labeling BrID90131 and BrID10157, can be explained
52.2419% phenotypic variation, additive effect are -43.1151, dominant effect -310.0999.
Qfre.gsau-6A is located on 6A chromosomes, chain with molecular labeling BrID10397 and 8C0419-1, can be explained
61.4756% phenotypic variation, additive effect 162.3067, dominant effect 163.7958.
Beneficial effects of the present invention：Present invention positioning first obtains 3 strong winter habit Chinese cabbage type winter rape Proline and contains
QTL site is measured, and provides 6 molecule marks chain with 3 strong winter habit Chinese cabbage type winter rape free proline content QTL site
Note, explains 54.5464%, 52.2419% and 61.4756% phenotypic variation respectively.In conventional cold-tolerance breeding, test material needs
Judge the power of its winter resistance by overwintering, it is time-consuming and laborious.By detecting free proline content QTL site, seedling stage just
Screening efficiency can be substantially increased with screening material, save production cost, accelerate breeding process.Free proline content at the same time
The acquisition of QTL site, can further clone the gene of control free proline content, be strong winter habit Chinese cabbage type winter rape cold-resistant machine
The exploration of reason provides technical support.
Brief description of the drawings
Fig. 1 is the superpower cold-resistant winter rape of the strong winter habit of the present invention ' Gansu Province oil 7 ' and strong cold-resistant winter rape ' Gansu Province oil 9 ' hybridization F2
For colony's free proline content distribution map；
Fig. 2 utilizes two parental line selection polymorphism primers for the present invention；
Fig. 3 is testing results of the polymorphism primer BrID101147 of the present invention in F2 generations；
Fig. 4 is Qfre.gsau-2A sites of the present invention in the position of 2A chromosomes and LOD curve synoptic diagrams；
Fig. 5 is Qfre.gsau-3A sites of the present invention in the position of 7A chromosomes and LOD curve synoptic diagrams；
Embodiment
The principles and features of the present invention are described below, and the given examples are served only to explain the present invention, is not intended to limit
Determine the scope of the present invention.
Embodiment 1：The structure of strong winter habit Chinese cabbage type winter rape segregating population and the measure of free proline content.
Specifically structure is as follows for the segregating population used in the present embodiment：
（1）In August, 2010 is using the superpower cold-resistant winter rape of the strong winter habit of parent ' Gansu Province oil 7 ' more for bagging selfing and resists by force
Severe winter rape ' Gansu Province oil 9 ' configuration cross combination, harvests F1 generation seed in May, 2011.
（2）In August, 2011 sows F1 seeds, and in April, 2012 bagging selfing, obtains F2 for seed.
In August, 2012 sows F2 for seed.Treat that seedling stage randomly selects 103 plants of listing marks, the fresh children of collection at the beginning of 11 months
Leaf, takes back laboratory with ice chest and is stored in -70 DEG C of ultra low temperature freezers.Free proline content is measured using Toluene Extraction.
The result shows that：F2 is in normal distribution for free proline content, and range of variation is very wide, it was demonstrated that soluble protein character belongs to several
Measure character（Fig. 1）.
Embodiment 2：The extraction of parent and F2 for segregating population blade STb gene.
Blade STb gene is extracted using CTAB methods, is comprised the following steps that：
（1）Material of the healthy spire of picking as extraction rape genomic DNA, is cleaned with distilled water, is blotted with paper.
（2）Take fresh blade 0.5g to be placed in mortar, add liquid nitrogen, load immediately after being ground to whitish powder shape rapidly
2ml centrifuge tubes.
（3）Add warmed-up 2 × CTAB Extraction buffers 700ul to be impregnated with powder and reverse centrifuge tube, make powder abundant
Scatter, it is soft therebetween to mix 2-3 times in 65 DEG C of water-bath 60min.
（4）Centrifuge tube is taken out, is cooled to room temperature, adds chloroform/isoamyl alcohol of 700ul（24/1）, light and slow reverse mixing is quiet
Put 10 min.
（5）13000rpm centrifuges 10min.
（6）Take supernatant 600ul to be transferred in new centrifuge tube, add isometric chloroform/isoamyl alcohol (24/1), it is light and slow reverse
Mix, room temperature places 10min.
（7）13000rpm centrifuges 10min, takes supernatant 400ul to be transferred in new centrifuge tube, adds the isopropyl of isometric precooling
Alcohol, is stored in -20 DEG C, stands 20 min.
（8）13000rpm centrifuges 10min, and centrifuge tube is inverted on blotting paper, drains supernatant, with the second of 600ul 70%
Alcohol washing precipitation 2 times, it is micro- dry at room temperature.Add 300ul deionized water dissolvings precipitation.
（9）Add 1ul RNase（10mg/ml）37 DEG C of 60 min of water-bath are placed in, each centrifuge tube adds 300ul deionizations
Water, adds isometric chloroform/isoamyl alcohol extraction 2 times.
（10）Draw supernatant 400ul and be transferred to new centrifuge tube, add the 3mol/LNaAC solution of supernatant volume 1/10,2.5 times
The precooling absolute ethyl alcohol precipitation DNA of volume, is placed in -20 DEG C, 20 min or so, 12000rpm centrifugation 10min, abandon supernatant.
（11）Precipitation is washed with the ethanol of 600ul 70% 2 times, aeration-drying or natural drying.
（12）30ul TE buffer solutions DNA is added, 4 DEG C save backup.（It is -20 °C long-term to preserve）
Embodiment 3：SSR and InDel Primer Sources, synthesis and polymorphism screening.
（1）From the www.UK crop.net rape micro-satellite primers sequences delivered and Brassica Database websites
http:315 pairs are uniformly chosen in all primers on 10 chromosomes announced on //brassicadb.org/.Wherein SSR draws
Thing 51 is right, and InDel primer 2s 64 are right.Primer is synthesized by Shanghai biotechnology Co., Ltd.
（2）6 plants of DNA mixed in equal amounts are respectively randomly selected from parent, the template as screening primer.
（3）PCR reaction systems
PCR reaction systems are 10ul：
Mix Taq enzymes 6ul
Upper primer 0.5ul
Lower primer 0.5ul
ddH2O 2ul
Template： 1ul
（4）PCR amplification program：94 DEG C of pre-degeneration 4min；94 DEG C of denaturation 50s, 55-60 DEG C of renaturation 50s（What is each circulated moves back
Fiery temperature reduces or 0.5 DEG C of rise）, 72 DEG C of extension 50s, 35 circulations；72 DEG C of extension 10min；Take out 4 DEG C of guarantors of PCR product
Deposit.
（5）Polyacrylamide gel electrophoresis
Pcr amplification product electrophoresis, concrete operations on 8% polyacrylamide gel are as follows：
A ddH2O abundant cleaning glass plate, sample comb and rubber sleeve, are placed on stent and dry.
After b dries, two pieces of glass plate alignment are anchored to together, are put into rubber sleeve, and sealed with 1% agarose gel, it is quiet
Put 30min.
The glass plate that c seals two pairs is carefully attached on electrophoresis tank.
D configures the acrylamide gel solution of 50ml：By 30% acrylamide 13.3ml, distilled water 31ml, 10 × TBE
5ml, 10% ammonium persulfate 10.7ml and TEMED 3.5ul are rapidly added in 100ml small beakers, are stirred evenly with glass bar.
Between the above-mentioned acrylamide gel solution prepared is slowly poured into two pieces of glass plates by e along glass notch board top, two pairs
After glass plate glue fills, comb is inserted into, stands 1h or so.
F adds a little 1 × tbe buffer liquid with liquid-transfering gun around comb, gently extracts comb, and 1 is filled in electrophoresis tank
× TBE electrode buffers.
The each loading wells of g adds PCR product 2-3ul.Power supply is connected, in voltage 200V, electric current 100mA electrophoresis 1h or so.
H closes power supply, recycles electrode buffer, removes glass plate, pries open glass plate and takes out gel, and number is rinsed with ddH2O
Secondary preparation silver staining.
（6）Silver staining process
A is fixed：300ml fixers are poured into the glue box equipped with gel, the jog 8min on decolorization swinging table, recycling is fixed
Liquid.
B is dyed：300ml dyeing liquors are added into glue box, the jog 10-15min on decolorization swinging table, recycles dyeing liquor, uses
DdH2O is rinsed twice.
C develops：300ml nitrite ions are added into glue box, jog is clear to band on decolorization swinging table, pours out nitrite ion,
Rinsed twice with ddH2O.
D takes a picture：Gel is placed on film illuminator and is taken a picture.
Required preparation of reagents during silver staining：
Fixer：100ml absolute ethyl alcohols, 5ml glacial acetic acid, 1L is settled to ddH2O.
Dyeing liquor：2g AgNO3,100ml absolute ethyl alcohols, 5ml glacial acetic acid, 1L is settled to ddH2O.
Developer solution：1.5ml formaldehyde is added in 300ml 3%NaOH solution（Matching while using）.
7. polymorphism primer screens
According to electrophoresis result, filter out 39 pairs and expand repetition stabilization between " Gansu Province oil 7 " and " Gansu Province oil 9 ", band is clear
It is clear, there is the primer of polymorphism.
Embodiment 4：Distribution, genetic linkage map structure and qtl analysis of the polymorphism primer in F2 generations.
（1）39 pairs of polymorphism primers that embodiment 3 is obtained carry out PCR expansions respectively to the DNA of 103 single plants of F2 colonies
Increase, silver staining photograph and banding pattern interpretation after polyacrylate hydrogel electrophoresis, banding pattern identical with parent's " Gansu Province oil 7 " is denoted as " A ", with parent
" Gansu Province oil 9 " identical banding pattern is denoted as " B ", and heterozygote is denoted as " H ", and the banding pattern of missing is denoted as "-".
（2）Banding pattern is counted as a result, calculating the genetic distance between primer using QTL IciMapping V3.3 softwares, and
Build genetic linkage map and qtl analysis.The 39 pairs of primers filtered out are respectively distributed on 10 chromosomes of turnip type rape.To trip
From proline content carry out qtl analysis, detect altogether 3 control free proline content QTL, respectively positioned at chromosome 2A,
On 3A and 6A, wherein：
QTL on 2A chromosomes（Fig. 4）Be named as Qfre.gsau-2A, between positioning area positioned at BrID10709 ~
Between BrID101165.The phenotypic variation that Qfre.gsau-2A can be explained is 54.5464%.
The QTL on 3A chromosomes（Fig. 5）Be named as Qfre.gsau-3A, between positioning area positioned at BrID90131 ~
Between BrID10157.The phenotypic variation that Qfre.gsau-3A can be explained is 52.2419.
QTL on 6A chromosomes is named as Qfre.gsau-6A, is located at BrID10397 ~ 8C0419-1 between positioning area
Between.The phenotypic variation that Qfre.gsau-6A can be explained is 61.4756.
The molecular labeling of table 1 and strong winter habit Chinese cabbage type winter rape free proline content QTL positioning
Table the last 2 winter habit Chinese cabbage type winter rape free proline content QTL site essential information
The foregoing is merely presently preferred embodiments of the present invention, is not intended to limit the invention, it is all the present invention spirit and
Any modification, equivalent replacement, improvement and so within principle, should all be included in the protection scope of the present invention.
Claims (1)
- The last 1. winter habit Chinese cabbage type winter rape free proline content molecular labeling and QTL positioning, it is characterised in that：Walked by screening Suddenly 3 QTL sites of strong winter habit Chinese cabbage type winter rape free proline content are obtained, are respectively designated as：Qfre.gsau-2A、 Qfre.gsau-3A and Qfre.gsau-6A, it is chain with the QTL site of 3 strong winter habit Chinese cabbage type winter rape free proline content 6 molecular labelings, be respectively：BrID10709、BrID101165、BrID90131、BrID10157、BrID10397、 8C0419-1；Wherein Qfre.gsau-2A sites are located on 2A chromosomes, between positioning area between BrID10709-BrID101165, Interpretable 54.5464 phenotypic variation, additive effect 31.1092, dominant effect -312.7443；Qfre.gsau-3A is located on 3A chromosomes, between positioning area between BrID90131-BrID10157, can be explained 52.2419% phenotypic variation, additive effect are -43.1151, dominant effect -310.0999；Qfre.gsau-6A is located on 6A chromosomes, between positioning area between BrID10397-8C0419-1, can be explained 61.4756% phenotypic variation, additive effect 162.3067, dominant effect 163.7958；6 molecular labeling primer sequences chain with strong winter habit Chinese cabbage type winter rape free proline content QTL site are respectively such as Under：BrID10709-F：TGAGGAAGAAACAAGTAGCTGBrID10709-R：ATGATGTGCTCGTGTGTTATBrID101165-F：TAAGGCCTGTTATTTGGAAGBrID101165-R：AACTCGCCCTAACAACAATABrID90131-F：GGAGGCCTCTTAGGCTTGTTBrID90131-R ：ATGAAAGGTGGTGAAGCCAABrID10157-F：TGTTGAAGTCCTGATCATTGBrID10157-R：GCTGGTTTGATAAAACTGCTBrID10397-F：GACTGAAATAAGGCACTAGAAGBrID10397-R：GACTGAAATAAGGCACTAGAAG8C0419-1-F：TCGAGCCCCTAGAAAAAGAGAAAG8C0419-1-R：TGGCGCCGGAGGACAAG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510211287.7A CN105018595B (en) | 2015-04-29 | 2015-04-29 | Strong winter habit Chinese cabbage type winter rape free proline content molecular labeling and QTL site |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510211287.7A CN105018595B (en) | 2015-04-29 | 2015-04-29 | Strong winter habit Chinese cabbage type winter rape free proline content molecular labeling and QTL site |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105018595A CN105018595A (en) | 2015-11-04 |
| CN105018595B true CN105018595B (en) | 2018-05-08 |
Family
ID=54408893
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510211287.7A Active CN105018595B (en) | 2015-04-29 | 2015-04-29 | Strong winter habit Chinese cabbage type winter rape free proline content molecular labeling and QTL site |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105018595B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105695572B (en) * | 2016-02-02 | 2021-02-23 | 中国水产科学研究院南海水产研究所 | Method for developing molecular markers in large scale and efficiently based on Indel and SSR site technology |
-
2015
- 2015-04-29 CN CN201510211287.7A patent/CN105018595B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| 不同温度低温处理对油菜抗寒性的影响;范志强;《安徽农业学通报》;20111231;第17卷(第22期);18-19 * |
| 北方白菜型冬油菜F_2主要生理生化特征的变异与抗旱性相关分析;孔德晶;《草业学报》;20140820(第4期);全文 * |
| 白菜型冬油菜抗寒生理性状的QTL定位研究;孔德晶;《甘肃农业大学 硕士学位论文》;20140601;第9、19-20、25-26及34页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105018595A (en) | 2015-11-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105969852B (en) | A kind of molecular labeling and application with rape crotch angle character QTL site close linkage | |
| CN104805080B (en) | A kind of molecular labeling of siliqua of oilseed rape number main effect QTL and application | |
| CN109929945B (en) | Molecular marker BrSF2604 primer of main effect QTL sites in flowering phase and mature phase of brassica napus and application thereof | |
| CN108504773B (en) | Molecular marker of major QTL (quantitative trait loci) site for grain weight and silique length of brassica napus and application of molecular marker | |
| CN103993011A (en) | Molecular marker of sesame dominant genic male sterility gene and preparation method and application thereof | |
| CN105154442A (en) | Indel mark of powdery mildew resistance allele er1-7 of peas and application thereof | |
| CN104498483A (en) | Aegilops searsii 2Ss chromosome molecular markers based on wheat and rice EST sequences and applications | |
| CN105506151B (en) | A kind of and the chain molecular labeling site of the operatic circle skin color trait and its application | |
| CN104805179B (en) | A kind of molecular labeling and preparation method and application with cabbage type rape grain re-association | |
| CN103333887B (en) | A kind of functional label utilizing DNA melting temperature (Tm) analyzing rice Pita gene | |
| CN105296472B (en) | The molecular labeling and its screening technique in Sand Pear ' faint scent ' pericarp brown character gene site entirely | |
| CN105018595B (en) | Strong winter habit Chinese cabbage type winter rape free proline content molecular labeling and QTL site | |
| CN109182592A (en) | Chain SNP marker and application with rape multi-branched character main effect QTL site | |
| CN110453008A (en) | One with the molecular labeling ZMM6206 and its application of gingili leaf length of a film and wide major gene loci close linkage | |
| CN105039508B (en) | Strong winter habit Chinese cabbage type winter rape SOD enzyme molecules label and QTL site | |
| CN103114134B (en) | Method for detecting X-type HMW-GS (High Molecular Weight Glutenin Subunit) gene in distant hybridization wheat crossbreed | |
| CN110373492A (en) | Without the hidden sub- grass LTR-RT molecular labeling primer of awns and the application in Germplasm Identification | |
| CN105018596B (en) | Strong winter habit Chinese cabbage type winter rape POD enzyme molecules label and QTL site | |
| CN104988138B (en) | Strong winter habit Chinese cabbage type winter rape soluble protein content molecular labeling and QTL positioning | |
| CN104988212B (en) | Strong winter habit Chinese cabbage type winter rape CAT enzyme molecule label and QTL positioning | |
| CN104877994B (en) | Strong winter habit Chinese cabbage type winter rape malonaldehyde MDA molecular labeling and QTL positioning | |
| CN103740712B (en) | Cucumber EST-SSR (Expressed Sequence Tag-Simple Sequence Repeat) molecular markers | |
| CN111100946B (en) | Molecular marker primer of rape grain weight character major gene locus and application | |
| CN103740856B (en) | Molecular method for predicting verticillium wilt resisting capability of different cotton materials | |
| CN109913579A (en) | A kind of barley phosphorus element efficiently utilizes molecular labeling and the application of QTL site |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |