CN104988138B - Strong winter habit Chinese cabbage type winter rape soluble protein content molecular labeling and QTL positioning - Google Patents
Strong winter habit Chinese cabbage type winter rape soluble protein content molecular labeling and QTL positioning Download PDFInfo
- Publication number
- CN104988138B CN104988138B CN201510211289.6A CN201510211289A CN104988138B CN 104988138 B CN104988138 B CN 104988138B CN 201510211289 A CN201510211289 A CN 201510211289A CN 104988138 B CN104988138 B CN 104988138B
- Authority
- CN
- China
- Prior art keywords
- winter
- rape
- strong
- soluble protein
- protein content
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses strong winter habit Chinese cabbage type winter rape soluble protein content molecular labeling and QTL site, it, which screens step, includes：（1）F2 is built for segregating population using the superpower cold-resistant winter rape of the strong winter habit of parent ' Gansu Province oil 7 ' more for bagging selfing and strong cold-resistant winter rape ' Gansu Province oil 9 ' hybridization；（2）The leaf DNA of two parents and F2 for segregating population is extracted using CTAB methods；（3）Polymorphism primer screening is carried out using the parent DNA of SSR and InDel primer pairs two；（4）Genotype data is obtained by F2 segregating populations and builds genetic linkage map and qtl analysis；（5）The QTL site of 2 strong winter habit Chinese cabbage type winter rape soluble protein content is obtained, Qsol.gsau 8A are named as；2 molecular labeling BrID10839 and Ra2 E12s chain with the QTL site of strong winter habit Chinese cabbage type winter rape soluble protein content.
Description
Technical field
The invention belongs to molecular biology and Biotechnology in Genetic Breeding field, and in particular to a kind of strong winter habit Chinese cabbage type winter rape
Soluble protein content QTL site, is also related to chain with strong winter habit Chinese cabbage type winter rape soluble protein content QTL site
Molecular labeling.
Background technology
Turnip type rape is long in China's cultivation history, with the characteristic such as cold-resistant, precocity, barren-resistant, is that China is important
One of oil crops.But turnip type rape is based on spring habit, strong winter habit Chinese cabbage type winter rape germplasm lacks, the especially suitable north
The strong winter habit winter rape variety of Han Han areas plantation lacks.Northern China weather severe cold, winter rape possesses excellent winter resistance ability
Safe overwintering, therefore cold-tolerance breeding is the key of northern winter rape development.Using conventional breeding methods seed selection cold-resistant fee of material
When it is laborious, and efficiency of selection is relatively low, if by molecular mark, can be eliminated in seedling stage, and not only saving is given birth to
Produce cost and greatly improve efficiency of selection.
Soluble protein is important osmotic adjustment and nutriment, and their increase and accumulation can improve cell
Water holding capacity, plays a protective role to the living matter and biomembrane of cell, therefore is commonly used as screening one of index of resistance.
Research on soluble protein content and changing rule is a lot, and research thinks that it meets genetics of quantitative characters feature.But
The research of related gene to controlling its synthesis is less.In recent years soluble protein content and changing rule in Chinese cabbage type winter rape
Research is a lot of, but there is not been reported for the research positioned to its molecular labeling and QTL.This research is positioned by QTL, it is intended to filtered out
The QTL site and molecular labeling of soluble protein content, clone and winter rape cold-tolerance breeding for soluble protein gene
Molecular marker assisted selection.
The content of the invention
The technical problems to be solved by the invention are there is provided 1 strong winter habit Chinese cabbage type for shortcoming of the prior art
The QTL site of winter rape soluble protein content, the effect value in the site is all higher, to Chinese cabbage type winter rape soluble protein
Content regulation and control play an important role, and can be used as positional cloning and molecular marker assisted selection.
The chain molecule of the QTL site of the invention that the oily soluble protein content of 2 strong winter habit Chinese cabbage type winter rape is also provided
Mark.These marks and the genetic distance of QTL site are relatively near and are that the SSR and InDel of PCR-based technology are marked, thus can
Lean on and easy to use, facility will be provided to strong winter habit Chinese cabbage type winter rape cold-tolerance breeding.
Technical problem for the solution present invention is adopted the following technical scheme that：
Strong winter habit Chinese cabbage type winter rape soluble protein content molecular labeling and QTL site, its screening include following step
Suddenly：
（1）Build segregating population：Using the superpower cold-resistant winter rape of the strong winter habit of parent ' Gansu Province oil No. 7 ' more for bagging selfing and
Strong cold-resistant winter rape ' Gansu Province oil 9 ' configuration cross combination, first familiar generation selfing produces F2 for segregating population.The reality that the present invention is used
Material is tested to be provided by genetics breeding of rape seminar of Gansu Agriculture University.
（2）Rape leaf DNA is extracted：Parent's ' Gansu Province oil 7 ' and ' Gansu Province oil 9 ' and F2 generation separation are extracted using CTAB methods
The leaf DNA of colony.
（3）Primer Source and synthesis：315 pairs of primers are synthesized by Shanghai biotechnology Co., Ltd, Primer Source in
Rape micro-satellite primers sequence and Brassica Database website http that www.UK crop.net are delivered://
All primers on 10 chromosomes announced on brassicadb.org/, wherein 51 pairs of SSR primers, InDel primer 2s 64
It is right.
（4）Polymorphism primer is screened：Enter performing PCR amplification using the parent DNA of primer pair two of synthesis, filter out with polymorphic
The primer of property, the process is related to the steps such as PCR amplifications, polyacrylamide gel electrophoresis, silver staining, photograph.
（5）Polymorphism primer is detected in F2 generations：The polymorphism primer filtered out is detected in F2 generations, gene is obtained
Type data, the process with（4）Step is essentially identical.
（6）Genetic linkage map is built and QTL positioning：According to F2 for genotype data, QTL IciMapping V3.3 are utilized
Software carries out genetic linkage map structure and QTL positioning.
1 QTL site of strong winter habit Chinese cabbage type winter rape soluble protein content is obtained by screening step, is named
For：Qsol.gsau-8A, 2 chain molecule marks with the QTL site of 1 strong winter habit Chinese cabbage type winter rape soluble protein content
Note, be respectively：BrID10839 and Ra2-E12, the sequence difference of 2 molecular labelings is as follows.
BrID10839-F：AGGAACAATACCCATTTGTG
BrID10839-R：GGTGTTTGTGTGTTCGGTA
Ra2-E12-F：TGTCAGTGTGTCCACTTCGC
Ra2-E12-R：AAGAGAAACCCAATAAAGTAGAACC.
Qsol.gsau-8A is located on 8A chromosomes, chain with molecular labeling BrID10839 and Ra2-E12, can be explained
12.4599% phenotypic variation, additive effect is 10.6371, dominant effect -11.9857.
Beneficial effects of the present invention：Present invention positioning first obtains 1 strong winter habit Chinese cabbage type winter rape soluble protein and contained
QTL site is measured, and provides 2 molecular labelings chain with strong winter habit Chinese cabbage type winter rape soluble protein content QTL site, point
Not Xie Shi 19.1302%, 21.9624% and 12.4599% phenotypic variation.In conventional cold-tolerance breeding, test material need to be by more
Winter judges the power of its winter resistance, wastes time and energy.By detecting soluble protein content QTL site, it can just be sieved in seedling stage
Material selection, substantially increases screening efficiency, saves production cost, accelerates breeding process.While soluble protein content QTL site
Acquisition, can further carry out the clone of soluble protein gene, be that the exploration of strong winter habit Chinese cabbage type winter rape cold-resistant mechanism is carried
For technical support.
Brief description of the drawings
Fig. 1 is the superpower cold-resistant winter rape of the strong winter habit of the present invention ' Gansu Province oil 7 ' and strong cold-resistant winter rape ' Gansu Province oil 9 ' hybridization F2
For colony's soluble protein content distribution map；
Fig. 2 utilizes two parental line selection polymorphism primers for the present invention；
Fig. 3 is testing results of the polymorphism primer 8C0419-1 of the present invention in F2 generations；
Fig. 4 is that Qsol.gsau-2A-1 and Qsol.gsau-2A-2 sites of the present invention are bent in the position of 2A chromosomes and LOD
Line schematic diagram；
Fig. 5 is Qsol.gsau-8A sites of the present invention in the position of 8A chromosomes and LOD curve synoptic diagrams.
Embodiment
The principles and features of the present invention are described below, and the given examples are served only to explain the present invention, is not intended to limit
Determine the scope of the present invention.
Embodiment 1：The structure and soluble protein content of strong winter habit Chinese cabbage type winter rape segregating population are determined.
The segregating population used in the present embodiment specifically builds as follows：
（1）In August, 2010 is using many superpower cold-resistant winter rapes of the strong winter habit of parent ' Gansu Province oil 7 ' for bagging selfing and resists by force
Severe winter rape ' Gansu Province oil 9 ' configuration cross combination, harvests F1 generation seed in May, 2011.
（2）In August, 2011 sows F1 seeds, and in April, 2012 bagging selfing obtains F2 for seed.
In August, 2012 sows F2 for seed.Treat that seedling stage randomly selects 103 plants of listing marks, the fresh children of collection at the beginning of 11 months
Leaf, laboratory is taken back with ice chest and -70 DEG C of ultra low temperature freezers are stored in.Soluble egg is determined using Coomassie brilliant G-250 method
Bai Hanliang.As a result show：F2 is in normal distribution for soluble protein content, it was demonstrated that soluble protein character belongs to quantitative character
（Fig. 1）.
Embodiment 2：The extraction of parent and F2 for segregating population blade STb gene.
Blade STb gene is extracted using CTAB methods, comprised the following steps that：
（1）The healthy spire of harvesting is cleaned with distilled water, blotted with paper as the material for extracting rape genomic DNA.
（2）Take fresh blade 0.5g or so to be placed in mortar, add liquid nitrogen, be ground to rapidly after whitish powder shape immediately
Load 2ml centrifuge tubes.
（3）Add warmed-up 2 × CTAB Extraction buffers 700ul to be impregnated with powder and reverse centrifuge tube, make powder abundant
Scatter, it is soft therebetween to mix 2-3 times in 65 DEG C of water-bath 60min.
（4）Centrifuge tube is taken out, room temperature is cooled to, 700ul chloroform/isoamyl alcohol is added（24/1）, it is light and slow it is reverse mix, it is quiet
Put 10 min.
（5）13000rpm centrifuges 10min.
（6）Take supernatant 600ul to be transferred in new centrifuge tube, add isometric chloroform/isoamyl alcohol (24/1), it is light and slow reverse
Mix, room temperature places 10min.
（7）13000rpm centrifuges 10min, takes supernatant 400ul to be transferred in new centrifuge tube, plus the isopropyl of precooling in equal volume
Alcohol, is stored in -20 DEG C, stands 20 min.
（8）13000rpm centrifuges 10min, and centrifuge tube is inverted on blotting paper, supernatant is drained, with 600ul 70% second
Alcohol washing precipitation 2 times, it is micro- dry at room temperature.Add 300ul deionized water dissolvings precipitation.
（9）Add 1ul RNase（10mg/ml）37 DEG C of min of water-bath 60 are placed in, each centrifuge tube adds 300ul deionizations
Water, adds isometric chloroform/isoamyl alcohol extraction 2 times.
（10）Draw supernatant 400ul and be transferred to new centrifuge tube, add the 3mol/LNaAC solution of supernatant volume 1/10,2.5 times
The precooling absolute ethyl alcohol precipitation DNA of volume, is placed in -20 DEG C, 20 min or so, 12000rpm centrifugation 10min abandon supernatant.
（11）Precipitation is washed with 600ul 70% ethanol 2 times, aeration-drying or natural drying.
（12）30ul TE buffer solutions DNA is added, 4 DEG C save backup.（It is -20 °C long-term to preserve）
Embodiment 3：SSR and InDel Primer Sources, synthesis and polymorphism screening.
（1）From the www.UK crop.net rape micro-satellite primers sequences delivered and Brassica Database websites
http:It is uniform in all primers on 10 chromosomes announced on //brassicadb.org/ to choose 315 pairs.Wherein SSR draws
51 pairs of thing, 64 pairs of InDel primer 2s.Primer is synthesized by Shanghai biotechnology Co., Ltd.
（2）6 plants of DNA mixed in equal amounts are respectively randomly selected from parent, the template of screening primer is used as.
（3）PCR reaction systems
PCR reaction systems are 10ul：
Mix Taq enzymes 6ul
Upper primer 0.5ul
Lower primer 0.5ul
ddH2O 2ul
Template： 1ul
（4）PCR amplification programs：94 DEG C of pre-degeneration 4min；94 DEG C of denaturation 50s, 55-60 DEG C of renaturation 50s（What is each circulated moves back
Fiery 0.5 DEG C of temperature reduction or rise）, 72 DEG C of extension 50s, 35 circulations；72 DEG C of extension 10min；Take out 4 DEG C of guarantors of PCR primer
Deposit.
（5）Polyacrylamide gel electrophoresis
Pcr amplification product electrophoresis on 8% polyacrylamide gel, concrete operations are as follows：
The a abundant cleaning glass plates of ddH2O, sample comb and rubber sleeve, are placed on support and dry.
After b dries, two pieces of glass plate alignment are anchored to together, put into rubber sleeve, and sealed with 1% agarose gel, it is quiet
Put 30min.
The glass plate that c seals two pairs is carefully attached on electrophoresis tank.
D configures 50ml acrylamide gel solution：By 30% acrylamide 13.3ml, distilled water 31ml, 10 × TBE
5ml, 10% ammonium persulfate 10.7ml and TEMED 3.5ul is rapidly added in 100ml small beakers, is stirred with glass bar.
E slowly pours into the above-mentioned acrylamide gel solution prepared between two pieces of glass plates along glass notch board top, two pairs
After glass plate glue is filled, comb is inserted, 1h or so is stood.
F adds a little 1 × tbe buffer liquid with liquid-transfering gun around comb, gently extracts comb, and 1 is filled in electrophoresis tank
× TBE electrode buffers.
The each loading wells of g adds PCR primer 2-3ul.Power supply is connected, in voltage 200V, electric current 100mA electrophoresis 1h or so.
H closes power supply, reclaims electrode buffer, removes glass plate, pries open glass plate and takes out gel, number is rinsed with ddH2O
Secondary preparation silver staining.
（7）Silver staining process
A is fixed：300ml fixers are poured into the glue box equipped with gel, the jog 8min on decolorization swinging table is reclaimed and fixed
Liquid.
B is dyed：300ml dyeing liquors are added into glue box, the jog 10-15min on decolorization swinging table reclaims dyeing liquor, used
DdH2O is rinsed twice.
C develops：300ml nitrite ions are added into glue box, jog is clear to band on decolorization swinging table, pours out nitrite ion,
Rinsed twice with ddH2O.
D takes a picture：Gel is placed on film illuminator and taken a picture.
Preparation of reagents needed for during silver staining：
Fixer：100ml absolute ethyl alcohols, 5ml glacial acetic acid, 1L is settled to ddH2O.
Dyeing liquor：2g AgNO3,100ml absolute ethyl alcohols, 5ml glacial acetic acid is settled to 1L with ddH2O.
Developer solution：1.5ml formaldehyde is added in 300ml 3%NaOH solution（Matching while using）.
（7）Polymorphism primer is screened
According to electrophoresis result, 39 pairs of amplification repetition stabilizations between " Gansu Province oil 7 " and " Gansu Province oil 9 " are filtered out, band is clear
It is clear, the primer with polymorphism.
Embodiment 4：Distribution, genetic linkage map structure and qtl analysis of the polymorphism primer in F2 generations.
（1）39 pairs of polymorphism primers that embodiment 3 is obtained enter performing PCR expansion to the DNA of 103 individual plants of F2 colonies respectively
Increase, silver staining photograph and banding pattern interpretation after polyacrylate hydrogel electrophoresis, " A " is designated as with parent " Gansu Province oil 7 " identical banding pattern, with parent
" Gansu Province oil 9 " identical banding pattern is designated as " B ", and heterozygote is designated as " H ", and the banding pattern of missing is designated as "-".
（2）Banding pattern result is counted, the genetic distance between primer is calculated using QTL IciMapping V3.3 softwares, and
Build genetic linkage map and qtl analysis.The 39 pairs of primers filtered out are respectively distributed on 10 chromosomes of turnip type rape.Pair can
Dissolubility protein content carries out qtl analysis, the QTL of 3 control soluble protein contents is detected altogether, respectively positioned at chromosome 2A
On 8A, wherein：
There are 2 to be located on 2A chromosomes（Fig. 4）, Qsol.gsau-2A-1 and Qsol.gsau-2A-2 are respectively designated as, it is fixed
Position is interval to be located between rID90127 ~ BrID10421 and BrID10709 ~ BrID101165 respectively.Qsol.gsau-2A-1 can be solved
The phenotypic variation released is that the explainable phenotypic variations of 19.1302%, Qsol.gsau-2A-2 are 21.9624%.
On 8A chromosomes, the QTL of 1 control soluble protein content is detected（Fig. 5）, it is named as Qsol.gsau-
It is located between 8A, positioning area between BrID10839 ~ Ra2-E12.The explainable phenotypic variations of Qsol.gsau-8A are
12.4599%。
Table 1 and the chain molecular labeling of the chain QTL site of strong winter habit Chinese cabbage type winter rape soluble protein content
Table the last 2 winter habit Chinese cabbage type winter rape soluble protein content QTL site essential information
The foregoing is only presently preferred embodiments of the present invention, be not intended to limit the invention, it is all the present invention spirit and
Any modification, equivalent substitution and improvements made within principle etc., should be included in the scope of the protection.
Claims (2)
1. a kind of strong winter habit Chinese cabbage type winter rape soluble protein content molecular labeling and QTL site, it is characterised in that：Pass through sieve
Select step to obtain 1 QTL site of strong winter habit Chinese cabbage type winter rape soluble protein content, be named as：Qsol.gsau-8A,
Qsol.gsau-8A is located on 8A chromosomes, is located between positioning area between BrID10839-Ra2-E12, can be explained
12.4599% phenotypic variation, additive effect is 10.6371, dominant effect -11.9857；Obtain and the 1 strong winter habit Chinese cabbage type winter
2 chain molecular labelings of the QTL site of rape soluble protein content, be respectively：BrID10839 and Ra2-E12,2 points
The sequence of son mark is as follows：
BrID10839-F：AGGAACAATACCCATTTGTG
BrID10839-R：GGTGTTTGTGTGTTCGGTA
Ra2-E12-F：TGTCAGTGTGTCCACTTCGC
Ra2-E12-R：AAGAGAAACCCAATAAAGTAGAACC.
2. strong winter habit Chinese cabbage type winter rape soluble protein content molecular labeling according to claim 1 and QTL site, its
It is characterised by that screening includes following steps：
（1）Build segregating population：Using more for the superpower cold-resistant winter rape Gansu Province oil of the strong winter habit of parent 7 of bagging selfing and strong cold-resistant
No. 9 configuration cross combinations of winter rape Gansu Province oil, first familiar generation selfing produces F2 for segregating population；
（2）Rape leaf DNA is extracted：The oily No. 9 and F2 blades for segregating population of parent Gansu Province oil 7 and Gansu Province are extracted using CTAB methods
DNA；
（3）Primer Source and synthesis：315 pairs of primers, wherein 51 pairs of SSR primers, 64 pairs of InDel primer 2s；
（4）Polymorphism primer is screened：Enter performing PCR amplification using the parent DNA of primer pair two of synthesis, filter out with polymorphism
Primer；
（5）Polymorphism primer is detected in F2 generations：The polymorphism primer filtered out is detected in F2 generations, genotype number is obtained
According to；
（6）Genetic linkage map is built and QTL positioning：According to F2 for genotype data, QTL IciMapping V3.3 softwares are utilized
Carry out genetic linkage map structure and QTL positioning.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510211289.6A CN104988138B (en) | 2015-04-29 | 2015-04-29 | Strong winter habit Chinese cabbage type winter rape soluble protein content molecular labeling and QTL positioning |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510211289.6A CN104988138B (en) | 2015-04-29 | 2015-04-29 | Strong winter habit Chinese cabbage type winter rape soluble protein content molecular labeling and QTL positioning |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104988138A CN104988138A (en) | 2015-10-21 |
| CN104988138B true CN104988138B (en) | 2017-09-29 |
Family
ID=54300033
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510211289.6A Active CN104988138B (en) | 2015-04-29 | 2015-04-29 | Strong winter habit Chinese cabbage type winter rape soluble protein content molecular labeling and QTL positioning |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104988138B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286492A (en) * | 2011-08-17 | 2011-12-21 | 中国农业科学院油料作物研究所 | Major gene locus for thousand-grain weight trait of rape and application thereof |
| CN103443292A (en) * | 2010-12-22 | 2013-12-11 | 先锋国际良种公司 | QTLs associated with and methods for identifying whole plant field resistance to sclerotinia |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9179633B2 (en) * | 2013-07-23 | 2015-11-10 | Pioneer Hi-Bred International, Inc. | Canola variety hybrid VR 9561 GS |
-
2015
- 2015-04-29 CN CN201510211289.6A patent/CN104988138B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103443292A (en) * | 2010-12-22 | 2013-12-11 | 先锋国际良种公司 | QTLs associated with and methods for identifying whole plant field resistance to sclerotinia |
| CN102286492A (en) * | 2011-08-17 | 2011-12-21 | 中国农业科学院油料作物研究所 | Major gene locus for thousand-grain weight trait of rape and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 北方白菜型冬油菜F2主要生理生化特性的变异与抗寒性相关分析;孔德晶等;《草业学报》;20140831;摘要、材料与方法1.1-1.2部分、结果与分析2.4部分、讨论部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104988138A (en) | 2015-10-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105969852B (en) | A kind of molecular labeling and application with rape crotch angle character QTL site close linkage | |
| CN108315465B (en) | InDel molecular marker closely linked with cowpea salt tolerance related characters, primers and application thereof | |
| CN104805179B (en) | A kind of molecular labeling and preparation method and application with cabbage type rape grain re-association | |
| CN104805080A (en) | Rapeseed pod number major QTL molecular marker and application thereof | |
| CN110184373A (en) | A kind of and the associated molecular labeling of rape mass of 1000 kernel and application | |
| CN108504773A (en) | Molecular labeling and its application of cabbage type rape grain weight and Pod length main effect QTL site | |
| CN102876777B (en) | The special primer of brown croaker EST microsatellite marker and screening method | |
| CN108950054A (en) | A kind of InDel molecular marker and primer thereof and application with cowpea salt tolerant correlated traits close linkage | |
| CN105296472A (en) | Molecular marker of peel full-brown trait gene locus of Chinese 'Qingxiang'-variety pears and screening method of molecular marker | |
| KR101734922B1 (en) | Molecular marker for discriminating black rot-resistant or sensitive cabbage cultivar and uses thereof | |
| CN102242222B (en) | Method for classifying ctenopharyngodon idella based on expressed sequence tag-simple sequence repeats (EST-SSR) marker | |
| CN110453008A (en) | One with the molecular labeling ZMM6206 and its application of gingili leaf length of a film and wide major gene loci close linkage | |
| CN105018595B (en) | Strong winter habit Chinese cabbage type winter rape free proline content molecular labeling and QTL site | |
| CN104988138B (en) | Strong winter habit Chinese cabbage type winter rape soluble protein content molecular labeling and QTL positioning | |
| CN101240340B (en) | Molecule identification method for Qingdao zoysia japonica and zoysia matrella filial generation authenticity | |
| CN105039508B (en) | Strong winter habit Chinese cabbage type winter rape SOD enzyme molecules label and QTL site | |
| CN110373492A (en) | Without the hidden sub- grass LTR-RT molecular labeling primer of awns and the application in Germplasm Identification | |
| CN104651497A (en) | SSR molecular marker primers interlinked with cabbage yellow testa gene Brsc-ye and application of primers | |
| CN106399480B (en) | Microsatellite genetic fingerprint of grass carp meiotic gynogenesis progeny induced by megalobrama amblycephala sperms | |
| CN115873976A (en) | Molecular marker for identifying height character of broom corn millet and application thereof | |
| CN113151543B (en) | Primer group, method and kit for rapidly identifying calla seedling types by using SSR markers and application of primer group, method and kit | |
| CN104988212B (en) | Strong winter habit Chinese cabbage type winter rape CAT enzyme molecule label and QTL positioning | |
| CN103740856B (en) | Molecular method for predicting verticillium wilt resisting capability of different cotton materials | |
| CN105018596B (en) | Strong winter habit Chinese cabbage type winter rape POD enzyme molecules label and QTL site | |
| CN104877994B (en) | Strong winter habit Chinese cabbage type winter rape malonaldehyde MDA molecular labeling and QTL positioning |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |