CN103740712B - Cucumber EST-SSR (Expressed Sequence Tag-Simple Sequence Repeat) molecular markers - Google Patents

Abstract

The invention discloses cucumber EST-SSR molecular markers. The cucumber EST-SSR molecular markers are prepared by the following steps: taking genome DNA (Deoxyribonucleic Acid) templates of 15 cucumbers or varieties as an object of study, according to the published cucumber EST sequences, adopting Primer 3.0 primer design software to design EST-SSR primers, and performing PCR (Polymerase China Reaction) amplification and polyacrylamide gel electrophoresis to screen out four EST-SSR molecular markers with polymorphism including SSR003357, SSR005987, SSR003154 and SSR9473. The cucumber EST-SSR molecular markers can be used for studying cucumber population genetic structures, heritable variation level and the like.

Description

Cucumber EST-SSR molecule marker

Technical field

The present invention relates to molecular marking technique, be specifically related to a kind of cucumber EST-SSR molecule marker.

Background technology

Cucumber ( cucumis sativusl.) be a kind of cucurbitaceae vegetable crop all having cultivation in the world, the cultivated area of China cucumber and the equal rank the first in the world of production, 50% of the overall cultivated area of its cultivated area Yi Zhan world cucumber.

Although cucumber geographic range is wide, its genetic background is comparatively narrow, and the labeling technique such as isozyme, RFLP, RAPD, AFLP is difficult to the genetic information providing mass efficient in breed cucumber, is unfavorable for that cucumber has excavation and the utilization of gene.

From expressed sequence tag (expressed sequence tag, EST) in, developing SSR mark (EST-SSR) is the New molecular marker that development in recent years is got up, compared with genome SSR, it eliminates the structure in library and a large amount of sequencings, save time and funds, there is the feature of efficient, low cost.Meanwhile, EST, as a part for gene transcripts, more easily obtains the information of genetic expression, and the Direct Identification that can be functional gene provides important evidence.

At present, the research of EST-SSR mark has in succession all been carried out at species such as grape, soybean, sugarcane, paddy rice, tomato and wheats.Compared with these species, cucumber EST-SSR marker development is delayed, only utilizes a small amount of cucumber est sequence to develop some SSR primers at present, and marker number is not enough, limits the molecule genetics research of cucumber.Therefore, in the urgent need to obtaining more EST-SSR mark with the investigation and application carrying out the aspects such as cucumber genetic diversity and genealogical identification.

For developing more mark, SSR site found by the cucumber est sequence that the present invention utilizes GeneBank to announce and MISA software, synthesized 30 pairs of primers, through 15 different genotype cucumber screenings, obtains the universal mark that 4 have polymorphism.

Summary of the invention

Technical problem to be solved by this invention is: exploitation cucumber EST-SSR molecule marker, polymorphism primer is provided, set up the technical system of cucumber EST-SSR marker development, Analysis of Genetic Background for cucumber provides how new EST-SSR mark, makes up current cucumber EST-SSR and marks the deficiency comparatively lacked.

The technical scheme of technical solution problem of the present invention: according to the cucumber est sequence announced, design EST-SSR primer, filters out through pcr amplification, polyacrylamide gel electrophoresis the EST-SSR molecule marker that 4 have polymorphism.Being numbered of 4 cucumber molecule markers: SSR003357, SSR005987, SSR003154, SSR9473, its nucleotide sequence respectively as SEQ ID NO.1, SEQ ID NO.2, shown in SEQ ID NO.3, SEQ ID NO.4.

4 EST-SSR molecule marker SSR003357, the primer sequence of SSR005987, SSR003154, SSR9473 is respectively:

SSR003357-F：CGTTGAAAGATCAAGGGCAT

SSR003357-R：GAATCCGCGATTACAGAAGC

SSR005987-F：GGCAGTGCTTCCTCTACTCC

SSR005987-R：TTCACATGGATCTCAAGGCA

SSR003154-F：ATGTCTGTGAGATGCGATGG

SSR003154-R：CTCTTCGTCAAGTTCCTCCG

SSR9473-F： GATATCAAGCCGTCGCAGAT

SSR9473-R： GGAAGGCGTTGGACAATAAA。

The present invention can be applicable to the research of the Genetic Constitution of Population and heritable variation level etc. of cucumber.

Accompanying drawing explanation

Fig. 1 is the result that EST-SSR marks the detection of SSR003357 denaturing polyacrylamide gel electrophoresis;

Fig. 2 is the result that EST-SSR marks the detection of SSR005987 denaturing polyacrylamide gel electrophoresis;

Fig. 3 is the result that EST-SSR marks the detection of SSR003154 denaturing polyacrylamide gel electrophoresis;

Fig. 4 is the result that EST-SSR marks the detection of SSR009473 denaturing polyacrylamide gel electrophoresis.

(1-15 represents respectively: Zhongnong No.9, middle peasant No. 29, and in the good garden exquisite spring, Xinjin grinds No. 4, emerald cucumber, tangshan autumn melon, Bai Yesan, spring and autumn cucumber, numb skin strong yellow melon, Japanese gherkin, Holland gherkin, U.S. gherkin, Xishuangbanna type, South China type cultivar, North-China Type cultivar)

Embodiment

embodiment 1: the design of cucumber EST-SSR labeled primer

Develop primer cucumber est sequence used from GenBank(http: //www.ncbi.nlm.nih.gov).Adopt Primer 3.0 software design primer, the overall principle of design of primers is: the beginning of SSR sequence and end position are no less than 50bp apart from 5 ' and 3 ' end respectively; Primer length 18 ~ 25bp; Tm value 52.0 ~ 60.0 DEG C, and the Tm value of upstream and downstream primer is more or less the same in 5 DEG C; GC content 40% ~ 60%; Pcr amplification product length 100 ~ 300bp; Avoid the appearance of primer secondary structure and continuous 6 base pairings as far as possible.After design of primers completes, synthesized by Sangon Biotech (Shanghai) Co., Ltd., synthesize 30 pairs of EST-SSR primers altogether, see the following form:

embodiment 2: the extraction of cucumber DNA

adopt TIANGEN Biotech's plant genome DNA to extract test kit, concrete steps are as follows:

(1) get fresh cucumber blade appropriate (be approximately 0.1 g), add liquid nitrogen and be fully ground to Powdered, cucumber variety sees the following form:

(2) ground powder is transferred to rapidly in the centrifuge tube that 700 μ l, 65 DEG C of preheating damping fluid GP1 are housed in advance, after putting upside down mixing rapidly, centrifuge tube is placed on 65 DEG C of water-bath 20 min, put upside down centrifuge tube in water-bath process with biased sample for several times.

(3) add 700 μ l chloroforms, fully mix, 12, centrifugal 5 min of 000 rpm.

(4) carefully previous step gained upper strata aqueous phase is proceeded in a new centrifuge tube, add 700 μ l damping fluid GP2, fully mix.

(5) proceed in adsorption column CB3 by the liquid of mixing, centrifugal 30 sec of 12,000 rpm, discard waste liquid.

(6) in adsorption column CB3, add 500 μ l damping fluid GD, centrifugal 30 sec of 12,000 rpm, outwell waste liquid, adsorption column CB3 are put into collection tube.

(7) in adsorption column CB3, add 600 μ l rinsing liquid PW, centrifugal 30 sec of 12,000 rpm, outwell waste liquid, adsorption column CB3 are put into collection tube.

(8) repetitive operation step 7.

(9) put back in collection tube by adsorption column CB3, centrifugal 2 min of 12,000 rpm, outwell waste liquid.Adsorption column CB3 is placed in room temperature and places several minutes, thoroughly to dry rinsing liquid remaining in sorbing material.

(10) proceeded to by adsorption column CB3 in a clean centrifuge tube, the unsettled dropping 100 in the middle part to adsorption film μ l elution buffer TE, room temperature places 5 min, and centrifugal 2 min of 12,000 rpm, by solution collection in centrifuge tube.

embodiment 3: screening has the primer of polymorphism

Be template with the cucumber DNA of extracting in embodiment 2, increase with 30 pairs of primers of design in embodiment 1.PCR adopts 20 μ l reaction systems: in reaction system, add 10 × PCR buffer (Mg respectively ²⁺) 2 μ l, dNTP ((2.5mM each) 0.5 μ l, Taq (2.5u/ μ l) 0.5 μ l, forward primer (10 μMs) 0.5 μ l, reverse primer (10 μMs) 0.5 μ l, DNA profiling (50ng/ μ l) 2 μ l, supply 20 μ l with sterilized water.Concrete steps are: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C extend 30s, amount to 45 circulations, and 72 DEG C extend 10min.

By the product after pcr amplification with in the ratio of 10:1 and sample-loading buffer (containing 98% deionized formamide, 10mM EDTA, 0.25% tetrabromophenol sulfonphthalein and 0.25% dimethylbenzene are blue or green) after mixing, get 3 μ l point samples, carry out electrophoretic separation, electrode buffer is 1 × TBE(Tris-boric acid), at 220V constant voltage electrophoresis, electrophoresis time is 90min.After electrophoresis terminates, careful separately two pieces of sheet glass.Developed by argentation, first use the ethanol of 10% (containing 5 ‰ Glacial acetic acid) to fix 6 minutes, wash 10 minutes, silver nitrate solution dyes 12 minutes, washes 30 seconds, and the NaOH nitrite ion of 15% develops the color 10 minutes, wash 10 minutes, after colour developing terminates, obtain the polymorphism collection of illustrative plates as shown in Fig. 1-4.

sequence table

< 110 >: Agricultural University Of Jiangxi

< 120 >: cucumber EST-SSR molecule marker

〈160〉: 4

SEQ ID NO：1

〈210〉：1

〈211〉:133

〈212〉：DNA

< 213 >: cucumber ( cucumissativusl.)

〈400〉: 1

CGTTGAAAGATCAAGGGCATTTATGGAGGTTGAATAATAAGTATGGTGTGAGAGCAATTTCGTCTCATCACAACAAGCTTTCTTCTTCTTCTTCTTCTTCTTCGAAGTCTTCAGCTTCTGTAATCGCGGATTC

SEQ ID NO：2

〈210〉：2

〈211〉:124

〈212〉：DNA

< 213 >: cucumber ( cucumissativusl.)

〈400〉: 2

GGCAGTGCTTCCTCTACTCCATCTTCACCTTCTTCTTCTTCTTCTTCTTCTTCTAATTCACCTTATTCTCTTATGGGTTTCATCCTTACGCTGCTACCTTTCTATGCCTTGAGATCCATGTGAA

SEQ ID NO：3

〈210〉：3

〈211〉: 114

〈212〉：DNA

< 213 >: cucumber ( cucumissativusl.)

〈400〉: 3

ATGTCTGTGAGATGCGATGGCGATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCCGCGGCTGTGGATTCCAATTTTTGACGCCAAGGTGTTCCGGAGGAACTTGACGAAGAG

SEQ ID NO：4

〈210〉：4

〈211〉: 269

〈212〉：DNA

< 213 >: cucumber ( cucumissativusl.)

〈400〉: 4

GATATCAAGCCGTCGCAGATTCCGTCGTTAATAAATTCAAGAAGGTTATTTCTTTGCTTGACCGCAACAGAACCGGCCATGCTCGTTTCAGAAGGGCTCCGGTTCTTACAACTACTACTACTACTACTACTCCGCCTCCTCCTCCTCCGCCAAAGGTCAAGCCCCAGCATCAAGATCCGAGTTCGTCGTCTCCGATTTCGGTACCTCCGGTTCAAGTAAAGAAACAAGAATCAGTTTCTGCTTTTAAGGTTTATTGTCCAACGCCTTCC

 

Claims (2)

1. a cucumber EST-SSR molecule marker, is characterized in that, the label of described EST-SSR molecule marker is respectively: SSR003357 and SSR003154, and its nucleotide sequence is respectively:

SSR003357：

CGTTGAAAGATCAAGGGCATTTATGGAGGTTGAATAATAAGTATGGTGTGAGAGCAATTTCGTCTCATCACAACAAGCTTTCTTCTTCTTCTTCTTCTTCTTCGAAGTCTTCAGCTTCTGTAATCGCGGATTC ；

SSR003154：

ATGTCTGTGAGATGCGATGGCGATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCCGCGGCTGTGGATTCCAATTTTTGACGCCAAGGTGTTCCGGAGGAACTTGACGAAGAG 。

2. cucumber EST-SSR molecule marker according to claim 1, is characterized in that: the primer sequence in described SSR003357 and SSR003154 two sites is:

SSR003357-F：CGTTGAAAGATCAAGGGCAT

SSR003357-R：GAATCCGCGATTACAGAAGC

SSR003154-F：ATGTCTGTGAGATGCGATGG

SSR003154-R：CTCTTCGTCAAGTTCCTCCG 。