CN103436530A - Functional marker for analyzing rice aroma gene by using DNA melting temperature, and application thereof - Google Patents
Functional marker for analyzing rice aroma gene by using DNA melting temperature, and application thereof Download PDFInfo
- Publication number
- CN103436530A CN103436530A CN201310238700XA CN201310238700A CN103436530A CN 103436530 A CN103436530 A CN 103436530A CN 201310238700X A CN201310238700X A CN 201310238700XA CN 201310238700 A CN201310238700 A CN 201310238700A CN 103436530 A CN103436530 A CN 103436530A
- Authority
- CN
- China
- Prior art keywords
- bad2
- rice
- melting temperature
- fragrant rice
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a functional marker for analyzing rice aroma gene by using a DNA melting temperature, and an application thereof, and belongs to the technical field of biology. According to the present invention, an aroma gene functional marker BAD2-E7 is designed according to sequence difference between rice aroma gene fgr and normal allele BAD2 in the coding region exon 7, and is adopted to carry out two cycles of PCR amplifications, wherein the first cycle PCR adopts genomic DNA as a template and adopts an outer primer to amplify, and the second cycle PCR adopts the diluted first cycle PCR amplification product as a template and adopts an inner primer to amplify; and a DNA melting temperature of the second cycle PCR amplification product is detected through an instrument, and sequence difference between fgr and BAD2 is distinguished with the melting temperature so as to distinguish genotype of the rice material (aroma or non-aroma).
Description
Technical field
The present invention relates to biological technical field, relate to particularly a kind of functional label and application thereof of the DNA of utilization melting temperature (Tm) analyzing rice scent gene.
Background technology
Paddy rice is the important farm crop of China, and fragrance is a key property of high-quality rice, and the price of the non-odor type rice of the cost ratio of odor type rice is high, and its breeding work has obtained extensive attention.Selection is one of most important link in the breeding of odor type rice.Traditional fragrant rice breeding selection method, selected the scent gene type indirectly by phenotype, and there is long, the shortcoming such as efficiency is low, accuracy is poor of cycle in this method.The most effectively select, directly the scent gene type is selected, this direct selection that appears as of DNA molecular marker provides possibility.
The fragrance proterties of most aromatic rices mainly is positioned at the single recessive gene on the 8th karyomit(e)
fgrcontrol.The researchs such as Bradbury think,
fgrit is the gene of coding beet aldehyde dehydrogenase 2
bAD2at the 7th exon, 8 base deletions and 3 place's nucleotide variations occur, cause premature transcription termination and make the loss of function of BAD2 enzyme, and then make its effect substrate 2-acetyl-1-pyrroline (2-acetyl-1-pyrroline, pathways metabolism 2AP) is interrupted, fragrance matter 2AP constantly accumulates, and causes the blade of paddy rice and seed to produce fragrance.For this function variant sites, the functional label GRFM04 based on gel electrophoresis has been developed and for the evaluation of fragrant rice germplasm.
The codominant marker that cost is low, simple and practical, reproducible is the important foundation of effectively carrying out fragrant rice molecule assisted selection.The resolving power of conventional gel electrophoresis is limited, and SNP or the Indel that can't meet extensive existence detect demand; In addition, during traditional gel electrophoresis operational cost, there is certain toxicity, realize that the marker detection difficulty of segregating population in enormous quantities is larger.Therefore, continual exploitation new function type molecule marker, be the inevitable demand of Rice molecular breeding progress.
The difference of DNA sequence dna can cause the difference of DNA melting temperature (Tm), if can utilize the DNA melting temperature (Tm) to detect genotype, can avoid the defect of gel electrophoresis, realizes mass, automatization, totally enclosed genotype detection.Utilize the DNA melting temperature (Tm) to differentiate genotype has been reported in the research of human diseases, but, this technology relates to the Optimization Work in early stage that link is more, need are detailed, at present on paddy rice system to carry out the report of this technical study less, this has limited its widespread use in rice breeding to a certain extent.
Summary of the invention
The technical problem to be solved in the present invention overcomes the defect of current traditional rice scent gene detection technique, and a kind of functional label of the DNA of utilization melting temperature (Tm) analyzing rice scent gene is provided.
Another object of the present invention is to provide a kind of application of functional label of the DNA of utilization melting temperature (Tm) analyzing rice scent gene.
Purpose of the present invention is achieved by the following technical programs:
A kind of rice scent gene functional label BAD2-E7, described BAD2-E7 is comprised of pair of inside primer BAD2-E7-in-F/BAD2-E7-in-R and pair of outside primer BAD2-E7-out-F/BAD2-E7-out-R, and BAD2-E7-in-F, BAD2-E7-in-R, BAD2-E7-out-F and BAD2-E7-out-R primer sequence are as shown in SEQ ID NO1 ~ 4.
The application of a kind of functional label of rice scent gene as mentioned above BAD2-E7, described being applied as for distinguishing fragrant rice and non-fragrant rice.
A kind of method of distinguishing fragrant rice and non-fragrant rice comprises the following steps:
S1. take oryza sativa genomic dna to be measured as masterplate, utilize outside primer BAD2-E7-out-F/BAD2-E7-out-R claimed in claim 1 to carry out pcr amplification;
S2. by the dilution of the product of step S1 pcr amplification, what take is masterplate, utilizes inboard primer BAD2-E7-in-F/BAD2-E7-in-R claimed in claim 1 to carry out pcr amplification;
S3. the melting temperature (Tm) of the DNA that detecting step S2 amplification obtains, if the melting temperature (Tm) of DNA to be measured between 79 ~ 79.6 ℃, paddy rice to be measured is non-fragrant rice; If the melting temperature (Tm) of DNA to be measured is between 77.3 ~ 77.9 ℃, paddy rice to be measured is fragrant rice.
The present invention finds rice scent gene by research
fgrmelting temperature (Tm) be 77.6 ℃, normal allelotrope
bAD2melting temperature (Tm) be 79.3 ℃, rice scent gene
fgrmelting temperature (Tm) than normal allelotrope
bAD2melting temperature (Tm) low 1.7 ℃, so, by melting temperature (Tm), just can distinguish
fgrwith
bAD2sequence difference, thereby the genotype (fragrance or non-fragrance) of differentiation rice material.If it is non-fragrant rice that the melting temperature (Tm) of the DNA of paddy rice to be measured between 79 ~ 79.6 ℃, can judge paddy rice to be measured, if the melting temperature (Tm) of DNA to be measured between 77.3 ~ 77.9 ℃, can judge paddy rice to be measured, be fragrant rice.
The fragrant rice of different varieties all contains rice scent gene
fgr, the fragrant rice of different varieties
fgrthe similarity of gene order is more than 99.5%, so, so long as be fragrant rice, no matter be any kind, the melting temperature (Tm) of the DNA sequence dna by the amplification of BAD2-E7 mark all can be 77.6 ℃ of left and right scopes, can be over 0.3 ℃ before and after this scope.
Preferably, the described dilution of step S2 is 15 ~ 20 times of dilutions.
Preferably, the described PCR reaction system of step S1 is:
2 * Power Taq PCR MasterMix mother liquor, 5 μ L;
Each 0.3 μ L of outside primer (10 μ mol/L);
Genomic dna 0.5 μ L;
Distilled water is supplied 10 μ L;
The pcr amplification program is 95 ℃, 5min; 95 ℃, 20s; 57 ℃, 20s; 72 ℃, 10s; 25 circulations; 72 ℃, 5min.
Preferably, the described PCR reaction system of step S1 is:
2 * Power Taq PCR MasterMix mother liquor, 4 μ L;
Each 0.3 μ L of inboard primer (10 μ mol/L);
20 * EvaGreen dyestuff, 0.5 μ L;
The first round PCR product 0.5 μ L diluted;
Distilled water is supplied 10 μ L;
The pcr amplification program is 95 ℃, 2min; 95 ℃, 20s; 59 ℃, 20s; 72 ℃, 10s; Totally 25 circulations; 72 ℃, 5min; 95 ℃, 2min; 25 ℃, 2min.
Preferably, the melting curve that the described melting temperature (Tm) curve of step S3 is 60 ~ 95 ℃.
Preferably, the described contrast of step S3, the melting curve that the melting temperature (Tm) curve is 75 ℃ ~ 82 ℃.
Than prior art, compare, the present invention has following beneficial effect:
1. the detection method provided is simple, than the original method of passing through gene sequencing or gel electrophoresis, determines that genotype is more easy, quick; In addition, this method does not contact toxic reagent, to operator's healthy and beneficial.
2. functional label provided by the invention, by the twice PCR purpose fragment that increases, has significantly improved the specificity of purpose fragment product, makes the interpretation of result more accurate.
3. method provided by the present invention, Detection accuracy is high, can be used for screening on a large scale target gene.
figure of description
Fig. 1. genome position, primer place and the amplified fragments of functional label BAD2-E7;
bAD2with
fgrthe function variant sites of gene identifies with asterisk (*) respectively.
Fig. 2. utilize BAD2-E7 to identify
bAD2,
fgrand the DNA cloning fragment melting temperature (Tm) of heterozygous.
Fig. 3. utilize the electrophoresis result of BAD2-E7 amplified production; M. DNA ladder; 1 ~ 2 BAD2(Japan is fine); 3 ~ 4
fgr(Basmati370); 5 ~ 6 heterozygous (Japanese fine+Basmati370).
Embodiment
Further illustrate the present invention below in conjunction with the drawings and specific embodiments.The test method of using in embodiment if no special instructions, is ordinary method; The material used, reagent etc. if no special instructions, are reagent and the material that can obtain from commercial channels.
S1. the extraction of aromatic rice Basmati370, the fine genomic dna of non aromatic rice Japan.
Concrete grammar:
S11. the 2.0 mL sterilizing centrifuge tubes that January after rice transplanting, spire was placed in liquid nitrogen freezing of taking a morsel are stirred to Powdered, add 1000 μ L 2 * CTAB-DNA and extract (CTAB that massfraction (W/V) is 2%, pH8.0; The PVP that massfraction (W/V) is 1%; 100 mmol/L Tris-HCl, pH8.0; 1.4 mol/L NaCl; 20 mmol/L EDTA, pH8.0; The mercaptoethanol that volume fraction (V/V) is 0.2%);
S12. be placed in 65 ℃ of thermostat water baths and shake once every 10 min, take out after 30 ~ 45 min;
S13. add 1000 μ L chloroform-primary isoamyl alcohol (volume ratio 24:1) after cooling 2 min, acutely fully shake up and down, both are mixed;
Centrifugal 10 min of S14.10000 rpm, beat easily in the new centrifuge tube of supernatant to 1.5 ml sterilizing, adds the upper and lower jog of the pre-cold isopropanol of 600 μ L even;
S15. place 30 min for-20 ℃ and make the DNA precipitation; Centrifugal 6 min of 10000 rpm, outwell supernatant handstand centrifuge tube immediately on paper handkerchief;
S16. upright centrifuge tube after 1 min, add 800 μ L 70% ethanol and 3 M NaAc (volume ratio 9:1), and jog suspends DNA and places 30 min;
S17. centrifugal 6 min of 10000 rpm, outwell immediately supernatant and add 800 μ L 70% ethanol by DNA rinsing 30 min again;
S18. centrifugal 3 min of 10000 rpm, dry in stink cupboard; Add 100 ~ 200 μ L1 * TB Buffer (10 mM Tris-HCl, pH8.0; 1 mM EDTA, pH8.0) dissolve, 4 ℃ save backup.
S2. the fine fragrance authentication method of aromatic rice Basmati370, non aromatic rice Japan.
Concrete grammar: the 2g left and right is cut into to fragment for the greenery that try material, puts into the fine taper bottle, add the potassium hydroxide solution of 10mL 17g/L in each bottle, cover immediately bottle cap, be placed in 10min under room temperature, then open one by one bottle cap, use immediately nasil it, differentiate fragrance.
S3. aromatic rice Basmati370, the fine scent gene mark BAD2-E7 exploitation of non aromatic rice Japan and amplification.
S31. compare Basmati370, Japanese fine BAD2 gene the 7th exon sequence difference, the functional label BAD2-E7(Fig. 1 in difference site is contained in design).Compare fine this section of Japan, 8 base deletions and 3 place's nucleotide variations occur at the 7th exon in Basmati370, cause this section DNA melting temperature (Tm) to reduce by 1.5 ℃ than Japan is fine.Described BAD2-E7 is comprised of pair of inside primer BAD2-E7-in-F/BAD2-E7-in-R and pair of outside primer BAD2-E7-out-F/BAD2-E7-out-R, and primer sequence is as follows:
BAD2-E7-out-F primer sequence (5 '-3 ') TACCAGGACTTGTTTGGAGCTT, as shown in SEQ ID NO:1; BAD2-E7-out-R primer sequence (5 '-3 ') AAACCTTAACCATAGGAGCAGC, as shown in SEQ ID NO:2; .
BAD2-E7-in-F primer sequence (5 '-3 ') TGTTAGGTTGCATTTACTGGGAGT, as shown in SEQ ID NO:3; BAD2-E7-in-R primer sequence (5 '-3 ') CAAACCTTAACCATAGGAGCAGC, as shown in SEQ ID NO:4.
Utilize functional label BAD2-E7 to carry out the two-wheeled pcr amplification, first round PCR be take genomic dna as template, utilizes the BAD2-E7-out-F/BAD2-E7-out-R primer amplification; Second take turns PCR take the dilution first round pcr amplification product be template, utilize the BAD2-E7-in-F/BAD2-E7-in-R primer amplification.
First round PCR: reaction system adds 2 * Power Taq PCR MasterMix mother liquor (hundred Tykes, Beijing), 5 μ L, outside primer (10 μ mol/L) each 0.3 μ L and 0.5 μ L genomic dna successively, finally with distilled water, supplies 10 μ L.In the enterprising performing PCR amplification of GeneAmp 9700 type PCR instrument (Applied Biosystems, USA), amplification program is 95 ℃, 5min; 25 * (95 ℃, 20s; 57 ℃, 20s; 72 ℃, 10s); 72 ℃, 5min.After having reacted, to the PCR pipe, add 200 μ L distilled waters, with dilution first round PCR product (approximately 20 times).
Second takes turns PCR: reaction system adds 2 * Power Taq PCR MasterMix mother liquor (hundred Tykes successively, Beijing) 4 μ L, inner primer (10 μ mol/L) each 0.3 μ L, 0.5 μ L 20 * EvaGreen dyestuff (Biotium, USA) and the first round PCR product that diluted of 0.5 μ L, finally with distilled water, supply 10 μ L.The pcr amplification program is 95 ℃, 2min; 25 * (95 ℃, 20s; 59 ℃, 20s; 72 ℃, 10s); 72 ℃, 5min; 95 ℃, 2min; 25 ℃, 2min.
S4. functional label BAD2-E7 amplified production DNA melting temperature (Tm) detection method.
Second takes turns amplified production all is transferred to respectively band shirt rim, opaque 96 orifice plates of white background, adds 20 μ L mineral oil (SIGMA, USA), and centrifugal (1000 rpm, 1 min) is to eliminate bubble.Check-out console to be measured is put into to LightScanner 96 (Idaho Technology, USA) analytical system, read the melting curve of 60 ℃ ~ 95 ℃.The raw data gathered is analyzed with LightScanner Call IT software (Idaho Technology, USA), selects Small Amplicon pattern to carry out automated analysis, the results are shown in Figure 2, as can be seen from Figure 2, and rice scent gene
fgrmelting temperature (Tm) be 77.6 ℃, normal allelotrope
bAD2melting temperature (Tm) be 79.3 ℃, rice scent gene
fgrmelting temperature (Tm) than normal allelotrope
bAD2melting temperature (Tm) low 1.7 ℃, so, by melting temperature (Tm), just can distinguish
fgrwith
bAD2sequence difference, thereby the genotype (fragrance or non-fragrance) of differentiation rice material.If it is non-fragrant rice that the melting temperature (Tm) of the DNA of paddy rice to be measured between 79 ~ 79.6 ℃, can judge paddy rice to be measured, if the melting temperature (Tm) of DNA to be measured between 77.3 ~ 77.9 ℃, can judge paddy rice to be measured, be fragrant rice.
The fragrant rice of different varieties all contains rice scent gene
fgr, the fragrant rice of different varieties
fgrthe similarity of gene order is more than 99.5%, so, so long as be fragrant rice, no matter be any kind, the melting temperature (Tm) of the DNA sequence dna by the amplification of BAD2-E7 mark all can be 77.6 ℃ of left and right scopes, can be over 0.3 ℃ before and after this scope.
S5. the polyacrylamide gel electrophoresis detection method of functional label BAD2-E7 amplified production.
Concrete grammar: amplified production is through 8.0% native polyacrylamide gel electrophoresis (electrophoretic buffer 1 * TBE, voltage 110 V, times 2.5 h), by 0.1% AgNO
3dyeing, utilize the BIORAD gel imaging system to observe, take pictures and read tape.
Embodiment 2: utilize BAD2-E7 to detect the rice scent gene type.
1. for the examination material: the research material order aromatic rice Basmati370 of this experiment institute, non aromatic rice Japan are fine.
2. for examination material fragrance, identify for 2 parts: the fragrance authentication method is described with embodiment 1.
3. result shows, the Basmati370 blade table reveals fragrance, Japanese fine blade British plain spirits.
4. 2 parts supply examination material DNA extraction, and the pcr amplification analysis: DNA extraction and pcr amplification method are described with embodiment 1.
5. functional label BAD2-E7 amplified production DNA melting temperature (Tm) detects: the melting temperature (Tm) detection method is described with embodiment 1.
Result shows, Basmati370 amplified production DNA melting temperature (Tm) is 77.6 ℃, illustrates that Basmati370 contains scent gene
fgrso, can judge that Basmati370 is as fragrant rice; The fine amplified production DNA melting temperature (Tm) of Japan is 79.3 ℃, and Japan is fine is wild type gene
bAD2, can judge Japanese fine is non-fragrant rice, above result shows to utilize functional label BAD2-E7 can distinguish rice varieties fragrant and non-perfume (or spice), rate of accuracy reached 100%.
6. functional label BAD2-E7 amplified production polyacrylamide gel electrophoresis: the polyacrylamide gel detection method is described with embodiment 1.Result shows, the more Japanese fine amplified production of Basmati370 lacks several bases, with expected results (Fig. 3) in full accord.Illustrate that institute's melting temperature (Tm) detects consistent with conventional gel electrophoresis result, can replace detected through gel electrophoresis scent gene type, improve detection efficiency.
SEQUENCE LISTING
<110 > Agricultural University Of South China
<120 > a kind of functional label and application thereof that utilizes DNA melting temperature (Tm) analyzing rice scent gene
<130>
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 22
<212> DNA
<213> BAD2-E7-out-F
<400> 1
taccaggact tgtttggagc tt 22
<210> 2
<211> 22
<212> DNA
<213> BAD2-E7-out-R
<400> 2
aaaccttaac cataggagca gc 22
<210> 3
<211> 24
<212> DNA
<213> BAD2-E7-in-F
<400> 3
tgttaggttg catttactgg gagt 24
<210> 4
<211> 23
<212> DNA
<213> BAD2-E7-in-R
<400> 4
caaaccttaa ccataggagc agc 23
Claims (8)
1. a rice scent gene functional label BAD2-E7, it is characterized in that, described BAD2-E7 is comprised of pair of inside primer BAD2-E7-in-F/BAD2-E7-in-R and pair of outside primer BAD2-E7-out-F/BAD2-E7-out-R, and BAD2-E7-in-F, BAD2-E7-in-R, BAD2-E7-out-F and BAD2-E7-out-R primer sequence are as shown in SEQ ID NO1 ~ 4.
2. the application of the described rice scent gene functional label of claim 1 BAD2-E7, is characterized in that, described being applied as for distinguishing fragrant rice and non-fragrant rice.
3. a method of distinguishing fragrant rice and non-fragrant rice, is characterized in that, comprises the following steps:
S1. take oryza sativa genomic dna to be measured as masterplate, utilize outside primer BAD2-E7-out-F/BAD2-E7-out-R claimed in claim 1 to carry out pcr amplification;
S2. by the dilution of the product of step S1 pcr amplification, what take is masterplate, utilizes inboard primer BAD2-E7-in-F/BAD2-E7-in-R claimed in claim 1 to carry out pcr amplification;
S3. the melting temperature (Tm) of the DNA that detecting step S2 amplification obtains, if the melting temperature (Tm) of DNA to be measured between 79 ~ 79.6 ℃, paddy rice to be measured is non-fragrant rice, if the melting temperature (Tm) of DNA to be measured between 77.3 ~ 77.9 ℃, paddy rice to be measured is fragrant rice.
4. distinguish according to claim 3 the method for fragrant rice and non-fragrant rice, it is characterized in that, the described dilution of step S2 is 15 ~ 20 times of dilutions.
5. distinguish according to claim 3 the method for fragrant rice and non-fragrant rice, it is characterized in that, the described PCR reaction system of step S1 is:
2 * Power Taq PCR MasterMix mother liquor, 5 μ L;
Each 0.3 μ L of outside primer (10 μ mol/L);
Genomic dna 0.5 μ L;
Distilled water is supplied 10 μ L;
The pcr amplification program is 95 ℃, 5min; 95 ℃, 20s; 57 ℃, 20s; 72 ℃, 10s; 25 circulations; 72 ℃, 5min.
6. distinguish according to claim 3 the method for fragrant rice and non-fragrant rice, it is characterized in that, the described PCR reaction system of step S1 is:
2 * Power Taq PCR MasterMix mother liquor, 4 μ L;
Each 0.3 μ L of inboard primer (10 μ mol/L);
20 * EvaGreen dyestuff, 0.5 μ L;
The first round PCR product 0.5 μ L diluted;
Distilled water is supplied 10 μ L;
The pcr amplification program is 95 ℃, 2min; 95 ℃, 20s; 59 ℃, 20s; 72 ℃, 10s; Totally 25 circulations; 72 ℃, 5min; 95 ℃, 2min; 25 ℃, 2min.
7. distinguish according to claim 3 the method for fragrant rice and non-fragrant rice, it is characterized in that, the melting curve that the described melting temperature (Tm) curve of step S3 is 60 ~ 95 ℃.
8. distinguish according to claim 3 the method for fragrant rice and non-fragrant rice, it is characterized in that, the described contrast of step S3, the melting curve that the melting temperature (Tm) curve is 75 ~ 82 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310238700XA CN103436530A (en) | 2013-06-17 | 2013-06-17 | Functional marker for analyzing rice aroma gene by using DNA melting temperature, and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310238700XA CN103436530A (en) | 2013-06-17 | 2013-06-17 | Functional marker for analyzing rice aroma gene by using DNA melting temperature, and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103436530A true CN103436530A (en) | 2013-12-11 |
Family
ID=49690246
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310238700XA Pending CN103436530A (en) | 2013-06-17 | 2013-06-17 | Functional marker for analyzing rice aroma gene by using DNA melting temperature, and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103436530A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789656A (en) * | 2015-03-23 | 2015-07-22 | 华南农业大学 | Molecular marker for rice aroma gene and application thereof |
| CN105349623A (en) * | 2014-08-13 | 2016-02-24 | 深圳市作物分子设计育种研究院 | HRM (high-resolution melt) detection method for herbicide-resistant gene OsmALS and application of method |
-
2013
- 2013-06-17 CN CN201310238700XA patent/CN103436530A/en active Pending
Non-Patent Citations (5)
| Title |
|---|
| LOUOIS M. T. BRADBURY ET AL.: "A perfect marker for fragrance genotyping in rice", 《MOLECULAR BREEDING》 * |
| 王丰 等: "一种水稻香味基因功能标记的开发", 《中国水稻科学》 * |
| 王廷华等: "《PCR理论与技术》", 31 December 2005 * |
| 王廷华等: "《PCR理论与技术》", 31 December 2005, article "第12章", pages: 171-177 * |
| 赵均良 等: "应用高分辨率熔解曲线技术分析水稻分子标记基因型", 《中国农业科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105349623A (en) * | 2014-08-13 | 2016-02-24 | 深圳市作物分子设计育种研究院 | HRM (high-resolution melt) detection method for herbicide-resistant gene OsmALS and application of method |
| CN104789656A (en) * | 2015-03-23 | 2015-07-22 | 华南农业大学 | Molecular marker for rice aroma gene and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106676102B (en) | One kind SNP marker relevant to arachidonic acid content in Seed of Camellia oleifera grease and its application | |
| CN105385778A (en) | Primers and method for detecting SNP gene typing of AhFAD2B genes of peanuts in high throughput | |
| CN104789656A (en) | Molecular marker for rice aroma gene and application thereof | |
| CN106755481A (en) | A kind of SSR molecular marker VI for identifying Gala apple Progeny plants and its application | |
| CN109628628B (en) | Development and application of SNP (single nucleotide polymorphism) marker of rice blast resistance gene Pi2 | |
| CN105238869A (en) | FLC1 specific SNP molecular marker based on competitive allele specificity PCR technology and application | |
| CN104789654A (en) | Molecular marker for rice blast resistance gene Pita and application thereof | |
| CN104561299B (en) | A kind of molecular marker and its application for identifying wheat seed peroxidase activity | |
| CN105779574A (en) | HRM detection method of rice blast resistance gene Pi2 and application thereof | |
| CN105316329A (en) | Flammulina velutipes SSR molecular marker and corresponding primers and application thereof | |
| CN104131092A (en) | High resolution melting curve-based multi-SNP identification method | |
| CN103146831B (en) | Method for identifying rice and dry rice | |
| CN107630103A (en) | A kind of CAPS molecule labelling methods for identifying rice varieties and application | |
| Yamamuro et al. | Rapid identification of drug-type and fiber-type cannabis by allele specific duplex PCR | |
| CN103436530A (en) | Functional marker for analyzing rice aroma gene by using DNA melting temperature, and application thereof | |
| CN103333887A (en) | Functional marker for analyzing Pita gene of rice by utilizing DNA melting temperature | |
| CN101892318A (en) | Method and kit for detecting correlated mutation allele of total farrow number of sow as well as application | |
| CN105132562B (en) | For identifying molecular labeling, primer pair and its application of the non-acid character of Peach fruits | |
| Zhou et al. | Evaluation of candidate reference genes for quantitative gene expression studies in tree peony | |
| CN108277221B (en) | Functional marker of wheat phytoene synthase gene psy-e2 and application thereof | |
| CN1932037B (en) | Method of screening transgenic wheat | |
| CN103436601B (en) | A kind of utilize DNA melting temperature (Tm) analyzing rice Wx gene functional label Wx-a/b and using method and application | |
| CN104593510A (en) | Primer, probe and method for detecting SNP allele variation of peanut FAD2 genes | |
| CN104789558A (en) | Molecular marker for rice gelatinization temperature control gene and application thereof | |
| CN116144816A (en) | KASP molecular marker for identifying orange peel color in seedling stage and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20131211 |