CN105018482A

CN105018482A - Hybridized tRNA (transfer ribonucleic acid) and application thereof to glutathione peroxidase preparation

Info

Publication number: CN105018482A
Application number: CN201510431360.1A
Authority: CN
Inventors: 魏景艳; 樊振林; 宋健; 管徒晨
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2015-07-21
Filing date: 2015-07-21
Publication date: 2015-11-04
Anticipated expiration: 2035-07-21
Also published as: CN105018482B

Abstract

The invention discloses hybridized tRNA (transfer ribonucleic acid) and application thereof to glutathione peroxidase preparation and belongs to the field of biotechnology. The hybridized tRNA relates to sequences SEQ ID No: 1-16, consists of 90 basic groups, and not only can serve as substrate tRNA for selenocysteine synthesis, but also can be recognized by autologous elongation factor EF-Tu of escherichia coli. A hybridized tRNA gene is obtained by a gene synthesis method, then a GPX (glutathione peroxidase) gene is synthetized or amplified, the hybridized tRNA gene and the GPX gene are assembled on a secretory prokaryotic expression vector capable of expressing the hybridized tRNA, a TAG engineering strain is transformed and subjected to induced expression in presence of sodium selenite, and a catalytic group Sec of the GPX is introduced into a substrate binding site of protein in a way that conventional amino acids enter a peptide chain, so that the protein is given with high GPX activity. The hybridized tRNA and application thereof to glutathione peroxidase preparation have the advantages that the method is simple, and zymoprotein is high in activity, yield and stability, so that the problems that natural GPX is limited in source and instable in property are solved.

Description

A kind of heterozygosis tRNA and preparing the application in Selenoperoxidase

Technical field

The invention belongs to biological technical field, be specifically related to a kind of heterozygosis tRNA and the application in the high vigor Sn bearing granite of preparation thereof.

Background technology

The substrate of Sn bearing granite (GPX) is gsh (GSH), and catalytic group is seleno-cysteine (Sec).In vivo, the same superoxide-dismutase of GPX (SOD), catalase (CAT) together form body anti-oxidative defense system.GPX plays an important role in this system, it with substrate GSH for reductive agent, hydrogen peroxide in decomposer and all kinds of hydroperoxide, thus can active oxygen (ROS) in purged body, prevent lipid peroxidation, treat the various diseases caused by active oxygen, as aging, ultraviolet radiation, cardiovascular and cerebrovascular diseases, diabetes, tumour etc.Different from other antioxidase, GPX is except removing except ROS, and lipid peroxide of can also degrading, prevents cellular superoxideization from damaging, and the function of the Cell protection of this uniqueness makes it in antioxidase system, occupy the position of particularly important.But, because the source of natural GPX is quite limited, poor stability, cause its artifact and the research of stand-in thereof to receive much concern.

Small molecule mimetics mainly contains PZ51 (ebselen), AL3823A, BXT series product, and their weakness is that vigor is low, about being only the thousandth of natural GPX.The GPX analogue enztme that macromolecular stand-in mainly contain abzyme (Chinese patent 94102481.4 and 96112628.0) and prepare for protein template with glutathione S-transferase (GST), its vigor is significantly higher than small molecule mimetics.Obviously, be that the macromole GPX analogue enztme of Template preparation have received better effect to have the albumen of gsh (GSH) combining site, therefore the GPX analogue enztme technology of preparing of these high vigor of exploitation preparation is with regard to the study hotspot of Cheng Liao academia, has broad application prospects for fields such as molecular biology, physiotechnology and medical science.The method that success has been developed so far has: the catalytic group seleno-cysteine (Sec) introducing GPX with chemical method (Chinese patent 94102481.4,96112628.0) or auxotroph prokaryotic expression system (Chinese patent 200810050556.6) in non-GPX class template albumen.

Chinese patent 94102481.4,96112628.0,99104234.4, the preparation method of all kinds of selenium-containing abzyme disclosed in 200810050556.6 is exactly the catalytic group Sec that applied chemistry sudden change (modification) method introduces GPX in antibody class template protein, there is following shortcoming: (1) is in preparation process, only chemical mutation (modification) this step will lose the zymoprotein of 20-40%, causes analogue enztme productive rate significantly to decline; (2) cycle of preparing analogue enztme is long, complex operation, and the time is long; (3) need to use phenylmethylsulfonyl fluoride, acetonitrile etc. in chemical mutation process, these materials are virose material; (4) lack targeting, for large protein molecular, chemical reaction different loci of being everlasting introduces multiple non-specific catalytic group, and therefore chemical mutation is introduced catalytic group and cannot be reached the such specificity of transgenation method.

The another kind of preparation method that Chinese patent 200810050556.6 also discloses people source strand selenium-containing abzyme introduces catalytic group by auxotroph prokaryotic expression system (intestinal bacteria) and transgenation method, but it is only limitted to the preparation of people source strand selenium-containing abzyme, do not comprise the preparation method of Selenoperoxidase (GPX) mutant and other GPX analogue enztme.Have the glutathione S-transferase (GST) of GPX activity preparation method (Yu, H.J., Liu, J.Q., a., Li, J., Luo, G.M., and Shen, J.C.J.Biol.Chem.2005,280,11930-11935) also appear in the newspapers, although this method also adopts auxotroph prokaryotic expression system and transgenation method to introduce catalytic group, it is only limitted to be that template protein prepares GPX analogue enztme with GST, does not comprise with natural GPX for Template preparation GPX mutant.In non-GPX class template albumen, introducing with auxotroph prokaryotic expression system catalytic group prepares analogue enztme method is catalytic group is incorporated into it that there is same substrate GSH combining site with GPX to plant in albumen and make it produce GPX vigor.

But do not possess the catalytic group of natural GPX self due to these template protein, be therefore difficult to find ideal and the position of catalytic group accurately; Simultaneously owing to not resembling catalytic triads desirable natural GPX in these template protein, therefore the catalytic efficiency of this kind of analogue enztme is not high yet.If with natural GPX for template gene engineering method prepares GPX, these shortcomings can be overcome.Because the codon UGA of the catalytic group Sec of the GPX that encodes is terminator codon, in common prokaryotic expression system, need first in the open reading frame of GPX gene, the codon UGA downstream of next-door neighbour Sec introduces neck ring structure, then by the complex process that special tRNA and SelC of Sec and a series of cis element and trans-acting factor participate in jointly, UGA translated into Sec instead of terminator codon.In open reading frame, the introducing of neck ring will inevitably cause the change of GPX space conformation, and then affects enzymic activity, in addition, this translating mechanism to read over efficiency very low, only up to 5% of 20 kinds of conventional amino acid.Therefore common prokaryotic expression system is unsuitable for directly expressing the Selenonic protein with GPX activity.

Disclosed in Chinese patent 201310302778.3 and 2013101428661, method achieves breakthrough, but it can only for the preparation of the various GPX mutant of high vigor, can not for the preparation of natural GPX albumen.

Summary of the invention

What the object of the present invention is to provide a kind of synthetic can read over heterozygosis tRNA that UAG is seleno-cysteine and the application in the high vigor Sn bearing granite of preparation thereof.

Using gene engineering technique, prokaryotic cell prokaryocyte culture technique, substituted and delete the intestinal bacteria of releasing hormone RF 1 for expression system with UAG terminator codons all in genome by UAA terminator codon, utilize encode UAG terminator codon of the heterozygosis tRNA of synthetic to be seleno-cysteine (seleno-cysteine), thus realize seleno-cysteine by the mode that conventional amino acid enters peptide chain and insert and the high expression of high vigor GPX in the active centre of Selenoperoxidase (GPX) fixed point.Present method can avoid the shortcomings such as the prokaryotic organism coding complex mechanism of seleno-cysteine and poor efficiency, play prokaryotic organism and be convenient to the advantages such as genetic manipulation, efficiently expressing exogenous gene and toxigenic capacity are low, the seleno-protein having a pharmaceutical use for GPX etc. provides simply, efficient preparation method.The inventive method has broad application prospects in bio-pharmaceuticals.

With the encoding sequence serT of the tRNA of intestinal bacteria Serine, (see NCBI, Gene ID:944826, encode tRNA in the present invention ^ser _uGA) and the tRNA encoding sequence SelC of seleno-cysteine (see NCBI, Gene ID:948167, coding tRNAsec) be template, by computer assisted sequential analysis and gene chemical synthesis, obtain the heterozygosis tRNA that a kind of amber stop codon UAG that can encode is seleno-cysteine ^uA _cUA, it is by 90 based compositions, with intestinal bacteria tRNA ^seccompare, it can either as the substrate tRNA of seleno-cysteine synthesis, can be identified by the elongation factor EF-Tu of intestinal bacteria self again, thus realize the fixed point coding of seleno-cysteine at UAG codon place by the mode that conventional amino acid enters peptide chain and insert.Utilize this heterozygosis tRNA to read over energy high expression height vigor in expression system at UAG and there is the GPX of natural acid sequence, described heterozygosis tRNA ^uA _cUAprimary nucleotide sequence (SEQ ID No:1) as follows:

SEQ ID No:1

GGAAGAUGUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCGCAGGUUCGAAUCCUGUCAUCUUCCGCCA

Further, the concrete nucleotide sequence of described heterozygosis tRNA also comprises any one the novel heterozygosis tRNA formed sported by sequence 1 (SEQ ID No:1) the 72nd bit base A in other three kinds of base C, U, G, and its sequence is SEQ ID No:2,3,4.

SEQ ID No:2

GGAAGAUGUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCGCAGGUUCGACUCCUGUCAUCUUCCGCCA

SEQ ID No:3

GGAAGAUGUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCGCAGGUUCGAUUCCUGUCAUCUUCCGCCA

SEQ ID No:4

GGAAGAUGUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCGCAGGUUCGAGUCCUGUCAUCUUCCGCCA

Further, the concrete base sequence of described heterozygosis tRNA also comprises, 8th bit base G in sequence 1-4 (SEQ ID No:1,2,3,4) is sported C, the 79th bit base C sports the novel heterozygosis tRNA of any one that G is formed, its sequence is SEQ ID No:5,6,7,8.

SEQ ID No:5

GGAAGAUCUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCGCAGGUUCGAAUCCUGUGAUCUUCCGCCA

SEQ ID No:6

GGAAGAUCUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCGCAGGUUCGACUCCUGUGAUCUUCCGCCA

SEQ ID No:7

GGAAGAUCUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCGCAGGUUCGAUUCCUGUGAUCUUCCGCCA

SEQ ID No:8

GGAAGAUCUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCGCAGGUUCGAGUCCUGUGAUCUUCCGCCA

Further, the concrete base sequence of described heterozygosis tRNA also comprises, by in sequence 1-8 (SEQ ID No:1,2,3,4,5,6,7,8), the 62nd bit base G sports U, the 78th bit base U sports A and the 64th bit base A sports C, the 76th bit base U sports the novel heterozygosis tRNA of any one that G is formed, its sequence can be SEQ ID No:9,10,11,12,13,14,15,16.

SEQ ID No:9

GGAAGAUGUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCUCCGGUUCGAAUCCGGACAUCUUCCGCCA

SEQ ID No:10

GGAAGAUGUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCUCCGGUUCGACUCCGGACAUCUUCCGCCA

SEQ ID No:11

GGAAGAUGUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCUCCGGUUCGAUUCCGGACAUCUUCCGCCA

SEQ ID No:12

GGAAGAUGUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCUCCGGUUCGAGUCCGGACAUCUUCCGCCA

SEQ ID No:13

GGAAGAUCUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCUCCGGUUCGAAUCCGGAGAUCUUCCGCCA

SEQ ID No:14

GGAAGAUCUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCUCCGGUUCGACUCCGGAGAUCUUCCGCCA

SEQ ID No:15

GGAAGAUCUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCUCCGGUUCGAUUCCGGAGAUCUUCCGCCA

SEQ ID No:16

GGAAGAUCUGGCCGAGCGGUUGAAGGCACCGGUCUCUAAAACCGGCGACCCGAAAGGGUUCUCCGGUUCGAGUCCGGAGAUCUUCCGCCA

The application of heterozygosis tRNA of the present invention in the high vigor Sn bearing granite of preparation, comprises following 2 kinds of methods:

Method 1:

First synthesize the promotor of heterozygosis tRNA and upstream and downstream thereof and gene order corresponding to terminator, correct position beyond the multiple clone site being assembled into secretor type prokaryotic expression carrier, resynthesis or amplification need the target gene of expression and are assembled in the multiple clone site of this secretor type prokaryotic expression carrier, transform UAG and read over engineering bacteria (or common expression engineering bacteria), reading over UAG by heterozygosis tRNA is seleno-cysteine, thus the catalytic group seleno-cysteine of GPX is incorporated into substrate binding site by the mode entering peptide chain with conventional amino acid, the substrate binding site of existing GPX on expressed albumen, there are again catalytic group and the catalytic triads of GPX, result gives the activity of its high GPX, just create the Selenoperoxidase GPX of high vigor.

Method 2:

First synthesize the promotor of heterozygosis tRNA and upstream and downstream thereof and gene order corresponding to terminator, correct position beyond the multiple clone site being assembled into secretor type prokaryotic expression carrier, the GPX gene of expressing is needed again with the amplification of PCR method, be assembled in the multiple clone site of this secretor type prokaryotic expression carrier, and be TAG by transgenation method by the sequence encoding mutant of seleno-cysteine in GPX, transform UAG and read over engineering bacteria (or common expression engineering bacteria), reading over UAG by heterozygosis tRNA is seleno-cysteine, thus the catalytic group seleno-cysteine of GPX is incorporated into substrate binding site by the mode entering peptide chain with conventional amino acid, the substrate binding site of existing GPX on expressed albumen, there are again catalytic group and the catalytic triads of GPX, result gives the activity of its high GPX, just create the Selenoperoxidase GPX of high vigor.

First method of the present invention is first at encoding gene and the GPX gene of biotech firm's DNA synthesizer synthetic tRNA of the present invention, build up to can express tRNA and GPX gene Procaryon secreted expression carrier on, read in engineering bacteria C321. Δ A.exp (Addgene Cat.#49018) bacterial strain at UAG and synthesize and carry Sec to UAG codon place, what realize natural GPX directly reads over expression.

1), the structure of carrier: according to the base sequence SEQ ID No:1 of tRNA of the present invention, SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID No:6, SEQ ID No:7, SEQ ID No:8, SEQ ID No:9, SEQ IDNo:10, SEQ ID No:11, SEQ ID No:12, SEQ ID No:13, SEQ ID No:14, SEQ ID No:15 or SEQ IDNo:16, at biotech firm's encoding gene corresponding to DNA synthesizer synthetic, guarantee that 5 ' end of heterozygosis tRNA gene is containing lpp promoter sequence and specific restriction enzyme site, 3 ' end is containing rrnc terminator sequence and specific restriction enzyme site, express the secretor type prokaryotic expression carrier (as pCold series etc.) of this heterozygosis tRNA containing the heterozygosis tRNA gene and being used for of specific restriction enzyme site with identical restriction endonuclease cutting two ends, then beyond the multiple clone site by specific restriction enzyme site heterozygosis tRNA genome being installed to secretor type prokaryotic expression carrier with DNA ligase, described specific restriction enzyme site can be expression vector multiple clone site beyond sequence contain and any one restriction enzyme site non-existent in heterozygosis tRNA gene, be the intrinsic DNA sequence dna by the based composition of restriction endonuclease identification on carrier,

Goal gene sequence is that the encoding sequence of seleno-cysteine in the gene of GPX disclosed in gene library is replaced with the gene after amber stop codon TAG, at the encoding gene that biotech firm answers with this goal gene sequence pair of DNA synthesizer synthetic, guarantee that specific restriction enzyme site is all contained at two ends; With the GPX gene of identical restriction endonuclease cutting two ends containing specific restriction enzyme site and the secretor type prokaryotic expression carrier (as pCold-tRNA etc.) containing heterozygosis tRNA of upper step acquisition, then by specific restriction enzyme site, GPX genome is installed in the multiple clone site of this secretor type prokaryotic expression carrier with DNA ligase; Described specific restriction enzyme site can be contain in the multiple clone site of expression vector and any one restriction enzyme site non-existent in GPX gene, be the intrinsic DNA sequence dna by the based composition of restriction endonuclease identification on carrier;

2), the screening of positive transformant and the expression and purification of albumen:

By step 1) in build containing heterozygosis tRNA gene with encoding sequence in transform UAG containing the expression vector of the goal gene of TAG and read over the competent cell of engineering bacteria-C321. Δ A.exp (Addgene Cat.#49018), be coated with the nutrient agar plate containing ammonia benzyl resistance, screening positive strain; After positive transformant enlarged culturing, containing in the nutrient agar of Sodium Selenite, through IPTG low temperature 4-25 DEG C of abduction delivering, under the identification of heterozygosis tRNA, UAG is encoded to seleno-cysteine, directly give expression to the GPX mutant containing seleno-cysteine at the combining site of substrate GSH, zymoprotein is expressed with soluble form and is secreted in the pericentral siphon chamber of thalline; The bacterial strain that resistance screening obtains, after 37 DEG C of enlarged culturing, goes to 4-25 DEG C of abduction delivering; Under collection, washing, ice bath, ultrasonication thalline, release zymoprotein, centrifugal by liquid cryogen, removes bacterial sediment, obtains supernatant liquor; With gsh (GSH) affinitive layer purification GPX albumen, after dialysis freeze-drying, namely obtain high vigor GPX albumen sterling.Target protein is identified with denaturing polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot (Western blot).

The method is readed in prokaryotic expression system at UAG, carries Sec to UAG codon place by heterozygosis tRNA, introduces catalytic group, thus produce the GPX albumen of high vigor at the substrate binding site of restructuring GPX.

Described uses gsh (GSH) affinitive layer purification GPX albumen, is by pH7.5,50mmol/L Tris-Cl balance and wash-out foreign protein, with the buffer solution elution target protein containing 10mmol/L GSH.

Described is centrifugal by liquid cryogen, can at 4 DEG C, the centrifugal 15 ~ 30min of 8000 ~ 12000g.

Second method of the present invention is first at the encoding gene of biotech firm's DNA synthesizer synthetic tRNA of the present invention, recycling pcr amplification method obtains GPX encoding gene, after building up to the Procaryon secreted expression carrier expressing tRNA and GPX gene, be TAG by rite-directed mutagenesis by the sequence encoding mutant of seleno-cysteine in GPX gene, last reading in engineering bacteria C321. Δ A.exp (Addgene Cat.#49018) bacterial strain at UAG is synthesized and carries Sec to UAG codon place, and what realize natural GPX directly reads over expression.

1), the structure of expression vector:

According to the base sequence SEQ ID No:1 of tRNA of the present invention, SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, SEQ ID No:6, SEQ ID No:7, SEQ ID No:8, SEQ ID No:9, SEQ ID No:10, SEQ IDNo:11, SEQ ID No:12, SEQ ID No:13, SEQ ID No:14, SEQ ID No:15 or SEQ ID No:16, at biotech firm's encoding gene corresponding to DNA synthesizer synthetic, guarantee that 5 ' end of heterozygosis tRNA gene is containing lpp promoter sequence and specific restriction enzyme site, 3 ' end is containing rrnc terminator sequence and specific restriction enzyme site, express the secretor type prokaryotic expression carrier (as pCold series etc.) of this heterozygosis tRNA containing the heterozygosis tRNA gene and being used for of specific restriction enzyme site with identical restriction endonuclease cutting two ends, then beyond the multiple clone site by specific restriction enzyme site heterozygosis tRNA genome being installed to secretor type prokaryotic expression carrier with DNA ligase, described specific restriction enzyme site can be expression vector multiple clone site beyond sequence contain and any one restriction enzyme site non-existent in heterozygosis tRNA gene, be the intrinsic DNA sequence dna by the based composition of restriction endonuclease identification on carrier,

Disclosed in gene library, the gene order of GPX is (see NCBI, NM_000581.2, NM_002083.3, NM_002084.3, NM_002085.3 etc.) design primer, increase its encoding gene, when designing primer, guarantee that 5 ' end of gene is containing initiator codon (ATG), 3 ' end is containing terminator codon, and specific restriction enzyme site is all contained at two ends, and other aminoacid sequence is constant, with the secretor type prokaryotic expression carrier (as pCold-tRNA etc.) containing heterozygosis tRNA that identical restriction endonuclease cutting GPX gene and upper step obtain, then by specific restriction enzyme site, GPX genome is installed in the multiple clone site of this secretor type prokaryotic expression carrier with DNA ligase, keeping under the prerequisite that other aminoacid sequence is constant, according to two rite-directed mutagenesis primers of the complete isometric complementation of amino acid whose gene order design near seleno-cysteine unique in GPX and it, centered by the codon of seleno-cysteine, the long 25-50bp of primer, with rite-directed mutagenesis primer and Fast Fixed-point mutagenesis kit, be TAG by the sequence encoding mutant of the seleno-cysteine in the GPX gene be structured on prokaryotic expression carrier, and occur without other unexpected transgenation, guarantee that the gene after suddenling change can be readed in engineering strain at UAG and express GPX albumen of the present invention, described specific restriction enzyme site can be contain in the multiple clone site of expression vector and any one restriction enzyme site non-existent in GPX gene, be the intrinsic DNA sequence dna by the based composition of restriction endonuclease identification on carrier,

By step 1) in build containing heterozygosis tRNA gene with encoding sequence in transform UAG containing the expression vector of the goal gene of TAG and read over the competent cell of engineering bacteria-C321. Δ A.exp (Addgene Cat.#49018), be coated with the nutrient agar plate containing ammonia benzyl resistance, screening positive strain; After positive transformant enlarged culturing, containing in the nutrient agar of Sodium Selenite, through IPTG low temperature 4-25 DEG C of abduction delivering, UAG reads over engineering bacteria cannot stop UAG codon, under the identification of heterozygosis tRNA, UAG is encoded to seleno-cysteine, directly gives expression to the GPX containing seleno-cysteine at the combining site of substrate GSH, zymoprotein is expressed with soluble form and is secreted in the pericentral siphon chamber of thalline; The bacterial strain that resistance screening obtains, after 37 DEG C of enlarged culturing, goes to 4-25 DEG C of abduction delivering; Under collection, washing, ice bath, ultrasonication thalline, release zymoprotein, centrifugal by liquid cryogen, removes bacterial sediment, obtains supernatant liquor; With gsh (GSH) affinitive layer purification GPX albumen, after dialysis freeze-drying, namely obtain GPX albumen sterling.Target protein is identified with denaturing polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot (Western blot).

Described is centrifugal by liquid cryogen, can at 4 DEG C, the centrifugal 15-30min of 8000-12000g.

The present invention has following characteristics:

(1) the present invention uses the genetic engineering technique such as simple gene chemical synthesis or amplification, transgenation and prokaryotic expression, achieve the reactive site that seleno-cysteine is inserted into GPX by the mode identical with 20 kinds of conventional amino acid, preparation method is simple, solves natural GPX limited source, this difficult problem of preparation difficulty.

(2) the GPX protein vigor prepared of the inventive method is high; and composition sequence is identical with natural GPX; for human body, immunity or rejection can not occur, Cell Biology Experiment has confirmed there is stronger provide protection to the myocardial cell of Hydroperoxide injury.

(3) anti-oxidant vigor of GPX of the present invention is significantly higher than the vigor of the GPX mutant in the past reported.

(4) secreted expression carrier of the present invention's use, GPX albumen can be expressed with soluble form and be secreted into colibacillary pericentral siphon chamber, the targeting signal peptide of pilot protein secreting, expressing is excised automatically by thalline, expressed albumen is solubility, there is the space conformation of native protein and the activity of Geng Gao, do not need renaturation, the productive rate that renaturing inclusion bodies process can be avoided to cause declines and inactivation, thus with short production cycle.

(5) the present invention reads over engineering bacteria combined utilization by novel heterozygosis tRNA and UAG, the mode being entered peptide chain by conventional amino acid is realized the fixed point coding of seleno-cysteine at UAG codon place and inserts, thus efficiency and productive rate are readed in raising, therefore have the double dominant of efficient high yield.

These advantages are all conducive to scale operation, for practical application from now on lays a solid foundation, solve the problem that natural GPX source is not enough, character is unstable and vigor is low, have broad application prospects in bio-pharmaceuticals.

Accompanying drawing illustrates:

The SDS-PAGE of Fig. 1: the embodiment 1-9 GPX1 prepared and (on) and Western blot (under) result: wherein M is molecular weight of albumen Marker, 1-9 swimming lane is target protein prepared by embodiment 1-9.

The SDS-PAGE of Fig. 2: the embodiment 10-18 GPX1 prepared and (on) and Western blot (under) result: wherein M is molecular weight of albumen Marker, 10-18 swimming lane is target protein prepared by embodiment 10-18.

Embodiment

Embodiment 1: read over prokaryotic expression system by the heterozygosis tRNA sequence 1 of synthesizing and target gene combined U AG and prepare genetically engineered people GPX1 albumen

TRNA base sequence according to sequence 1 (SEQ ID No:1) of the present invention, the gene of expressed sequence 1 (SEQ ID No:1) described heterozygosis tRNA in engineering strain can be readed at UAG at biotech firm's DNA synthesizer synthetic, guarantee that 5 ' end of heterozygosis tRNA gene is containing lpp promoter sequence and ClaI restriction enzyme site, 3 ' end is containing rrnc terminator sequence and ClaI restriction enzyme site (sequence is as follows)

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATGTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCGCAGGTTCGAATCCTGTCATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

After gene with restriction endonuclease ClaI single endonuclease digestion heterozygosis tRNA, be connected to (TAKARA on the same pCold III carrier using ClaI single endonuclease digestion, Cat.#3369, ClaI is the Individual existence restriction enzyme site beyond pCold III multiple clone site, insert exogenous array at this place and do not affect other functions of carrier itself), the carrier obtained is pCold III-tRNA.

Can read at UAG the GPX1 gene reading over expression in engineering strain (C321. Δ A.exp) at biotech firm's DNA synthesizer synthetic, guarantee that its 5 ' end is containing initiator codon (ATG) and EcoR I restriction enzyme site, 3 ' end is containing terminator codon and HindIII restriction enzyme site, the encoding sequence TGA of its 49th Sec replaces with amber stop codon (TAG), after restriction endonuclease EcoR I and Hind III double digestion, be connected on pCold III-tRNA carrier that same enzyme cuts, the plasmid of structure is pColdIII-tRNA-GPx1.

Transform with the carrier (pCold III-tRNA-GPx1) that heterozygosis tRNA and GPX1 gene are housed the competent cell that UAG reads over engineering bacteria C321. Δ A.exp, be coated with the nutrient agar plate containing 100 μ g/mL Amp, screening positive strain.Be inoculated in by positive transformant in 1.2L nutrient agar (containing 100 μ g/mL penbritins and 50uM Sodium Selenite), in 37 DEG C of airbaths, 160rpm concussion is cultured to OD600 is 0.5.Bacterium liquid is placed in 30 DEG C of low temperature shaking table 80rpm and shakes cultivation 5h, adding final concentration is afterwards 0.1mmol/L IPTG, 30 DEG C of shaking culture 5h, and GPX1 albumen is expressed in the pericentral siphon chamber of thalline with soluble form.Collect thalline (6000rpm, 10min) and wash twice with isopyknic damping fluid T (50mM Tris buffer, pH7.5, containing 1mMEDTA).With the resuspended bacterial sediment of damping fluid T, add the PMSF (phenylmethylsulfonyl fluoride) of final concentration 1mM, ultrasonication thalline, 4 DEG C, the centrifugal 30min of 12000rpm, collect supernatant.By specification process GSH affinity post, application damping fluid (50mmol/L Tris, pH7.5) balance, adds on GSH affinity post, with level pad wash-out foreign protein, with 10mmol/LGSH wash-out target protein by supernatant liquor.By elutriant dialysis also freeze-drying, obtain people GPX1 albumen.Target protein is identified with denaturing polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot (Western blot), its molecular weight is 21.9kDa, and be combined with anti-GPX1 antibodies specific, prove to have successfully been obtained target protein, see the 1st swimming lane of Fig. 1.Its GPX vigor is 27291U/umol albumen, higher than the GPX mutant reported in the past.

Embodiment 2-16:

Read over prokaryotic expression system with the heterozygosis tRNA sequence 2-16 synthesized and target gene combined U AG and prepare genetically engineered people GPX1 albumen.Concrete grammar tRNA base sequence just respectively according to of the present invention sequence 2-16 (SEQ ID No:2-16) identical with embodiment 1, the gene of expressed sequence 2-16 in engineering strain (SEQ IDNo:2-16) described heterozygosis tRNA can be readed at UAG at biotech firm's DNA synthesizer synthetic, guarantee that 5 ' end of heterozygosis tRNA gene is containing lpp promoter sequence and ClaI restriction enzyme site, 3 ' end containing rrnc terminator sequence and ClaI restriction enzyme site, the concrete gene order sequence of synthesis respectively:

The gene order of the tRNA base sequence can expressed described in SEQ ID No:2 of the 2-in-1 one-tenth of embodiment is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATGTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCGCAGGTTCGACTCCTGTCATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

The gene order of the tRNA base sequence can expressed described in SEQ ID No:3 that embodiment 3 is synthesized is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATGTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCGCAGGTTCGATTCCTGTCATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

The gene order of the tRNA base sequence can expressed described in SEQ ID No:4 that embodiment 4 is synthesized is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATGTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCGCAGGTTCGAGTCCTGTCATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

The gene order of the tRNA base sequence can expressed described in SEQ ID No:5 that embodiment 5 is synthesized is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATCTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCGCAGGTTCGAATCCTGTGATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

The gene order of the tRNA base sequence can expressed described in SEQ ID No:6 that embodiment 6 is synthesized is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATCTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCGCAGGTTCGACTCCTGTGATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

The gene order of the tRNA base sequence can expressed described in SEQ ID No:7 that embodiment 7 is synthesized is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATCTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCGCAGGTTCGATTCCTGTGATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

The gene order of the tRNA base sequence can expressed described in SEQ ID No:8 that embodiment 8 is synthesized is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATCTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCGCAGGTTCGAGTCCTGTGATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

The gene order of the tRNA base sequence can expressed described in SEQ ID No:9 that embodiment 9 is synthesized is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATGTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCTCCGGTTCGAATCCGGACATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

The gene order of the tRNA base sequence can expressed described in SEQ ID No:10 that embodiment 10 is synthesized is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATGTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCTCCGGTTCGACTCCGGACATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

The gene order of the tRNA base sequence can expressed described in SEQ ID No:11 that embodiment 11 is synthesized is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATGTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCTCCGGTTCGATTCCGGACATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

The gene order of the tRNA base sequence can expressed described in SEQ ID No:12 that embodiment 12 is synthesized is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATGTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCTCCGGTTCGAGTCCGGACATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

The gene order of the tRNA base sequence can expressed described in SEQ ID No:13 that embodiment 13 is synthesized is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATCTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCTCCGGTTCGAATCCGGAGATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

The gene order of the tRNA base sequence can expressed described in SEQ ID No:14 that embodiment 14 is synthesized is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATCTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCTCCGGTTCGACTCCGGAGATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

The gene order of the tRNA base sequence can expressed described in SEQ ID No:15 that embodiment 15 is synthesized is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATCTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCTCCGGTTCGATTCCGGAGATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

The gene order of the tRNA base sequence can expressed described in SEQ ID No:16 that embodiment 16 is synthesized is:

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGTAACGCTGAATTCGGAAGATCTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCGGCGACCCGAAAGGGTTCTCCGGTTCGAGTCCGGAGATCTTCCGCCAGGATCCTCTAGAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG；

GPX1 albumen prepared by embodiment 2-16 is shown in the 2-16 swimming lane of Fig. 1 and 2.Its GPX vigor is respectively 26321,26752,27036,26058,26259,27003,26698,26782,26863,26089,26563,26259,26356,26932,27251U/umol, higher than the GPX mutant reported in the past.

Embodiment 17: read over prokaryotic expression system with the heterozygosis tRNA of synthesis and the target gene combined U AG of PCR method amplification and prepare genetically engineered people GPX1 albumen.

CCATCGATCCCATCAAAAAAATATTCTCAACATAAAAAACTTTGTGTAATACTTGT AACGCTGAATTCGGAAGATGTGGCCGAGCGGTTGAAGGCACCGGTCTCTAAAACCG GCGACCCGAAAGGGTTCGCAGGTTCGAATCCTGTCATCTTCCGCCAGGATCCTCTA GAGTCGACCTGCAGATCCTTAGCGAAAGCTAAGGATTTTTTTT ATCGATGG; After restriction endonuclease ClaI single endonuclease digestion, (TAKARA on the pCold III carrier being connected to same ClaI single endonuclease digestion, Cat.#3369, ClaI is the Individual existence restriction enzyme site beyond pCold III multiple clone site, insert exogenous array at this place and do not affect other functions of carrier itself), the carrier obtained is pColdIII-tRNA.

With mRNA Mini Kit (Sigma, Cat#MRN-10) from people HepG-2 (DSMZ#ACC 180) liver cancer cell, mRNA is extracted, at reversed transcriptive enzyme (AMV RT, Promega, Cat#M5101) and oligo (dT) exist under, be transcribed into cDNA by RT-PCR (RT-polymerase chain reaction).Disclosed in gene library, the gene of people GPX1 is (see NCBI, NM_000581.2) primers increases its encoding gene, guarantee that 5 ' end of gene is containing initiator codon (ATG) and Nde I restriction enzyme site, 3 ' end is containing terminator codon and Hind III digestion site; 5 ' concrete end primer is 5 '-GGAATTCCATATGGCTGCTGCTCGGC-3 ', and 3 ' end primer is 5 '-CCCAAGCTTCTAGGCAGCGCTGGGC-3 '.After restriction endonuclease Nde I and Hind III double digestion, be connected on pCold III (TAKARA, the Cat.#3369) carrier that same enzyme cuts with DNA ligase, be designated as pCold III-tRNA-GPx1.Keeping under the prerequisite that other aminoacid sequence is constant, according to two rite-directed mutagenesis primers of the complete isometric complementation of amino acid whose gene order design near No. 49 Sec in GPX1, the long 25-50bp of primer, centered by the codon of No. 49 Sec (TGA).With primer and Fast Fixed-point mutagenesis kit (the Invitrogen company of these two complete complementaries, by the operation of test kit specification sheets), the encoding sequence TGA of the GPX1 gene be structured on prokaryotic expression carrier pCold III No. 49 Sec is sported amber codon (TAG), determine to suddenly change successfully by DNA sequencing, and occur without other unexpected transgenation.

Transform with the carrier (pCold III-tRNA-GPx1) that heterozygosis tRNA and GPX1 gene are housed the competent cell that UAG reads over engineering bacteria C321. Δ A.exp, be coated with the nutrient agar plate containing 100 μ g/mL Amp, screening positive strain.Be inoculated in by positive transformant in 1.2L nutrient agar (containing 100 μ g/mL penbritins and 50uM Sodium Selenite), in 37 DEG C of airbaths, 160rpm concussion is cultured to OD600 is 0.6.Bacterium liquid is placed in 30 DEG C of low temperature shaking table 80rpm and shakes cultivation 5h, adding final concentration is afterwards 0.1mmol/L IPTG, 30 DEG C of shaking culture 5h, and GPX1 albumen is expressed in the pericentral siphon chamber of thalline with soluble form.Collect thalline (6000rpm, 10min) and wash twice with isopyknic damping fluid T (50mM Tris buffer, pH7.5, containing 1mMEDTA).With the resuspended bacterial sediment of damping fluid T, add the PMSF (phenylmethylsulfonyl fluoride) of final concentration 1mM, ultrasonication thalline, 4 DEG C, the centrifugal 30min of 12000rpm, collect supernatant.By specification process GSH affinity post, application damping fluid (50mmol/L Tris, pH7.5) balance, adds on GSH affinity post, with level pad wash-out foreign protein, with 10mmol/LGSH wash-out target protein by supernatant liquor.By elutriant dialysis also freeze-drying, obtain people GPX1 albumen.Target protein is identified with denaturing polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot (Western blot), its molecular weight is 21.9kDa, and be combined with anti-GPX1 antibodies specific, prove to have successfully been obtained target protein, see the 17th swimming lane of Fig. 2.Its GPX vigor is 26675U/umol, higher than the GPX mutant reported in the past.

Embodiment 18:

Remove expression vector pCold III (TAKARA used for embodiment 1, Cat.#3369) pColdI (TAKARA of band Histidine purification tag is changed into, Cat.#3367), all the other are identical with embodiment 1, namely obtain the GPX1 albumen of tape label the most at last.This albumen introduces 16 exogenous amino acids carrier comprising 6 Histidines at aminoterminal, therefore molecular weight comparatively embodiment 1 increase to some extent, SDS-PAGE and Western Blot result can be seen, see the 18th swimming lane of Fig. 2, its advantage also can use nickel affinity chromatography target protein.Its GPX vigor is 25623U/ μm of ol, a little less than embodiment 1, proves that the vigor of purification tag to albumen does not have a significant effect, higher than the GPX mutant reported in the past.

Claims

1. a heterozygosis tRNA, is characterized in that: its nucleotide sequence is as shown in SEQ ID No:1.

2. a heterozygosis tRNA, is characterized in that: its nucleotide sequence is as shown in SEQ ID No:2, SEQ ID No:3 or SEQ ID No:4.

3. a heterozygosis tRNA, is characterized in that: its nucleotide sequence is as shown in SEQ ID No:5, SEQ ID No:6, SEQ ID No:7 or SEQ ID No:8.

4. a heterozygosis tRNA, is characterized in that: its nucleotide sequence is as shown in SEQ ID No:9, SEQ ID No:10, SEQ IDNo:11 or SEQ ID No:12.

5. a heterozygosis tRNA, is characterized in that: its nucleotide sequence is as shown in SEQ ID No:13, SEQ ID No:14, SEQ IDNo:15 or SEQ ID No:16.

6. the heterozygosis tRNA of claim 1-5 described in any one is preparing the application in Selenoperoxidase.

7. heterozygosis tRNA as claimed in claim 6 is preparing the application in Selenoperoxidase, it is characterized in that: the step of application is as follows,

1), the structure of carrier

According to the base sequence SEQ ID No:1 of tRNA, SEQ ID No:2, SEQ ID No:3, SEQ ID No:4, SEQID No:5, SEQ ID No:6, SEQ ID No:7, SEQ ID No:8, SEQ ID No:9, SEQ ID No:10, SEQ IDNo:11, SEQ ID No:12, SEQ ID No:13, SEQ ID No:14, SEQ ID No:15 or SEQ ID No:16, at biotech firm's encoding gene corresponding to DNA synthesizer synthetic, guarantee that 5 ' end of heterozygosis tRNA gene is containing lpp promoter sequence and specific restriction enzyme site, 3 ' end is containing rrnc terminator sequence and specific restriction enzyme site, express the secretor type prokaryotic expression carrier of this heterozygosis tRNA containing the heterozygosis tRNA gene and being used for of specific restriction enzyme site with identical restriction endonuclease cutting two ends, then beyond the multiple clone site by specific restriction enzyme site heterozygosis tRNA genome being installed to secretor type prokaryotic expression carrier with DNA ligase,

Goal gene sequence is that the encoding sequence of seleno-cysteine in the gene of GPX disclosed in gene library is replaced with the gene after amber stop codon TAG, at the encoding gene that biotech firm answers with this goal gene sequence pair of DNA synthesizer synthetic, guarantee that specific restriction enzyme site is all contained at two ends; With the GPX gene of identical restriction endonuclease cutting two ends containing specific restriction enzyme site and the secretor type prokaryotic expression carrier containing heterozygosis tRNA of upper step acquisition, then by specific restriction enzyme site, GPX genome is installed in the multiple clone site of this secretor type prokaryotic expression carrier with DNA ligase;

2), the screening of positive transformant and the expression and purification of albumen

By step 1) in build containing heterozygosis tRNA gene with encoding sequence in transform UAG containing the expression vector of the goal gene of TAG and read over the competent cell of engineering bacteria-C321. Δ A.exp, be coated with the nutrient agar plate containing ammonia benzyl resistance, screening positive strain; After positive transformant enlarged culturing, containing in the nutrient agar of Sodium Selenite, through IPTG low temperature 4-35 DEG C of abduction delivering, under the identification of heterozygosis tRNA, UAG is encoded to seleno-cysteine, directly give expression to the GPX containing seleno-cysteine at the combining site of substrate GSH, zymoprotein is expressed with soluble form and is secreted in the pericentral siphon chamber of thalline; The bacterial strain that resistance screening obtains, after 37 DEG C of enlarged culturing, goes to 4-35 DEG C of abduction delivering; Under collection, washing, ice bath, ultrasonication thalline, release zymoprotein, centrifugal by liquid cryogen, removes bacterial sediment, obtains supernatant liquor; With gsh GSH affinitive layer purification GPX albumen, after dialysis freeze-drying, namely obtain high vigor GPX albumen sterling.

8. heterozygosis tRNA as claimed in claim 6 is preparing the application in Selenoperoxidase, it is characterized in that: the step of application is as follows,

1), the structure of expression vector

The gene order design primer of GPX disclosed in gene library, increase its encoding gene, when designing primer, guarantee that 5 ' end of gene is containing initiator codon ATG, 3 ' end is containing terminator codon, and specific restriction enzyme site is all contained at two ends, and other aminoacid sequence is constant, with the secretor type prokaryotic expression carrier containing heterozygosis tRNA that identical restriction endonuclease cutting GPX gene and upper step obtain, then by specific restriction enzyme site, GPX genome is installed in the multiple clone site of this secretor type prokaryotic expression carrier with DNA ligase, keeping under the prerequisite that other aminoacid sequence is constant, according to two rite-directed mutagenesis primers of the complete isometric complementation of amino acid whose gene order design near seleno-cysteine unique in GPX and it, centered by the codon of seleno-cysteine, the long 25-50bp of primer, with rite-directed mutagenesis primer and Fast Fixed-point mutagenesis kit, be TAG by the sequence encoding mutant of the seleno-cysteine in the GPX gene be structured on prokaryotic expression carrier, and occur without other unexpected transgenation, guarantee that the gene after suddenling change can be readed in engineering strain at UAG and express GPX albumen of the present invention, described specific restriction enzyme site can be contain in the multiple clone site of expression vector and any one restriction enzyme site non-existent in GPX gene, be the intrinsic DNA sequence dna by the based composition of restriction endonuclease identification on carrier,

By step 1) in build containing heterozygosis tRNA gene with encoding sequence in transform UAG containing the expression vector of the goal gene of TAG and read over the competent cell of engineering bacteria-C321. Δ A.exp, be coated with the nutrient agar plate containing ammonia benzyl resistance, screening positive strain; After positive transformant enlarged culturing, containing in the nutrient agar of Sodium Selenite, through IPTG low temperature 4-35 DEG C of abduction delivering, under the identification of heterozygosis tRNA, UAG is encoded to seleno-cysteine, directly give expression to the GPX containing seleno-cysteine at the combining site of substrate GSH, zymoprotein is expressed with soluble form and is secreted in the pericentral siphon chamber of thalline; The bacterial strain that resistance screening obtains, after 37 DEG C of enlarged culturing, goes to 4-35 DEG C of abduction delivering; Under collection, washing, ice bath, ultrasonication thalline, release zymoprotein, centrifugal by liquid cryogen, removes bacterial sediment, obtains supernatant liquor; With gsh GSH affinitive layer purification GPX albumen, after dialysis freeze-drying, namely obtain GPX albumen sterling.