KR101844650B1 - Gene for coding the protein containing repetitive alanine sequence, recombinant vector comprising the gene and process for the protein using the same - Google Patents

Abstract

The present invention relates to a gene encoding a protein having an alanine repeat sequence occupying 60% or more of an alanine amino acid, a recombinant vector containing the same, and a method for producing a protein using the recombinant vector.
According to the present invention, since a protein having an alanine repeat sequence occupying more than 60% of alanine amino acid in a bacterial Escherichia coli can be mass-produced efficiently and the protein produced is also highly active, And can be widely used throughout the industry.

Description

A recombinant vector comprising the same, and a method for producing a protein using the same, wherein the alanine amino acid sequence is repeated, a recombinant vector comprising the gene,

The present invention relates to a method for producing a protein having an alanine repeat sequence, and more particularly, to a gene encoding a protein having an alanine repeat sequence, wherein the bacterial Escherichia coli host cell comprises more than 60% of alanine amino acid And a protein production method using the recombinant vector.

Escherichia coli is most commonly used as a strain for producing recombinant proteins, since the protein production system is best understood by many research results accumulated over a long period of time, and it is easy to handle and industrially cultivated at a relatively low cost. However, in the case of Escherichia coli, the production yield of a repetitive protein having a sequence of amino acid repeats by high-concentration fermentation is about 140 to 360 mg / L depending on the protein size due to the limitation of translation apparatus for protein synthesis (Fahnestock SR et al. Reviews in Molecular Biotechnology, 74: 105,1997).

To date, the production of repetitive proteins in E. coli, especially high molecular weight, repetitive sequence proteins, which determine the mechanical properties of polymers, has several difficulties (Huang et al., J Biol Chem, 278 Protein Expres Purif, 7: 400, 1996; Tsung et al., J Biol Chem, 264 (8): 4428, 1989).

Such repetitive sequence proteins are often produced in a low activity form, and are degraded by protein proteases of cells, leading to a decrease in productivity. In particular, when the repetitive sequence protein is an antimicrobial peptide histonein (Kim et al., 2008), it has a great difficulty in production because it is fatal to the production strain. Therefore, the production of such a repeated amino acid sequence requires a new approach because many factors are complexly intertwined, making it difficult to solve the problem with extremely limited genes or proteins through conventional molecular biology techniques

The present inventors have made efforts to develop a method for producing a specific amino acid repeat sequence protein in Escherichia coli at a high yield. As a result, it has been found that when the alanine amino acid repeat protein is produced in Escherichia coli, the gene of the alanine repeat protein is replaced with the gene codon of the Escherichia coli host cell It was confirmed that the yield of alanine repeat protein can be improved by optimizing the GC nucleotide sequence content ratio, and the present invention has been completed.

Accordingly, it is an object of the present invention to provide a gene encoding a protein having an alanine repeat sequence, a recombinant vector containing the same, and a method for producing a protein using the recombinant vector.

In order to achieve the above object, the present invention provides a gene coding for a protein in which an alanine amino acid sequence consisting of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 is repeated.

Here, the protein is preferably an anti-freezing protein.

In the present invention, a recombinant vector containing the gene is provided.

Here, it is preferable that the recombinant vector expresses an anti-freezing protein in the form of a multimer complex including a plurality of the genes.

According to the present invention, there is also provided a method of producing a gene, comprising: (a) preparing a vector comprising the gene; And (b) introducing the vector into Escherichia coli and culturing the same.

Here, after the step (b), (c) a step of disrupting the cultured Escherichia coli cells and centrifuging them; And (d) collecting the centrifuged supernatant and passing it through a nickel column.

According to the present invention, it is possible to efficiently mass-produce a protein having an alanine repeat sequence occupying 60% or more of the alanine amino acid in Escherichia coli , which is a bacterium, and the produced alanine repeat sequence protein is highly active, And can be widely used throughout the industry.

Brief Description of the Drawings Fig. 1 is an overall configuration diagram of a recombinant vector pEQEHanN according to the present invention.
FIG. 2 is an SDS-PAGE image of monomer anti-freezing proteins Han1 and Han2 produced using the monomer expression vector produced by the present invention.
FIG. 3 is an SDS-PAGE photograph showing that monomeric anti-freezing proteins Han1 and Han2 produced using the monomer expression vector produced by the present invention exist in a water-soluble form.
4 is an SDS-PAGE photograph of monomer freezing protein Han1 purified using a nickel (Ni) column.
FIG. 5 is an SDS-PAGE photograph of Han1-t and Han2-t, which are mating anti-freezing proteins produced using a tetramer expression vector produced by the present invention.

Hereinafter, the present invention will be described in detail.

First, terms used in the present invention are defined as follows. In the present invention, 'specific amino acid repetitive protein' refers to a protein having a specific amino acid content in comparison with the average amino acid composition in E. coli. For example, 'alanine repetitive protein' was defined as the protein in which amino acid composition of alanine was more than 50% and occupied the most.

Since many antioxidant proteins can regulate the formation of ice crystals, studies are underway to develop applications in biotechnology and medicine, such as developing fish species resistant to low temperatures and preserving organs for transplantation. Efforts are being made worldwide for the use of antioxidant proteins extracted from the poles for food storage, cryosurgery in medicine, stem cells, oocytes, organs, and blood mains.

Conventional anti-icing proteins have the disadvantage of mass production limitations because they are extracted from polar animals with limited resources. A system for producing anti-freezing protein secreted out of E. coli cells has been developed, but the amount of secreted protein is as low as 10-20 mg / L (Lin et al., 1999). A variety of antifreeze proteins exist in the organisms on Earth, revealing one type of antifreeze glycoproteins (AFGPs) and four types of anti-icing proteins (type I to IV) (Harding et al., 2003). Of these, type I is the most structurally known. Alanine occupies more than 60% and has an α-helix structure (Harding et al., 1999; Harding et al., 2003).

In the present invention, anti-freezing protein was selected as an alanine repetitive sequence protein to chemically synthesize genes encoding a customized anti-freezing protein optimized for an Escherichia coli producing strain, and the expression system of monomeric or polyprotein anti-freezing proteins was produced, Successfully produced anti-freezing protein. In particular, the expression of a protein having an alanine repeat sequence can be markedly increased.

Example 1 Synthesis of Genes Encoding Custom Anti-Frozen Proteins Optimized for E. coli Host Cells

The alanine repeat sequence protein selected in the present invention is a type I anti-icing protein, which occupies more than 60% of the alanine amino acid. When a gene coding for the original anti-freezing protein that has not changed codons in the Escherichia coli producing strain is used, Is relatively small. To solve this problem, we optimized the nucleotide sequence of the anti - icing protein gene by controlling the gene codon and GC nucleotide sequence content, which are frequently used in E. coli.

Using the computer-based OptmumGene ^™ Codon Optimization Analysis, genes for anti-icing proteins were modified to alter the AFP gene sequence by modifying codon usage bias and GC nucleotide sequences optimized for E. coli host cells, A gene encoding anti-icing protein was obtained and the optimized results are shown in Table 1 below.

Genes encoding optimized anti-icing proteins Name Source Optimized DNA sequence

SEQ ID NO: 1:
Han1 Myoxocephalus octodecemspinosus longhorn sculpin skin-type antifreeze protein
(Low et al., 2001)
ATGGATGCCCCGGCGAAAGCGGCCGCAAAAACCGCTGCGGATGCCAAAGCCGCAGCTGCGAAAACGGCCGCAGACGCACTGGCTGCGGCCAACAAAACCGCAGCTGCGGCCAAAGCAGCTGCAAAATAA (129 bp)


SEQ ID NO: 2:
Han2 Winter flounder Pseudopleuronectes americanus antifreeze protein (Pickett et al., 1984)
GATACCGCGAGTGACGCCGCAGCTGCGGCCGCACTGACGGCTGCGAACGCCAAAGCCGCAGCTGAACTGACCGCAGACAATGCGGCCGCAGCTGCCGCAGCGACGGCGCGCGGTTAA (117 bp)

From the viewpoint of high-efficiency gene expression, the Codon Adapation Index (CAI) of 0.9 or more is very good. However, the nucleotide sequence of anti-freezing proteins is composed of tandem rare codons, which are able to reduce translation efficiency. Anti-icing protein Han1 altered the codon usage bias in E. coli by improving the base sequence from 0.7 to 0.83 in the Codon Adapation Index (CAI). The GC content is in the optimal percentage range of 30-70%. The base sequence before optimization was 72.60%, but after optimization, it changed to 65.40%. The anti-icing protein Han2 altered the codon usage bias in E. coli by improving the base sequence from CAI (Codon Adapation Index) of 0.64 to 0.84. The GC content was 67.51% before the optimization, but changed to 68.24% after optimization.

Example 2: Construction of expression vector of anti-freezing protein in monomer form

For the production of anti-freezing protein, the overall structure of the expression vector is shown in Fig. His-tag labeling was used to easily purify the produced target protein with high purity. First, in order to prepare a monomer-type anti-icing protein expression vector, Han 1 and Han 2 having a nucleotide sequence coding for the anti-icing protein optimized in Example 1 were chemically synthesized. Han 1 was used as a template, Han 2 was used as a primer in SEQ ID NOS: 5 and 6, and PCR (first denaturation at 95 ° C for 5 minutes, second denaturation at 95 ° C for 30 seconds, hybridization at 55 ° C 1 Min, extension 72 ° C for 1 minute 30 seconds, 30 times repeated).

The primers used in the expression system of anti- Primer name Oligonucleotide sequence SEQ ID NO: 3: Han 1-F-KpnI CGG GGTACC ATGGATGCCCCGGCGAAA (27 mer) SEQ ID NO: 4: Han 1-R-Hin III AAAA AAGCTT TTATTTTGCAGCTGCTTTGGC (31 mer) SEQ ID NO: 5: Han 2-F-KpnI CGG GGTACC GATACCGCGAGTGACGCCG (28 mer) SEQ ID NO: 6: Han 2-R-Hin III AAAA AAGCTT TTAACCGCGCGCCGTCG (27 mer)

In a fragment obtained by the PCR in agarose gel electrophoresis Han 1 is about 129 bp, Han 2 is separated a DNA fragment of 117 bp in size, and restriction enzyme was cut out with Kpn I and Hin dIII. Plasmid was pQE30 (Qiagen, USA) also connects with the same restriction enzymes Kpn I and Hin dIII cut DNA fragment obtained by the obtained recombinant plasmid, and transformed by introducing into the E. coli XL1-Blue by heat shock (heat shock) methods: , And ampicillin (50 占 퐂 / L), respectively, from which recombinant plasmids pEQEHanN (pEQEHan 1 and pEQEHan 2) were successively obtained. The selected transformed E. coli strains were cultured in LB liquid medium supplemented with ampicillin and stored in a -80 ° C freezer.

Example 3: Production and purification of anti-freezing protein in monomer form

Transformants XL1-Blue (pOptHan 1) and XL1-Blue (pOriHan 2) prepared in Example 2 were inoculated again in a 250-mL Erlenmeyer flask containing 100 mL of LB liquid medium supplemented with ampicillin (50 μg / L) And cultured at 37 ° C. Gene expression was induced by addition of 1 mM IPTG when the absorbance measured at 600 nm wavelength was 0.6 with a spectrophotometer. After 5 hours of induction of expression, the culture was centrifuged at 4 ° C and 6000 rpm for 5 minutes to obtain cells, and the production of anti-freezing protein was confirmed by 15% SDS-polyacrylamide gel (SDS-PAGE). As a result, it was possible to efficiently produce anti-freezing protein having an alanine repeat sequence optimized for the base sequence (FIG. 2). As shown in FIG. 3, almost all of the Han 1 and Han 2 proteins were found to be soluble in water (soluble form or insoluble form) there was.

The anti-freezing protein was purified using Ni-NTA Spin Kit (Qiagen, USA). Han 1-producing cells were obtained by the above method, and then suspended in Lysis Buffer (50 mM NaH ₂ PO ₄ , 300 mM NaCl, 10 mM imidazole, pH 8.0) and disrupted by ultrasonication. The supernatant was collected by centrifugation at 10,000 rpm for 20 minutes at 4 ° C, passed through a Ni-NTA spin column (Qiagen, USA), and centrifuged at 2,000 rpm for 2 minutes. 600 μl Wash Buffer (50 mM NaH ₂ PO ₄ , 300 mM NaCl, 20 mM imidazole, pH 8.0) was passed twice through the column and eluted with 200 μl Elution Buffer (50 mM NaH ₂ PO ₄ , 300 mM NaCl, 500 mM imidazole, pH 8.0) was added to the column to purify the anti-freezing protein and confirmed by 15% SDS-PAGE (FIG. 4). As a result, it was possible to obtain Han 1 of almost 100% purity.

Example 4: Construction and production of expression vector of multimeric anti-ice protein

In the present invention, an anti-freezing protein in the form of a monomer is prepared in the form of a polyol to increase protein productivity and improve the efficiency of purification. In addition, experts predict that the super-molecular weight of AFP will have a high anti-icing function, and there is no report yet to be produced in the form of an active multimeric form. Therefore, the anti-freezing protein was produced in the form of a multimeric form and successfully produced anti-freezing protein.

Han 1 and Han 2, which are synthetic anti-freezing proteins having optimized gene sequences, were designed in the form of a 4-mer as shown in FIG. 1, artificially synthesized through gene synthesis, As in Example 2, DNA was amplified and inserted into an expression vector to prepare multimeric expression systems pEQEHan1-t and pEQEHan2-t. Escherichia coli producing strains were transformed and selected.

As a result, it was confirmed that 4-mer anti-freezing protein was successfully produced (Fig. 5). In order to select the best E. coli producing strains, E. coli XL1-Blue, M15 and SG13009 were tested for anti-icing protein expression. As a result, it was found that M15 and SG13009 strains were more suitable for producing polyunsaturated antioxidant protein than E. coli XL1-Blue.

Having described specific portions of the present invention in detail, those skilled in the art will appreciate that these specific embodiments are merely preferred embodiments and are not to be construed as limiting the scope of the present invention. The scope of which is defined by the appended claims and their equivalents.

K: restriction enzyme Kpn I H: restriction enzyme Hin dIII
n: Number of gene repetitions that encode anti-freezing protein
Arrow (◀): Target protein
S: soluble form I: insoluble form
E1: first elution E2: second elution

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION OF DONGYANG UNIVERSITY <120> gene for coding the protein containing repetitive domain          sequence, recombinant vector comprising the gene and process for          the protein using the same <130> P14-B111 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 129 <212> DNA <213> Myoxocephalus octodecemspinosus longhorn sculpin <400> 1 atggatgccc cggcgaaagc ggccgcaaaa accgctgcgg atgccaaagc cgcagctgcg 60 aaaacggccg cagacgcact ggctgcggcc aacaaaaccg cagctgcggc caaagcagct 120 gcaaaataa 129 <210> 2 <211> 117 <212> DNA <213> Winter flounder Pseudopleuronectes americanus <400> 2 gataccgcga gtgacgccgc agctgcggcc gcactgacgg ctgcgaacgc caaagccgca 60 gctgaactga ccgcagacaa tgcggccgca gctgccgcag cgacggcgcg cggttaa 117 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 cggggtacca tggatgcccc ggcgaaa 27 <210> 4 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 aaaaaagctt ttattttgca gctgctttgg c 31 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 cggggtaccg ataccgcgag tgacgccg 28 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 aaaaaagctt ttaaccgcgc gccgtcg 27

Claims (6)

A gene encoding a protein in which an alanine amino acid sequence consisting of the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 is repeated. The gene according to claim 1, wherein the protein is an anti-freezing protein. A recombinant vector comprising the gene of claim 1. The method of claim 3,
Wherein the recombinant vector comprises a plurality of genes of claim 1 and expresses an anti-freezing protein in the form of a polyol. A method for producing a protein in which an alanine amino acid sequence is repeated,
(a) producing the vector of claim 4; And
(b) introducing the vector into Escherichia coli and culturing it. 6. The method of claim 5, wherein after the step (b)
(c) disrupting the cultured Escherichia coli cells and centrifuging them; And
(d) collecting the centrifuged supernatant and passing it through a nickel column.

Images