CN104928295A - Rice seedling stage cold inducible expression promoter POscold7 - Google Patents
Rice seedling stage cold inducible expression promoter POscold7 Download PDFInfo
- Publication number
- CN104928295A CN104928295A CN201510324979.2A CN201510324979A CN104928295A CN 104928295 A CN104928295 A CN 104928295A CN 201510324979 A CN201510324979 A CN 201510324979A CN 104928295 A CN104928295 A CN 104928295A
- Authority
- CN
- China
- Prior art keywords
- nucleotide sequence
- poscold7
- seq
- rice
- cold
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a rice seedling stage cold inducible expression promoter POscold7 and the application thereof. The promoter treats sequences in SEQ ID No: 1 and 2 in a sequence listing as basic sequences, and on the basis, expansion is conducted. The promoter comprises all variants of the two sequences, in particular to sequences having the promoter function in the all variants. An expression cassette containing the rice seedling stage cold inducible expression promoter POscold7 and a plant expression vector are further provided, and the expression cassette and the plant expression vector are applied to the plant genetic engineering. In addition, a primer pair specially used for amplifying the promoter from rice (Oryza sativa L. japonica. cv. Nipponbare) is further provided. The promoter can be used for improving the growth characteristics and the cold resistance of the rice, and significant theoretical and practical meaning is achieved in the rice cold resistance molecular mechanism research and the rice cold resistance molecular breeding.
Description
Technical field
The present invention relates to biotechnology and field of plant genetic.Specifically, the present invention relates to the cold abduction delivering promotor of a kind of rice seedling and application thereof.
Background technology
Paddy rice is one of important food crop in the whole world, and low temperature can cause the paddy rice underproduction, and the ubiquitous problem in paddy rice main producing region, the world is the problem of chilling injury.Damage to plants caused by sudden drop in temperature at the different times of Development of Rice and all can cause infringement in various degree to paddy rice.Damage to plants caused by sudden drop in temperature in seedling stage phenomenons such as can causing rice shoot chlorosis, a deadlock, minimizing of tillering, wither, dead seedling can occur time serious; Damage to plants caused by sudden drop in temperature boot stage and anther development can be made incomplete, cause the paddy rice underproduction; Sheng of the blooming phase damages to plants caused by sudden drop in temperature and paddy rice can be caused the normal sprouting of normally loose powder or pollen tube not to be affected, thus causes setting percentage to decline.How the crop loss that the annual whole world is caused because of injury from low temperature, up to hundreds billion of dollar, therefore overcomes injury from low temperature, cultivates the key that cryophylactic gene engineering crop is Perspectives of Molecular Design Breeding in Crops.
A complicated low temperature stress signal response network system is there is in plant.Plant carries out a series of gene genetic modification by this system after being subject to low temperature stress, regulates to adapt on self metabolism and growth the impact that this unfavorable factor causes it.Utilize key gene in this response network, effectively can improve the tolerance of plant to low temperature.Zhong Kang etc. (2007), by the proline content rising in overexpression render transgenic paddy rice in paddy rice of zinc finger protein albuminoid OsCOIN gene, improve the resistance to cold of plant.Zhang Hongsheng etc. (2009) are by paddy rice zinc finger protein ZFP245 gene overexpression in paddy rice, find that overexpression ZFP245 trans-genetic hybrid rice makes the expression amount of Proline Accumulation genes involved OsP5CS and proline transport gene OsProT gene improve under the cold side of body is near, impel the amount of proline(Pro) to increase, strengthen the resistance to cold of plant.Remaining virtuous and beautiful grade (2010) finds that MYBS3 overexpression paddy rice can survive after processing at 4 DEG C, and does not affect its Other Main Agronomic Characters.In addition, the overexpression some being comprised to the transcription factors such as DREB/CBF, NAC can improve the resistance to cold of paddy rice.
China's rice pest insects enriches, and excavates, locates, clones cold-resistant genes involved and cold induced promoter thereof, have important theory and practical significance by the seed selection of rice cold tolerance kind, will have wide application and market outlook at agriculture field from paddy rice.But, even if at present worldwide, such utilized genetic resources is not a lot of yet.
Summary of the invention
Therefore, for the problems referred to above, the object of this invention is to provide a kind of drive foreign gene specific expressed under cold inductive condition promotor, obtain containing the transformant of this promoter sequence and the application of this promotor.Wherein, involved herein " plant " refers to monocotyledons, such as paddy rice, wheat, corn, barley, jowar or oat, is preferably paddy rice.
To achieve these goals, on the one hand, the invention provides the cold abduction delivering promotor POscold7 of a kind of rice seedling, it is characterized in that, comprise:
Nucleotide sequence shown in (a) SEQ ID NO:1; Or
(b) obtain replace one or more Nucleotide in the nucleotide sequence shown in SEQ ID NO:1 after and there is the nucleotide sequence of promoter function; Or
(c) obtain add one or more Nucleotide in the nucleotide sequence shown in SEQ ID NO:1 after and there is the nucleotide sequence of promoter function; Or
That obtain after the one or more Nucleotide of sequential nucleotide deletion shown in (d) SEQ ID NO:1 and there is the nucleotide sequence of promoter function; Or
E () and the nucleotide sequence shown in SEQ ID NO:1 have at least 90% homology, and have the nucleotide sequence of promoter function; Or
F () has a nucleotide sequence of promoter function with the nucleotide sequence hybridization shown in SEQ ID NO:1 under strict conditions;
Nucleotide sequence shown in (g) SEQ ID NO:2; Or
H () and the nucleotide sequence shown in SEQ ID NO:2 have at least 90% homology and there is the nucleotide sequence of promoter function; Or
(i) obtain replace one or more Nucleotide in the nucleotide sequence shown in SEQ ID NO:2 after and there is the nucleotide sequence of promoter function; Or
(j) obtain add one or more Nucleotide in the nucleotide sequence shown in SEQ ID NO:2 after and there is the nucleotide sequence of promoter function; Or
(k) obtain after the one or more Nucleotide of sequential nucleotide deletion shown in SEQ ID NO:2 and there is the nucleotide sequence of promoter function; Or
L () has a nucleotide sequence of promoter function with the nucleotide sequence hybridization shown in SEQ ID NO:2 under strict conditions.
In sequence table, the DNA sequence dna shown in SEQ ID No:1 and 2 is increase and the Rice Cold extracted induction strongly expressed promotor from the fine paddy rice of Japan (Oryzasativa L cv.Nipponbare), is called POscold7 or promotor POscold7 herein.Specifically, present inventor finds that Japanese fine paddy rice (Oryza sativa L cv.Nipponbare) upstream region of gene comprises the DNA sequence dna of the 1985bp of transcription initiation site, there is the function driving target gene specific expressed under cold conditions, namely this promotor can play its effect at rice seedling, therefore the present inventor's separating clone identify the function of this DNA sequence dna.
On the other hand, the invention provides a kind of total length of above-mentioned rice seedling cold abduction delivering promotor POscold7 or primer pair of its any fragment of increasing.
On the other hand, the present invention also provides a kind of expression cassette comprising above-mentioned plant cold induction strongly expressed promotor.
Another aspect, the present invention also provides a kind of recombinant expression vector, described recombinant expression vector comprises the cold abduction delivering promotor POscold7 of above-mentioned rice seedling, in described recombinant expression vector, described rice seedling cold abduction delivering promotor POscold7 is connected to the upstream of gene order to be expressed.Preferably, described gene to be expressed is Gus gene, described recombinant expression vector is pCAMBIA1391-POscold7, this recombinant expression vector, for the sequence shown in SEQ ID No:1 and POscold7 or promotor POscold7 are implemented in the recombinant expression vector obtained in pCAMBIA1391, is called pCAMBIA1391-POscold7 herein.Or gene to be expressed can have for any winter hardiness to crop the gene improving function.Expressed under cold conditions by this cold tolerance gene of promoters driven of the present invention, thus realize the function improving crop cold tolerance trait.
Again on the one hand, the invention provides above-mentioned plant cold induction strongly expressed promotor and cultivate the application in transgenic plant.Described application comprises above-mentioned plant provided by the invention cold induction strongly expressed promotor is connected to the gene order upstream to be expressed of carrier (such as, before described promoter sequence is inserted target gene), thus structure recombinant expression vector, described recombinant expression vector is transformed in vegetable cell, tissue or organ and cultivates.
And preferably, described application may be used for improving plant growth characteristic, described plant is monocotyledons, such as paddy rice, wheat, corn, barley, jowar or oat, is preferably paddy rice.
It should be noted that: in the DNA sequence dna of above-mentioned promotor, the sequence in SEQ ID No:2 is the sequence after the 22bp eliminating 22bp and the ending started in SEQ ID No:1, for available from the DNA sequence dna in the fine paddy rice of Japan.The 22bp started in SEQ ID No:1 is the retention sequence obtaining the forward primer used in promotor process; The 22bp ended up in SEQ ID No:1 is the retention sequence (corresponding sequence of this retention sequence and reverse primer is complementary) obtaining the reverse primer used in promotor process.It is emphasized that mentioned promotor both can refer to above-mentioned whole DNA sequence dna herein, also can refer to the DNA sequence dna after removing above-mentioned primer retains sequence.It should be noted that, even if those skilled in the art are on basis of the present invention, adopt other primers to obtain similar sequence, it also falls within protection scope of the present invention.
In sum, the present inventor finds, extract and identify the DNA sequence dna that Japanese fine paddy rice POscold7 upstream region of gene comprises the 1985bp of transcription initiation site, and by its called after promotor POscold7.This sequence is connected to after enzyme is cut on plant binary expression vector pCAMBIA1391, obtain corresponding recombinant plasmid (i.e. recombinant expression vector), utilize this recombinant plasmid transformed Agrobacterium tumefaciens strain EHA105, then carry out the conversion of paddy rice by agriculture bacillus mediated method, obtain transgenic rice plant.Gus is carried out to the transgenic paddy rice obtained and expresses detection by quantitative discovery, transfer-gen plant is after low temperature induction process, Gus gene expression dose on the whole improves, thus prove that the sequence of this 1985bp has the activity driving genetic expression, and the Gus gene of this promoters driven is expressed after paddy rice low induction process.
Promoter sequence of the present invention can be connected with plant binary expression vector, for replacing constitutive promoter.And, this promoter sequence can be connected with required target gene, build recombinant plant expression vector, after transforming, can drive target gene can be specific expressed when rice seedling in plant after low temperature induction process, thus improve the expression amount of exogeneous target gene in plant, increase genetically modified effect.
Technique effect
The rice starter POscold7 that the present invention clones can concentrate expression by regulatory gene in plant, has remarkable value in actual applications.Utilize this promotor can significantly improve the cold tolerance of paddy rice, the new rice variety of this research for rice cold tolerance molecular mechanism and cultivation winter hardiness has important theory and realistic meaning.
Accompanying drawing explanation
Below, describe embodiment of the present invention in detail by reference to the accompanying drawings, wherein:
Fig. 1 is schematic diagram POscold7 promotor be implemented in pCAMBIA391 vector plasmid, wherein in Fig. 1, A is pCAMBIA1391 schematic diagram, in Fig. 1, B is pCAMBIA1391-Poscold7 schematic diagram, illustrated therein is the Gus genetic expression utilizing POscold7 promoters driven to be positioned at its downstream;
Fig. 2 is the result schematic diagram of promotor of the present invention being carried out to digestion verification;
Fig. 3 is the POscold7::GUS transfer-gen plant tissue staining figure of 7 days seedling ages.The rice plant of normal growth under 30 DEG C of conditions, after dyeing in 24 hours, root, leaf are all active without Gus, and 4 DEG C of deepfreezes after 24 hours, then after 30min dyeing, in root, stem, leaf, all have Gus strong expression.(scale=10mm)
Fig. 4 is the change of the relative expression quantity of POscold7 after deepfreeze 0h, 1h, 4h, 8h, 12h, 16h, 20h, 24h.
Embodiment
Referring to specific embodiment, the present invention is described.It will be appreciated by those skilled in the art that these embodiments are only for illustration of the present invention, its scope do not limited the present invention in any way.
Experimental technique in following embodiment, if no special instructions, is ordinary method.Medicinal raw material used in following embodiment, reagent material etc., if no special instructions, be commercially available purchase product.
the acquisition of the POscold7 promotor containing restriction enzyme site
The design of step 1, primer
According to the rice varieties Japan provided in NCBI fine (Oryza sativa L cv.Nipponbare) whole genome sequence, according to the sequences Design amplimer of paddy gene, and according to the feature of the carrier selected and target gene, the restriction enzyme site of design primer.
(CAMBIA is come from paddy rice binary expression vector pCAMBIA1391 in this experimental example, openly use carrier, genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group is preserved) be example, target gene is Gus gene, the primer of specific design is: forward primer (SEQ ID No:3) 5 ' end band BamHI, restriction enzyme site (GGATCC), reverse primer (SEQ ID No:4) 5 ' end band EcoRI, restriction enzyme site (GAATTC), primer sequence is as follows:
Forward primer: GGATCCTGATTTTGGATAGCTTTTTGTG BamHI
Reverse primer: GAATTCCGATCTCACTTGCTGTGTTCGA EcoRI
Synthesized by Shenzhen Hua Da genome company.
The acquisition of step 2, promotor POscold7
With the fine DNA of rice varieties Japan for template, utilize the amplification of forward primer, reverse primer promotor, routinely PCR system, adopt following amplification program:
95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 2min30s, circulate 35 times; Last 72 DEG C extend 10min.
Reclaim the object fragment of pcr amplification, object fragment length 1985bp, be connected to PGEM-T-Easy carrier (purchased from Promega company, ratio mixing in carrier specification sheets) on, after cold shock method transformation of E. coli XL-Blue competent cell, competent cell is activated, and then object fragment is transferred to the competent cell of activation, then, screen through bacterium colony PCR and obtain positive colony, picking mono-clonal bacterium liquid upgrading grain, carries out double digestion checking with above-mentioned primer BamHI and EcoRI, as shown in Figure 2.Positive colony through qualification is sent and the order-checking of Invitrogen company.Verify that correct clone is the promotor that will obtain, its nucleotide sequence is as shown in SEQ ID No:1.
the structure of plant expression vector and the conversion of Agrobacterium
Extract plasmid in the positive colony obtained " acquisition of promotor POscold7 " process from above, cut with BamHI and EcoRI enzyme, reclaim promotor POscold7 fragment.Utilize BamHI and EcoRI to carry out linearization process to pCAMBIA1391 simultaneously, reclaim pCAMBIA1391, above-mentioned POscold7 fragment is connected with pCAMBIA1391 fragment T4 ligase enzyme (being purchased from TaKaRa company), obtain the plant expression vector pCAMBIA1391-POscold7 of promotor POscold7 and Gus gene fusion, freeze-thaw method is utilized plant expression vector to be proceeded to agrobacterium tumefaciens (Agrobacterium tumefaciens) EHA105 (genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group is preserved).
promotor POscold7 is utilized to drive Gus reporter gene to express in paddy rice
Step 1: agriculture bacillus mediated rice transformation
After mature seed (Japanese fine rice paddy seed) removes clever shell, with 70% alcohol-pickled seed 1min, outwell alcohol.With 50% clorox (stoste effective chlorine density is greater than 4%) the solution soaking seed 40min (150r/min) containing 1 Tween20.Outwell clorox, aseptic washing is clarified, without clorox taste to solution for 5 times.Sterilized water soaks seed and spends the night.With the aleurone layer of scalper along seed, embryo is peeled, embryo is inoculated on calli induction media.At 30 DEG C light culture after 11 days by callus and endosperm and germ separation, by go bud in good condition, divide vigorous elementary callus and carry out preculture is used for Agrobacterium conversion after 3 ~ 5 days.
The agrobacterium tumefaciens having proceeded to recombinant expression vector in above-mentioned " structure of plant expression vector and the conversion of Agrobacterium " process is adopted to carry out Agrobacterium-mediated genetic transformation, obtain POscold7::gus transgenic rice plant, this genetic transformation, transformant screening and transgenic plant regeneration etc. are with reference to YongboDuan (Yongbo Duan, Chenguang Zhai, et al.An efficient and high-throughputprotocol for Agrobacterium mediated transformation based onphOsphomannOse isomerase pOsitive selection in Japonica rice (Oryza sativaL.) [J] .Plant Cell Report, method 2012.DOI10.1007/s00299-01201275-3.) etc. proposed.
The cold Stress treatment of step 2, POscold7-pCAMBIA1391 plant and the cold response activity checking of POscold7
(Cornell Univ USA is come from from the transfer-gen plant proceeding to POscold7-pCAMBIA1391 and the transfer-gen plant having proceeded to PActin-pCAMBIA1391 in contrast, gus gene is driven by constitutive promoter paddy rice PActin conventional in current genetically engineered, genetically modified organism product composition supervision and inspection center of Academy of Agri-Science and Technology Anhui Province Ministry of Agriculture paddy rice group is preserved) in, the T2 seed selecting 4 is identified for promoter activity.Seedling in rear for sprouting 7 day age is placed in 4 DEG C and within 24 hours, carries out cold Stress treatment, parallel material 30 DEG C of normal growths in contrast.
GUS dyes: root, the leaf got 24 hours dye respectively, takes a picture.Under result is presented at the cold induction condition of 24 hours of 4 DEG C, root and leaf can be dyed to obvious visible blueness (Fig. 3), illustrate that this promotor littlely can drive gus gene strong expression constantly 4 DEG C of process 24.
Gus is quantitative: get process 0h, 1h, 4h, 8h, 12h, 16h, 20h, the complete stool material of 24h is as sample, the plant total RNA extraction reagent box of Tian Gen biochemical technology company limited is used to extract sample total serum IgE, the Fastquant RT test kit reverse transcription re-using day root growth Science and Technology Ltd. is cDNA, take cDNA as template, with ACTIN gene for internal reference, with the SuperReal PreMix Plus real-time fluorescence quantitative PCR premixed liquid of Tian Gen biochemical technology company limited for reaction reagent, on the PRISM7500 fluorescent PCR instrument of ABI company, by the Gus expression intensity of qRT-PCR reaction detection POscold7 and PActin promoters driven.Wherein, for demarcating the quantitative qRT-PCR primer of ACTIN gene be:
ACTIN upstream primer: 5 '-CCTTCAACACCCCTGCTATG-3 ',
ACTIN downstream primer: 5 '-CAATGCCAGGGAACATAGTG-3 '
The qRT-PCR primer of expressing for detecting gus gene is:
Gus upstream primer: 5 '-TACGGCAAAGTGTGGGTCAATAATCA-3 '
Gus downstream primer: 5 '-CAGGTGTTCGGCGTGGTGTAGAG-3 '
Result shows, and along with the prolongation of deepfreeze time, the activity of POscold7 raises gradually.Process after 24 hours, the activity of POscold7 is 30 times final (as shown in Figure 4), illustrates that POscold7 is a kind of Low background signal, highly sensitive cold induced promoter.
Specific description of embodiments of the present invention does not above limit the present invention, and those skilled in the art can make various change or distortion according to the present invention, only otherwise depart from spirit of the present invention, all should belong to the scope of claims of the present invention.
Claims (9)
1. the cold abduction delivering promotor POscold7 of rice seedling, is characterized in that, comprise:
Nucleotide sequence shown in (a) SEQ ID NO:1; Or
(b) obtain replace one or more Nucleotide in the nucleotide sequence shown in SEQ ID NO:1 after and there is the nucleotide sequence of promoter function; Or
(c) obtain add one or more Nucleotide in the nucleotide sequence shown in SEQ ID NO:1 after and there is the nucleotide sequence of promoter function; Or
That obtain after the one or more Nucleotide of sequential nucleotide deletion shown in (d) SEQ ID NO:1 and there is the nucleotide sequence of promoter function; Or
E () and the nucleotide sequence shown in SEQ ID NO:1 have at least 90% homology, and have the nucleotide sequence of promoter function; Or
F () has a nucleotide sequence of promoter function with the nucleotide sequence hybridization shown in SEQ ID NO:1 under strict conditions;
Nucleotide sequence shown in (g) SEQ ID NO:2; Or
H () and the nucleotide sequence shown in SEQ ID NO:2 have at least 90% homology and there is the nucleotide sequence of promoter function; Or
(i) obtain replace one or more Nucleotide in the nucleotide sequence shown in SEQ ID NO:2 after and there is the nucleotide sequence of promoter function; Or
(j) obtain add one or more Nucleotide in the nucleotide sequence shown in SEQ ID NO:2 after and there is the nucleotide sequence of promoter function; Or
(k) obtain after the one or more Nucleotide of sequential nucleotide deletion shown in SEQ ID NO:2 and there is the nucleotide sequence of promoter function; Or
L () has a nucleotide sequence of promoter function with the nucleotide sequence hybridization shown in SEQ ID NO:2 under strict conditions.
2. the total length of rice seedling according to claim 1 cold abduction delivering promotor POscold7 that increases or the primer pair of its any fragment.
3. one kind contains recombinant vectors or the expression cassette of the cold abduction delivering promotor POscold7 of rice seedling described in claim 1.
4. a recombinant expression vector, it is characterized in that, described recombinant expression vector is insert in the multiple clone site of plant expression vector pCAMBIA1391 the recombinant plasmid that the cold abduction delivering promotor POscold7 of rice seedling according to claim 1 obtains, in described recombinant expression vector, described plant cold induction strongly expressed promotor POscold7 is connected to the upstream of gene order to be expressed in carrier.
5. recombinant expression vector according to claim 4, is characterized in that, described gene to be expressed is cold tolerance gene, and described cold tolerance gene comprises OsCOIN gene, paddy rice zinc finger protein ZFP245 gene, MYBS3, DREB/CBF or NAC.
6. an expression cassette, is characterized in that, described expression cassette comprises the cold abduction delivering promotor POscold7 of rice seedling described in claim 1.
7. cultivating the application in transgenic plant according to the cold abduction delivering promotor POscold7 of the rice seedling described in claim 1 for one kind, it is characterized in that, described application comprises: be connected to gene order upstream to be expressed in carrier by according to the cold abduction delivering of the rice seedling in claim 1 described in any one promotor POscold7, thus builds recombinant expression vector; Described recombinant expression vector is transformed in vegetable cell, tissue or organ and cultivates.
8. application according to claim 7, is characterized in that, described application also comprises vegetable cell, tissue or the organ that utilization cultivates and carries out cold-resistant rice cultivating.
9. application according to claim 7, is characterized in that, described application is used for improving plant growth characteristic, and described plant is monocotyledons: paddy rice, corn, wheat, barley, jowar or oat.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510324979.2A CN104928295B (en) | 2015-06-11 | 2015-06-11 | The cold-induced expression promoter POscold7 of rice seedling |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510324979.2A CN104928295B (en) | 2015-06-11 | 2015-06-11 | The cold-induced expression promoter POscold7 of rice seedling |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104928295A true CN104928295A (en) | 2015-09-23 |
| CN104928295B CN104928295B (en) | 2018-06-12 |
Family
ID=54115722
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510324979.2A Expired - Fee Related CN104928295B (en) | 2015-06-11 | 2015-06-11 | The cold-induced expression promoter POscold7 of rice seedling |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104928295B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103849622A (en) * | 2014-03-27 | 2014-06-11 | 安徽省农业科学院水稻研究所 | Plant cold-induced expression promoter Poscold 2 and application thereof |
| CN103865930A (en) * | 2014-03-27 | 2014-06-18 | 安徽省农业科学院水稻研究所 | Cold inducible expression promoter Poscold3 of plant stem leaf and application of promoter |
-
2015
- 2015-06-11 CN CN201510324979.2A patent/CN104928295B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103849622A (en) * | 2014-03-27 | 2014-06-11 | 安徽省农业科学院水稻研究所 | Plant cold-induced expression promoter Poscold 2 and application thereof |
| CN103865930A (en) * | 2014-03-27 | 2014-06-18 | 安徽省农业科学院水稻研究所 | Cold inducible expression promoter Poscold3 of plant stem leaf and application of promoter |
Non-Patent Citations (3)
| Title |
|---|
| SASAKI等: "AP003254", 《NCBI:GENBANK》 * |
| 崔永兰等: "两个水稻胚乳启动子的克隆及表达分析", 《中国生物工程杂志》 * |
| 陈爱敏: "水稻茎叶特异性启动子研究进展", 《现代农业科技》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104928295B (en) | 2018-06-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104946649A (en) | Specific expression promoter OsAnth1 for rice anthers | |
| CN103849622B (en) | The cold abduction delivering promotor Poscold2 of one kind of plant and application thereof | |
| US20100275327A1 (en) | Method of increasing abiotic stress tolerance in plants | |
| CN103819549B (en) | A kind of rice protein and encoding gene application in regulation and control plant drought resistance thereof | |
| CN103740717B (en) | A kind of EMBRYO IN RICE specific expressing promoter and application thereof | |
| CN104073491B (en) | Plant high temperature induction expresses promotor Posheat2 and application thereof | |
| CN103865930B (en) | A kind of cold abduction delivering promotor Poscold3 of plant stem-leaf and application thereof | |
| CN104046629B (en) | A kind of plant salt abduction delivering promotor POsSalt1 and application thereof | |
| CN103088022B (en) | Plant-salt-induced expression promoter | |
| CN103882023B (en) | A kind of plant drouhgt stress abduction delivering promotor PosDro2 and application thereof | |
| CN103849621B (en) | The cold abduction delivering promotor Poscold1 of one kind of plant and application thereof | |
| CN103740720B (en) | Identification and application of rice root specific strong promoter POsRo2 | |
| CN105713079A (en) | Application of protein and related biological material thereof in increasing plant yield | |
| CN105602955A (en) | Rice stamen specific expression promoter OsAnth2 and application thereof | |
| CN105063047A (en) | Plant seed specific expression promotor OsSee1 | |
| CN104073493B (en) | The cold induction strongly expressed promoter Poscold4 of plant and application thereof | |
| CN103614385B (en) | A gene KT525 is improving the application on plant stress tolerance | |
| CN103834661B (en) | A kind of vegetable hot abduction delivering promotor Posheat1 and application thereof | |
| CN104845973A (en) | Cloning and applications of low-temperature strong inducible promoter POscold6 of rice | |
| CN104928295A (en) | Rice seedling stage cold inducible expression promoter POscold7 | |
| CN105087591B (en) | Paddy rice root tip specific expression promoter POsRo3 | |
| CN104845974B (en) | The DNA fragmentation POscold5 of long-term cold stress can be responded | |
| CN104087587A (en) | Plant drought stress induction expression promoter and application thereof | |
| CN103882021A (en) | Plant drought induced expression promoter PosDro1 and application thereof | |
| CN104073490B (en) | A kind of plant drouhgt stress abduction delivering promotor PosDro3 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180612 Termination date: 20200611 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |