CN104928288B - A kind of nested primer and its application for China's cultured prawn shrimp liver sausage born of the same parents' insect infection early warning - Google Patents
A kind of nested primer and its application for China's cultured prawn shrimp liver sausage born of the same parents' insect infection early warning Download PDFInfo
- Publication number
- CN104928288B CN104928288B CN201510287845.8A CN201510287845A CN104928288B CN 104928288 B CN104928288 B CN 104928288B CN 201510287845 A CN201510287845 A CN 201510287845A CN 104928288 B CN104928288 B CN 104928288B
- Authority
- CN
- China
- Prior art keywords
- same parents
- primer
- liver sausage
- china
- early warning
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention relates to a kind of nested primer for China's cultured prawn shrimp liver sausage born of the same parents' insect infection early warning and its application, the nested primer includes a pair of outer primer EMISF/EMISR and a pair of inner primer EMISnF/EMISnR, particular sequence are as follows：EMISF：GCGGTAATTCCAACTCCAAG；EMISR：TAAGCAGCACAATCCACTCC；EMISnF：AGTAGCGGAACGGATAGGGA；EMISnR：ACCCAGCATTGTCGGCATAG.Detection sensitivity of the present invention is very high and specific good, it is adapted to content extremely low and the monitoring of the shrimp seedling Prawn liver sausage born of the same parents worm of tissue mass very little, suitable for the micro infection of China cultured prawn shrimp liver sausage born of the same parents worm or early monitoring and the early warning of latent infection, have a good application prospect.
Description
Technical field
It is more particularly to a kind of to be used for China cultured prawn shrimp liver sausage born of the same parents worm the invention belongs to cultured prawn disease prevention and cure field
Infect nested primer and its application of early warning.
Background technology
Follow-up study to China's cultured prawn disease in recent years and epidemiology survey find that one kind just started in recent years
South Asia region it is popular prawn microsporidian --- shrimp liver sausage born of the same parents worm (Enterocytozoon hepatopenaei) is in China
Also it is widely current in cultivation Environment of Litopenaeus vannamei Low.The analysis shows such as pathology, from various regions collection there is disease symptom (just to integrate in vain
Sign) prawn vivo detection to largely, the shrimp liver sausage born of the same parents worm in different development stage.Filled in infection prawn Hepatopancreas
Full microsporidian spore, the serious vacuolation of cell is until size degradation, and infection shrimp is slow-growing, immunity degradation, easy virus infection,
Other cause of diseases such as vibrios and break out viral or bacteriosis, economic loss is more serious.Because microsporidian is intracellular
Parasite, and there is hard chitin shell, therefore, the treatment method of microsporidian is only several in nosema bombycis etc.
Individual species has curative drug, and less effective, and for aquatic livestock microsporidian especially this new hair of shrimp liver sausage born of the same parents worm
Species, there is presently no the relevant report of remedy measures.It is difficult to eliminate after prawn infection shrimp liver sausage born of the same parents worm, it is usually lifelong to carry.
Therefore, the control at present for shrimp liver sausage born of the same parents worm should rely mainly on prevention, and find shrimp liver sausage early in infection early stage/incubation period as far as possible
The infection of born of the same parents worm, realizes early warning, effectively controls the infection and propagation of cause of disease, avoids shrimp liver sausage born of the same parents parasitosis and Secondary cases virus
Disease, bacterial disease extensive popular and break out.
The circulation way of shrimp liver sausage born of the same parents worm is that vertical transmission and horizontal transmission coexist.If seed shrimp infects shrimp liver sausage born of the same parents worm,
Filial generation shrimp seedling can be then transmitted to by vertical transmission, because the cultivation density and temperature of shrimp seedling are very high, is especially advantageous for microsporidian
Propagation and horizontal transmission so that infection shrimp liver sausage born of the same parents worm shrimp seedling quantity increase, therefore, seed shrimp and shrimp seedling shrimp liver sausage rapidly
The early warning of born of the same parents' insect infection is more even more important than cultivation period.Molecule PCR diagnostic techniques is needed due to quick, easy, sample tissue
Measure it is small, thus, suitable for the quick diagnosis of prawn Prawn liver sausage born of the same parents worm especially seed shrimp and shrimp seedling Prawn liver sausage born of the same parents worm, still,
The country of China yet there are no the formal report on shrimp liver sausage born of the same parents worm, also not on the popular molecule planted of China shrimp liver sausage born of the same parents worm
Detection technique, it is China cultured prawn shrimp liver there is an urgent need to design for the popular high special planted in China and sensitive primer
The early warning early of intestines born of the same parents worm and in time prevention provide technical guarantee.
Because microsporidian is cytozoicus biology, also with hard chitin shell, DNA extraction is not only influenceed
Efficiency, and shorter fragment easily occur, therefore, microsporidian both at home and abroad based on universal primer (amplification long segment) it is general
Logical PCR recall rates are more much lower than the recall rate of the cause of diseases such as bacterium, virus, although quantitative PCR technique sensitivity improves,
But testing cost greatly improves, and it is higher to instrument requirements.Sleeve type PCR technology is by designing inside and outside two pairs of nested primers
Two-wheeled amplification is carried out, the template DNA of trace is enriched with, expanded to the amount that can be detected, and amplification efficiency is high, and because two pairs are drawn
The target gene of thing amplification is nested, and the specificity of amplification greatly enhances, and reaches high sensitivity, high specific amplification purpose base
The purpose of cause.Method efficiency compared with the regular-PCR of single pair primer is higher by a lot, again relatively easy compared with quantitative fluorescent PCR
Easy and cost is cheap.
The content of the invention
The technical problems to be solved by the invention are to provide a kind of for China's cultured prawn shrimp liver sausage born of the same parents insect infection early stage
The nested primer of early warning and its application, the nested primer detection sensitivity is very high and specific good, is adapted to content extremely low and organizes
The monitoring of the shrimp seedling Prawn liver sausage born of the same parents worm of very little is measured, suitable for the micro infection of China cultured prawn shrimp liver sausage born of the same parents worm or latent infection
Early monitoring and early warning, have a good application prospect.
A kind of nested primer for China's cultured prawn shrimp liver sausage born of the same parents' insect infection early warning of the present invention, the shell type
Primer includes a pair of outer primer EMISF/EMISR and a pair of inner primer EMISnF/EMISnR, particular sequence are as follows：
EMISF：GCGGTAATTCCAACTCCAAG；
EMISR：TAAGCAGCACAATCCACTCC；
EMISnF：AGTAGCGGAACGGATAGGGA；
EMISnR：ACCCAGCATTGTCGGCATAG.
The expanding fragment length of the outer primer EMISF/EMISR is 423bp.
The expanding fragment length of the inner primer EMISnF/EMISnR is 188bp.
A kind of application of nested primer for China's cultured prawn shrimp liver sausage born of the same parents' insect infection early warning of the present invention, institute
State Molecular Detection and Disease Warning Mechanism that nested primer is applied to China prawn shrimp liver sausage born of the same parents worm.
Extensive epidemiology survey and common and Ultrastructural pathology analysis shows of the present invention based on universal primer, infection
The shrimp liver sausage born of the same parents worm of China's Environment of Litopenaeus vannamei Low is same kind, and SSU rRNA gene orders are identical.Accordingly, a set of be based on is devised
The gene order of China's prawn shrimp liver sausage born of the same parents' worm kind, and the nested primer that amplified fragments are very short.
Beneficial effect
Detection sensitivity of the present invention is very high and specific good, is adapted to content extremely low and the shrimp seedling Prawn liver sausage of tissue mass very little
The monitoring of born of the same parents worm, suitable for the micro infection of China cultured prawn shrimp liver sausage born of the same parents worm or early monitoring and the early warning of latent infection, tool
There is good application prospect.
Brief description of the drawings
Fig. 1 is 8 tail Environment of Litopenaeus vannamei Low shrimp seedling hepatic tissue DNA primer amplification；Wherein, preceding 8 swimming lanes are set
Formula primer amplification, rear 8 swimming lanes are external primer amplification result.
Embodiment
With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are merely to illustrate the present invention
Rather than limitation the scope of the present invention.In addition, it is to be understood that after the content of the invention lectured has been read, people in the art
Member can make various changes or modifications to the present invention, and these equivalent form of values equally fall within the application appended claims and limited
Scope.
Embodiment 1
Respectively using EMISF/EMISR primers and nested primer (EMISF/EMISR and EMISnF/EMISnR) to 4 shrimps
The shrimp seedling sample hepatic tissue DNA profiling in pond source enters performing PCR amplification experiment.
Outer primer (EMISF/EMISR) amplification system and condition：Amplification system totally 25 μ L, by 1 μ L tissue DNAs template, 0.5
μ L forward direction outer primers EMISF (10 μM), the reverse outer primer EMISR of 0.5 μ L (10 μM), 12.5 μ LGreen
Master Mix (promega) and 10.5 μ L form without DNA enzymatic water.Amplification condition is：95 DEG C of pre-degeneration 4min, then 95 DEG C
40s, 52 DEG C of 30s, 72 DEG C of 35s are circulated 25 times, last 72 DEG C of extensions 5min.A PCR primer part is used as inner primer amplification
Template.
Inner primer (EMISnF/EMISnR) amplification system and condition：Amplification system totally 25 μ L, by 1 μ L external primer amplifications
PCR primer, 0.4 μ L forward direction inner primers EMISnF (10 μM), the reverse inner primer EMISnR of 0.4 μ L (10 μM), 12.5 μ LGreen Master Mix (promega) and 10.7 μ L form without DNA enzymatic water.Amplification condition is：95 DEG C of pre-degenerations
3min, then 95 DEG C of 35s, 53 DEG C of 30s, 72 DEG C of 20s are circulated 22 times, last 72 DEG C of extensions 5min.
Take the nested primer PCR primers of the 8 tail shrimp seedlings in one of pond together with outer primer PCR primer through 1% agarose
Detected through gel electrophoresis, as a result as shown in Figure 1.From electrophoretogram as can be seen that external primer amplification result be all it is negative (swimming lane 9~
16), and nested primer amplification is all positive (swimming lane 1~8), band is bright and single.All positive findingses are tested through sequencing
Card, is shrimp liver sausage born of the same parents worm.Outer primer and nested primer are shown in Table 1 to the testing result of 4 culturing pool shrimp seedlings.
Testing result explanation：1st, shrimp seedling Prawn liver sausage born of the same parents worm content is extremely low；2nd, nested primer (EMISF/EMISR and
EMISnF/EMISnR detection sensitivity) is very high and specific good, is adapted to content extremely low and the shrimp seedling Prawn liver of tissue mass very little
The monitoring of intestines born of the same parents worm, suitable for the micro infection of China cultured prawn shrimp liver sausage born of the same parents worm or early monitoring and the early warning of latent infection.
The amplification of the outer primer of table 1 and nested primer to shrimp seedling Prawn liver sausage born of the same parents worm
Claims (2)
- A kind of 1. nested primer for China's cultured prawn shrimp liver sausage born of the same parents' insect infection early warning, it is characterised in that：The set Formula primer includes a pair of outer primer EMISF/EMISR and a pair of inner primer EMISnF/EMISnR, particular sequence are as follows：EMISF：GCGGTAATTCCAACTCCAAG；EMISR：TAAGCAGCACAATCCACTCC；EMISnF：AGTAGCGGAACGGATAGGGA；EMISnR：ACCCAGCATTGTCGGCATAG；The expanding fragment length of the outer primer EMISF/EMISR is 423bp.
- 2. a kind of shell type for China's cultured prawn shrimp liver sausage born of the same parents' insect infection early warning according to claim 1 is drawn Thing, it is characterised in that：The expanding fragment length of the inner primer EMISnF/EMISnR is 188bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510287845.8A CN104928288B (en) | 2015-05-29 | 2015-05-29 | A kind of nested primer and its application for China's cultured prawn shrimp liver sausage born of the same parents' insect infection early warning |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510287845.8A CN104928288B (en) | 2015-05-29 | 2015-05-29 | A kind of nested primer and its application for China's cultured prawn shrimp liver sausage born of the same parents' insect infection early warning |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104928288A CN104928288A (en) | 2015-09-23 |
| CN104928288B true CN104928288B (en) | 2018-02-09 |
Family
ID=54115715
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510287845.8A Active CN104928288B (en) | 2015-05-29 | 2015-05-29 | A kind of nested primer and its application for China's cultured prawn shrimp liver sausage born of the same parents' insect infection early warning |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104928288B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106048022A (en) * | 2016-06-16 | 2016-10-26 | 徐锦余 | Kit for detecting enterocytozoonhepatopenaei |
| CN106636471B (en) * | 2017-01-16 | 2020-04-24 | 山东省海洋生物研究院 | Multiplex PCR detection kit for simultaneously detecting WSSV, AHPND, EHP and IHHNV of prawns |
| CN106591474A (en) * | 2017-01-19 | 2017-04-26 | 浙江省淡水水产研究所 | LAMP detection kit for Enterocytozoon hepatopenaei |
| KR101987852B1 (en) | 2018-04-24 | 2019-06-11 | 한국생명공학연구원 | Primer set for diagnosing infection of Enterocytozoon hepatopenaei and diagnosis kit comprising the same |
| CN112957392B (en) * | 2021-03-04 | 2022-03-08 | 上海联旺水产科技有限公司 | Preparation for preventing and treating liver enterocytozoosis of prawns and shrimps as well as preparation method and application thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102071263B (en) * | 2010-12-07 | 2013-05-15 | 中华人民共和国珠海出入境检验检疫局 | Nested fluorescence reverse transcription-polymerase chain reaction (RT-PCR) detection reagent for avian influenza virus (AIV) H5 subtype and detection kit |
| CN102747164A (en) * | 2012-07-25 | 2012-10-24 | 福建农林大学 | PCR-DGGE (polymerase chain reaction and denaturing gradient gel electrophoresis) analysis method for f flora on gill of oyster |
-
2015
- 2015-05-29 CN CN201510287845.8A patent/CN104928288B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104928288A (en) | 2015-09-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104928288B (en) | A kind of nested primer and its application for China's cultured prawn shrimp liver sausage born of the same parents' insect infection early warning | |
| Torfason et al. | Polymerase chain reaction for laboratory diagnosis of orf virus infections | |
| CN107299155A (en) | A kind of primer and probe of goose astrovirus real-time fluorescence quantitative PCR detection | |
| CN103160615B (en) | Multiple PCR primer used for simultaneously detecting infectious Bovine Rhinotracheitis virus and akabane virus as well as its design method | |
| CN103627816A (en) | Multiplex RT-PCR detection kit for porcine reproductive and respiratory syndrome virus and application thereof | |
| CN103882153B (en) | Fluorescent quantitative primer group for visual differential diagnosis of waterfowl parvoviruses | |
| CN104630387A (en) | LAMP detection kit for porcine epidemic diarrhea virus | |
| CN104152582A (en) | Lumpy skin disease virus (LSDV) Taqman-MGB (minor groove binder) probe real-time fluorescence quantitative PCR (polymerase chain reaction) detection primer, kit and detection method | |
| CN104561379A (en) | Detection method and detection kit of genotype I grass carp reovirus | |
| CN105525038B (en) | Newcastle disease virus is strong, weak malicious one-step method real-time fluorescent RT-PCR detection kit | |
| CN104561267A (en) | Loop-mediated isothermal amplification reaction primer for detecting streptococcus agalactiae of tilapias | |
| CN102876811A (en) | RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection kit and RT-LAMP detection method for SVCV (spring viremia of carp virus) | |
| Mughini-Gras et al. | Control of a reassortant pandemic 2009 H1N1 influenza virus outbreak in an intensive swine breeding farm: effect of vaccination and enhanced farm management practices | |
| CN101319253B (en) | Method for detecting high-pathogenicity blue ear disease | |
| CN103014181B (en) | LAMP (Loop-Mediated Isothermal Amplification) detection kit and detection method for giant salamander iridovirus | |
| CN104313163B (en) | Method and kit for triple PCR detection of porcine infectious actinobacillus pleuropneumonia serum types 2, 3 and 6 and application of porcine infectious actinobacillus pleuropneumonia serum types 2, 3 and 6 | |
| CN104651536A (en) | Reverse transcription loop-mediated isothermal amplification kit for PRRSV (Porcine Reproductive And Respiratory Syndrome Virus) and application thereof | |
| CN103695552A (en) | Culture-independent semiquantitative detection kit of tilapia streptococcus agalactiae | |
| CN103215389A (en) | Porcine reproductive and respiratory syndrome and porcine Japanese B encephalitis dual one-step RT-PCR (Reverse Transcription-Polymerase Chain Reaction) diagnosis kit | |
| CN106435015A (en) | Rapidly color developing LAMP kit for one-step detection of porcine parvoviruses | |
| CN106755518A (en) | A kind of swimming crab flesh spore worm real time quantitative PCR detecting reagent kit | |
| CN102994652A (en) | Method for detecting newcastle disease virus nucleic acid by RT-PCR | |
| CN103160620B (en) | High-efficient PCR (polymerase chain reaction) detection method of infectious hematopoietic necrosis virus | |
| CN106282399A (en) | The PCR detection primer of a kind of Borrelia burgdoyferi and detection method | |
| CN105925727A (en) | Primer and kit for detecting foot and mouth disease virus type A and type O mixed infection and use method and application of kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |