CN104630387A - LAMP detection kit for porcine epidemic diarrhea virus - Google Patents
LAMP detection kit for porcine epidemic diarrhea virus Download PDFInfo
- Publication number
- CN104630387A CN104630387A CN201510058622.4A CN201510058622A CN104630387A CN 104630387 A CN104630387 A CN 104630387A CN 201510058622 A CN201510058622 A CN 201510058622A CN 104630387 A CN104630387 A CN 104630387A
- Authority
- CN
- China
- Prior art keywords
- epidemic diarrhea
- diarrhea virus
- porcine epidemic
- seq
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Abstract
The invention discloses a kit for detecting porcine epidemic diarrhea virus. The kit comprises primers shown in SEQ ID NO:1-4, and genes used for performing loop-mediated isothermal amplification on the porcine epidemic diarrhea virus. The invention also discloses an application of the primers shown as SEQ ID NO:1-4 in preparation of agents for the genes used for performing loop-mediated isothermal amplification on the porcine epidemic diarrhea virus. The detection kit disclosed by the invention can accurately and effectively detect the porcine epidemic diarrhea virus and has the advantages of high specificity, high sensitivity, low time consumption, rapid detection and good application prospects.
Description
Technical field
The present invention relates to a kind of LAMP detection kit detecting Porcine epidemic diarrhea virus.
Background technology
The velocity of propagation of Porcine Epidemic Diarrhea in swinery comparatively transmissible gastroenteritis of swine is slow, and mortality ratio is also lower, but reports one or two years recently, and Porcine epidemic diarrhea virus (PEDV) morphs, and mortality ratio increases to some extent.The main clinic symptoms of sucking piglets infected pigs epidemic diarrhea virus is: there is watery diarrhea and cause serious dehydration with vomiting, become thin, the symptom such as eye socket sink; Ight soil is rarer, and color is yellow or canescence, vomits multiple being born in and to suck the breast or after feed; Morbidity pig is generally dead at about 5 days, and the mortality ratio of some pig farms sucking piglets can up to 90%.It is comparatively light that weanling pig and child care pig infect symptom after epidemic diarrhea virus, often present that spirit is depressed, apocleisis, have loose bowels, the clinical symptom such as vomiting, as proper in nursed, pig farm is cleaner, and without the infection of Other diseases supervention, then mortality ratio is lower, about 10%-20%; Fatten to infect with replacement gilt and present transient feature, seldom death occurs, general 3-7 days can spontaneous remission.Cut open the main small intestine extreme expansion of main pathological change of inspection, intestines wall is translucent shape, and mesenteric lymph bears water hyperemia, and stomach is full of white curdling block, and small intestine contents is thin, and containing a large amount of weak yellow liquids, intestinal villi shortens.
Traditional detection method is as Virus Isolation and serum inspection, often consuming time long.Ring mediated isothermal amplification (Loop-mediated isothermal amplification, LAMP) is the one in numerous nucleotide amplification techniques (the nucleic acid amplifications tests, NATs).Since the investigators such as Notomi announced this technology in 2000, this technology is widely used in life science, wherein just comprises the detection to pathogenic infection.While this technology is applied to the various pathogenic agent of detection by investigator, also a lot of improvement is proposed to this technology, make this technology gradual perfection, successfully can be applied to the detection as malaria, trypanosomiasis, your disease pathogen such as piroplasmosis and babesiosis of Taylor.LAMP nucleic acid amplification carries out under isothermal conditions, does not need special instrument, can visual results, simple to operate.
Zheng Xintian etc., " loop-mediated isothermal amplification technique rapid detection Porcine epidemic diarrhea virus ", China's Preventive Veterinary Medicine report, volume the 10th phase October the 36th in 2014, disclose a kind of method adopting RT-LAMP to detect Porcine epidemic diarrhea virus, the lowest detection limit of its Porcine epidemic diarrhea virus that can detect is 16copies/ μ L.
Summary of the invention
In order to solve the problem, the invention provides the test kit of a kind of high specificity, highly sensitive detected Porcine epidemic diarrhea virus.
The present invention detects the test kit of Porcine epidemic diarrhea virus, and it comprises primer shown in SEQ ID NO:1 ~ 4, for the gene of ring mediated isothermal amplification Porcine epidemic diarrhea virus.
Wherein, described test kit also comprises primer shown in SEQ ID NO:5 ~ 6.
Wherein, described test kit also comprises the gene fragment shown in SEQ ID NO:7.
Present invention also offers the purposes of primer shown in SEQ ID NO:1 ~ 4 in the reagent of preparation detection Porcine epidemic diarrhea virus.
Wherein, the reagent of described detection Porcine epidemic diarrhea virus is the reagent of the gene of ring mediated isothermal amplification Porcine epidemic diarrhea virus.
Wherein, described reagent also comprises the gene fragment shown in SEQ ID NO:7.
Wherein, described reagent also comprises primer shown in SEQ ID NO:5 ~ 6.
Present invention also offers the purposes of primer shown in SEQ ID NO:1 ~ 4 in the reagent of gene preparing ring mediated isothermal amplification Porcine epidemic diarrhea virus.
Wherein, described reagent also comprises primer shown in SEQ ID NO:5 ~ 6.
Wherein, described reagent also comprises the gene fragment shown in SEQ ID NO:7.
The primer of the present invention's design, specially can be increased by LAMP technology the gene of Porcine epidemic diarrhea virus effectively, the minimal detectable concentration of virus is 15copies/ μ L, lowest detection limit is a little less than existing method, and sensitivity is slightly high, simultaneously, high specificity, consuming time short, detect fast, have a good application prospect.
The embodiment of form by the following examples, is described in further detail foregoing of the present invention.But this should be interpreted as that the scope of the above-mentioned theme of the present invention is only limitted to following embodiment.The technology that all contents recorded based on claims of the present invention realize all belongs to scope of the present invention.
Accompanying drawing explanation
Fig. 1 dNTPs is on the impact of LAMP.M:DL2000DNA Marker; The dosage that swimming lane 1-8 is corresponding in turn to dNTPs is: 0.5,1.0 μ L, 1.5,2.0,2.5,3.0,3.5,4.0 μ L.
Fig. 2 MgSO4 is on the impact of LAMP.M:DL2000DNA Marker; The dosage that swimming lane 1-8 is corresponding in turn to MgSO4 is: 0.5,1.0,1.5,2.0,2.5,3.0,3.5 μ L.
Fig. 3 Bst archaeal dna polymerase is on the impact of LAMP.M:DL2000DNA Marker; The dosage that swimming lane 1-9 is corresponding in turn to Bst large fragment DNA polysaccharase is: 0,0.2,0.4,0.6,0.8,1.0,1.2,1.4,1.6 μ L.
Fig. 4 trimethyl-glycine is on the impact of LAMP.M:DL2000DNA Marker; The dosage that swimming lane 1-7 is corresponding in turn to trimethyl-glycine is: 0,1.0,2.0,3.0,4.0,5.0,6.0 μ L.
Fig. 5 temperature of reaction is on the impact of LAMP.M:DL2000DNA Marker; Swimming lane 1-8 is corresponding in turn to temperature of reaction: 58,59,60,61,62,63,64,65 DEG C.
The impact that Fig. 6 inner primer concentration is reacted LAMP.M:DL2000DNA Marker; The dosage that swimming lane 1-8 is corresponding in turn to inner primer concentration is: 0.4,1.2,1.6,2.0,2.4,2.8,3.2,3.6 μ L.
Fig. 7 does not add the impact in ring primer pair reaction times.M:DL2000DNA Marker, swimming lane 1-6 are corresponding in turn to and do not add the ring primer differential responses time and be: 15min, 30min, 45min, 60min, 75min, 90min..
The impact that Fig. 8 ring primer concentration reacts LAMP.M:DL2000DNA Marker; ; The dosage that swimming lane 1-9 is corresponding in turn to ring primer concentration is: 0,0.4,0.8,1.2,1.6,2.0,2.4,2.8,3.2 μ L.
Fig. 9 adds the impact in ring primer pair reaction times.M:DL2000DNA Marker, swimming lane 1-6 are corresponding in turn to and add the ring primer differential responses time and be: 10min, 20min, 30min, 40min, 50min, 60min.
Figure 10 AMV ThermoScript II is on the impact of RT-LAMP.M:DL2000DNA Marker; The dosage that swimming lane 1-6 is corresponding in turn to AMV ThermoScript II is: 0.1,0.2,0.3,0.4,0.5,0.6,0.7,0 μ L.
Figure 11 specific test, electrophoretogram.M:DL2000DNA Marker; EDV, TGEV, PoRV, CSFV, PRRSV, JEV, PRV of the amplification of 1-8:RT-LAMP method and the agarose gel electrophoresis result of negative control, RT-LAMP reaction tubes is taken a picture by gene genius biological imaging systems
Figure 12 specific test.M:DL2000DNA Marker; EDV, TGEV, PoRV, CSFV, PRRSV, JEV, PRV of the amplification of 1-8:RT-LAMP method and the agarose gel electrophoresis result of negative control, RT-LAMP reaction tubes is taken a picture by gene genius biological imaging systems.
Figure 13 RT-LAMP sensitivity test, electrophoretogram.M, Marker DL 2000; 1-9: use 10
1-10
9the agarose gel electrophoresis result of the amplified production of the RT-LAMP method of the positive RNA template of dilution; 10: negative control.
Figure 14 RT-LAMP sensitivity test, the video picture of reaction product under ultraviolet lamp.M, MarkerDL 2000; 1-9: use 10
1-10
9the agarose gel electrophoresis result of the amplified production of the RT-LAMP method of the positive RNA template of dilution; 10: negative control.
Embodiment
One, experiment material and instrument
Virus and main agents and material
Transmissible gastro-enteritis virus, Porcine epidemic diarrhea virus, porcine rotavirus (OSU strain), Pestivirus suis, pig breed with dyspnoea syndrome virus, encephalitis b virus, pig circular ring virus, PRV (Pseudorabies virus), preserve purchased from China Veterinary Drugs Supervisory Inst. or this laboratory.Escherichia coli DH5a, Reverse Transcription box, T7 in-vitro transcription test kit, restriction enzyme Nde I, EcoR I, Spe I, DNAse I etc. are purchased from the precious biological company limited in Dalian, plasmid Mini Kit, DNA gel recovery test kits etc. are purchased from Omega company, and RNA extracts test kit, 2 × PCR Mix (containing Taq archaeal dna polymerase, dNTPs, ddH
2o, MgCl
2), dNTPs, DNA Marker agarose etc. is purchased from the biochemical company limited of sky root, pGEM T-Easy Vector System I and AMV ThermoScript II purchased from Progema company, Bst DNA Polymerase (Large Fragment), 10 × ThermoPolBuffer, MgSO
4deng purchased from NEB company, trimethyl-glycine available from Sigma, Goldenview nucleic acid dye is purchased from the biological company limited in match Parkson, Beijing, and fluorexon fluorescence dye is purchased from Guangzhou Deaou Biotechnology Co., Ltd., designed primer delivers to the synthesis of Shanghai biotechnology company limited, 50 × TAE.
Key instrument equipment
MyCyclerTM PCR instrument, POWER Pac TM electrophoresis apparatus and Horizontal electrophoresis tank, UNIVERSAL HOOD gel imaging system, Smartspec
tMplus nucleic acid-protein instrument, liquid-transfering gun, U.S. BIO-RAD Products; Legend Micro 17R centrifuge high speed freezing centrifuge, constant-temperature shaking incubator, U.S. Thermo Products; WaterPro Plus ultrapure water instrument, U.S. LABCONCO Products; Electronic balance, thermostat water bath.
The preparation of embodiment 1 test kit of the present invention
1, material and instrument
With aforementioned experiment material and instrument.
2, experimental technique
2.1 primers and Template preparation
2.1.1 design of primers
The LAMP primer of design PEDV is in table 1.
Primer is as follows:
2.1.2 positive template preparation
By goal gene fragment (SEQ ID NO:7)
ATCTGTGAGAACCGCACTCGGATTACTCACAGCTGAGTAGTCGCCGTGTTTGGACCGGACATAGAAAGCCCAACCAGTGCCAGATGGAGCATTGACTGAACGACCAACACGTCCGTAGACAATTGTTGTAGTGGCCTTGGCGACTGTGACGAAATTAGGTAATTGACTTACCTGTACGCCAGTAGCAACCTTATAGCCCTCTACAAGCAATGTACCACTAAGGAGTGTTAGCGTTACACCAGTTGGTGCTCCAAGCACTGGAATGCAGACCTGTCGGCCCATCACAGAAGTAGTGAGAAGCGCGTCTGTTTCAGGATTGAAAGACCACCAAGAATGTGTCCTGCGCCACAACCGAATGCTATTGACAAAGTACATTATCCACAGCATAAGAGTGATGCAAGCCATAAGGATGCTGAAAGCAAAAAAGACCCAATTGACCTGAAAGCTAGCCCATGCATCAAAAAGTGACAGTGCTAACACAAGGGGCCAAAGTATCCATAGAATAGCCATCTTGACACCATACAAGAACGCAGAGTACTTGTAATGGCCATACTGAAGCACTACAAGTAGTATCGTCAGTATGATATTCCATGTGAAATTCCAGTTTCTAAGGTGTTG
AATCACCTCATCAA CGGGA
Connect the PGEM-T easy carrier comprising T7 and SP6RNA polymerase promoter, linked system sees the following form with reference to Promega pGEM T-Easy Vector System I specification sheets reaction system.
Reagent needed for table 1 object fragment connection PGEM-T carrier and consumption
Response procedures is: hatch 2h for 22 DEG C, and 4 DEG C are spent the night.
The foundation of the RT-LAMP detection method of 2.2PEDV
2.2.1 the optimization of reaction conditions and system
Initial setting RT-LAMP reaction conditions is 63 DEG C of reaction 60min, and in the 25 μ L reaction systems of 80 DEG C of reaction 10min, each component and content see the following form, and are supplemented to 25 μ L with deionized water.With prepared positive plasmid for template, undertaken organizing experiment by above-mentioned system, the reagent of required optimization is bought in advance and prepares, and is made into corresponding concentration, facilitates application of sample when condition optimizing, reduces certain workload more.DNTPs (10mmol/L), MgSO4 (100mmol/L), trimethyl-glycine (5mol/L), Bst archaeal dna polymerase (8U/ μ L), the mixed final concentration of inner primer FIP, BIP (25pmol/L), the mixed final concentration of outer primer F3, B3 (2.5pmol/L), the mixed final concentration of ring primer LF, LB (12.5pmol/L), AMV ThermoScript II concentration (10U/ μ L), with the reagent dosage of above-mentioned reagent concentration optimizing reaction system and the anti-reaction conditions of the best, to determine each reagent optimum response concentration.
Because discernable by eye is limited in one's ability, colour-change, turbidity change etc. according to SYBR Green I, fluorexon indicator can not the susceptibility of accurate interpretation reaction, thus the condition optimizing of this test judge to react according to agarose gel electrophoresis result in the reagent optimum quantum of utilization of each individual system.Reaction product is analyzed in the agarose gel electrophoresis of 20g/L, selects optimum reaction condition.Along with the carrying out of condition optimizing, each is all from selected reagent optimum amount and optimum reaction condition repeatedly revision test, when carrying out next condition optimizing, select last top condition and reagent dosage, to the last a condition and reagent dosage have been optimized by that analogy.
The optimization of dNTPs optimum concn: add 0.5,1.0,1.5,2.0,2.5,3.0,3.5,4.0 μ L respectively; MgSO4 optimum concn is optimized: add 0,0.5,1.0,1.5,2.0,2.5,3.0,3.5 μ L respectively; Bst large fragment DNA polysaccharase optimum concn is optimized: 0,0.2,0.4,0.6,0.8,1.0,1.2,1.4,1.6 μ L; Trimethyl-glycine optimum concn is optimized: add 0,1.0,2.0,3.0,4.0,5.0,6.0 μ L respectively; Optimum temps is optimized: be respectively 58,59,60,61,62,63,64,65 DEG C; Inner primer FIP, BIP concentration optimization: add 0.4,0.8,1.2,1.6,2.0,2.4,2.8,3.2 μ L respectively; Optimum reacting time is optimized: be respectively 15,30,45,60,75,90min; Ring primer LF, LB concentration optimization: add 0.4,0.8,1.2,1.6,2.0,2.4,2.8,3.2 μ L respectively, the reaction times reduces to 30min; Add the optimization of ring primer optimum reacting time: 10,20,30,40,50,60min; AMV ThermoScript II optimum concn is optimized: on the basis that above optimum result is tested, carry out the optimization of AMV ThermoScript II with prepared viral RNA template, the scope of AMV ThermoScript II is set to 0.1-0.7 μ L, increases progressively with 0.1.
2.2.2 the assembling of test kit
2.2.2.1RT-LAMP detection method condition optimizing result
Comprise the best pH value of 10 × T Buffer and consumption, the MgSO of dNTPs, 100mmol/L of 10mmol/L
4, the outer primer of 5pmol/L, the inner primer of 50pmol/L, the Bst large fragment DNA polysaccharase of 8U/ μ L, the trimethyl-glycine of 5mol/L, optimum temps, do not add the ring primer reaction times, add ring primer after reaction times, 10U/ μ L the consumption of AMV ThermoScript II.
2.2.2.2 test kit assembling
After the optimization completing RT-LAMP reaction system and condition, re-start purchase again and the preparation of all reagent, carry out preparation and the assembling of the reagent of test kit by the system optimized.
3, experimental result
The optimization of 3.1dNTPs optimum concn
Along with the increase of dNTPs amount, the brightness of band increases, and when dNTPs is increased to 3 μ L, slowly weakens (Fig. 1) along with dNTPs continues to increase band brightness.This test determines that the optimum amount of the dNTPs of 10mmol/L is 2.5 μ L, and reaction final concentration is 1mmol/L.
3.2MgSO
4optimum concn is optimized
Work as Mg
2+consumption there is obvious inhibited reaction more than 2.0 μ L, the brightness of amplified band obviously weakens, and adds appropriate Mg
2+enzyme can be made to reach the highest catalytic activity and do not affect the synthesis (Fig. 2) of DNA.This test-results also shows, cannot cannot distinguish negative amplified reaction when amplified reaction is less by visual inspection turbidity.The MgSO of 100mmol/L is determined in this test
4optimum amount be 1 μ L, reaction final concentration is 4mmol/L.
3.3Bst large fragment DNA polysaccharase optimum concn is optimized
Test-results shows that enzyme adds 0.2 μ L reaction and just can carry out, but band is darker, along with the consumption of enzyme increases, the DNA amount of synthesis also increases, the tetra-sodium generated also increases, as can be seen from the turbidity of reaction tubes also, and just can to see obvious muddiness when enzyme is added to 0.8 μ L, but cannot cannot distinguish negative amplified reaction by visual inspection turbidity when amplified reaction is less, 0 and 0.2 μ L enzyme dosage naked eyes difference cannot have amplification (Fig. 3).Electrophoresis result shows when enzyme dosage there is no showed increased higher than its amplified production during 0.6 μ L, and because the price of enzyme is somewhat expensive, this test determines that the consumption of the enzyme of 8U/ μ L is 0.8 μ L.
3.4 trimethyl-glycine optimum concns are optimized
Trimethyl-glycine has the effect reducing non-specific amplification, increase the effect of the efficiency of DNA cloning, test-results shows that trimethyl-glycine is not necessary to LAMP reaction, can find out that not adding trimethyl-glycine also can increase from result, but the amount lower (Fig. 4) of amplification.This test determines that the consumption of the trimethyl-glycine of 5mol/L is 3 μ L, and optimum response concentration is 0.6M.
3.5 optimum temps optimizations
Test-results shows, LAMP all can react at 58-65 DEG C, the electrophoretic band of the amplified reaction when 59-64 DEG C without obvious difference, the electrophoretic band relatively light (Fig. 5) of the amplified reaction of 58 and 65 DEG C.This test determine react temperature be 63 DEG C to carry out follow-up test.
3.6 inner primer concentration optimizations
The result optimized shows, inner primer consumption is that 0.4 μ L just has good expanding effect, does not have primer dimer phenomenon, primer complete reaction is described; Brighter amplified band is just had during 1.2 μ L, and without primer diastereomerism; Along with primer and amount increase, the band of amplification is more and more brighter, obviously reduces until primer amount is 2.8,3.2 μ L amplified band brightness, and primer dimer phenomenon is serious, occurs obvious inhibited reaction (Fig. 6).This test determines that the consumption of inner primer FIP, BIP of 25pmol/L is 1.2 μ L.
3.7 time-optimized
Amplified production amount and proliferation time have direct relation, and proliferation time is more of a specified duration, and amplified production is more, as can be seen from test electrophorogram, just occur obvious band at 30min, along with instead with regard to carrying out, the brightness of band is also more and more brighter (Fig. 7).This test determines that optimum reacting time is 60min.
3.8 ring primer concentrations are optimized
Can obviously be found out by electrophorogram, the amplified band not adding the control group of ring primer obviously adds the low lightness of ring primer than other, but ring primer consumption to reaction without too much influence (Fig. 8).This test determines that the consumption of the ring primer of 12.5pmol/L is 0.8 μ L.
3.9 add the optimization of ring primer optimum reacting time
Add ring primer and have obvious difference with the reaction times not adding ring thing, only need 10min just can occur obvious amplified band after adding ring primer, after 20min, the brightness of band reaches maximum and along with the brightness of the increase band in reaction times is without significantly change (Fig. 9).This test determines that optimum reacting time is 30min.
3.10AMV ThermoScript II optimum concn is optimized
The consumption of AMV ThermoScript II directly has influence on the synthesis of cDNA, the too little synthesis affecting reaction dna of consumption, cannot carry out without AMV ThermoScript II RT-LAMP, the consumption of AMV ThermoScript II is larger, the DNA of amplification is also larger, but expensive due to AMV ThermoScript II, this test determines that the consumption of the AMV ThermoScript II of 10U/ μ L is 0.5 μ L (Figure 10).
3.11 test kit
According to said structure, preferably in 25 μ L reaction systems:
The dNTPs 2.5 μ L of 10mmol/L;
The MgSO of 100mmol/L
41.0 μ L;
The outer primer 1 μ L of 5pmol/L;
The inner primer 0.6 μ L of 50pmol/L;
Bst large fragment DNA polysaccharase consumption is greater than 0.8 μ L;
The trimethyl-glycine 3 μ L of 5mol/L;
The AMV ThermoScript II consumption 0.5 μ L of 10U/ μ L;
10 × T Buffer pH value is 8.76, and consumption is 3.0 μ L.
Optimum temps 63 DEG C, not add the ring primer reaction times be 60min, and adding the ring primer reaction times is 30min.
Add ddH
2o complements to 25 μ L.
Embodiment 2 specificity experiments
One, test method
Extract the nucleic acid of TGEV, PEDV, PoRV, CSFV, PRRSV, JEV and PRV, carry out RT-LAMP detection by the optimal conditions of embodiment 1, check its specificity, if DEPC process water is as negative control.
Two, result
Experimental result such as Figure 11 ~ 12 adopt the inventive method to detect, PEDV is only had just to have positive findings, agarose gel electrophoresis presents scalariform band, reaction product is the reaction of visible significantly green fluorescence under ultraviolet lamp, and TGEV, PoRV, PEDV, CSFV, PRRSV, JEV and PRV detection is feminine gender, agarose gel electrophoresis is without scalariform band, and reaction product is redgreen fluorescent reaction under ultraviolet lamp.
The inventive method only can detect PEDV virus, can not detect other virus, the high specificity of primer of the present invention and test kit is described.
Embodiment 3 sensitivity test
One, test method
By prepared positive RNA template DEPC process water dilution, the RNA concentration adjusting PEDV is respectively 1.5 × 10
8copies/ μ L, by template 10 times of gradient dilutions, carries out RT-LAMP detection by the optimal conditions of embodiment 1, carries out sensitivity test, simultaneously using DEPC process water as negative control.
Two, result
As shown in Figure 13 ~ 14, carry out detection show the positive RNA template of 10 times of gradient dilutions, 1-7 swimming lane all has obvious scalariform band and reaction product under ultraviolet lamp, have obvious green fluorescence to react, and the RT-LAMP of PEDV can detect 10
7the doubly prepared positive RNA template of dilution, i.e. the sample of 15copies/ μ L.
Experimental result illustrates, the minimal detectable concentration adopting test kit of the present invention to detect PEDV is 15copies/ μ L, highly sensitive.
Embodiment 4 clinical detection
1, experimental technique
Fetch and deliver 31 parts of clinical pathological material of diseases of diarrhoea of inspection, carry out RT-LAMP method by the optimal conditions of embodiment 1 and detect, sample message sees the following form:
Table 2 sample statistics table
2, experimental result
As shown in table 3 below:
A table 3 sample detection result
| Censorship ground | Detect number | Result P+ |
| Mianyang | 5 | 5 |
| Mao County | 4 | 3 |
| Shehong | 5 | 5 |
| Pujiang | 4 | 4 |
| Leshan | 5 | 5 |
| Dayi | 4 | 4 |
| Anyue | 4 | 0 |
| Sum | 31 | 26 |
In 31 parts of clinical samples, 26 parts of PEDV positives.
Experimental result illustrates, test kit of the present invention can be used for clinical detection.
To sum up, test kit of the present invention can detect Porcine epidemic diarrhea virus simultaneously, high specificity, highly sensitive, consuming time short, detects fast, has a good application prospect.
Claims (10)
1. detect a test kit for Porcine epidemic diarrhea virus, it is characterized in that: it comprises primer shown in SEQ ID NO:1 ~ 4, for the gene of ring mediated isothermal amplification Porcine epidemic diarrhea virus.
2. test kit according to claim 1, is characterized in that: described test kit also comprises primer shown in SEQ ID NO:5 ~ 6.
3. test kit according to claim 1, is characterized in that: described test kit also comprises the gene fragment shown in SEQ ID NO:7.
Primer shown in 4.SEQ ID NO:1 ~ 4 detects the purposes in the reagent of Porcine epidemic diarrhea virus in preparation.
5. purposes according to claim 4, is characterized in that: the reagent of described detection Porcine epidemic diarrhea virus is the reagent of the gene of ring mediated isothermal amplification Porcine epidemic diarrhea virus.
6. the purposes according to claim 4 or 5, is characterized in that: described reagent also comprises primer shown in SEQ ID NO:5 ~ 6.
7. purposes according to claim 4, is characterized in that: described reagent also comprises the gene fragment shown in SEQ ID NO:7.
The purposes of primer shown in 8.SEQ ID NO:1 ~ 4 in the reagent of gene preparing ring mediated isothermal amplification Porcine epidemic diarrhea virus.
9. purposes according to claim 8, is characterized in that: described reagent also comprises primer shown in SEQ ID NO:5 ~ 6.
10. purposes according to claim 8, is characterized in that: described reagent also comprises the gene fragment shown in SEQ ID NO:7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510058622.4A CN104630387B (en) | 2015-02-04 | 2015-02-04 | The LAMP detection kit of Porcine epidemic diarrhea virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510058622.4A CN104630387B (en) | 2015-02-04 | 2015-02-04 | The LAMP detection kit of Porcine epidemic diarrhea virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104630387A true CN104630387A (en) | 2015-05-20 |
| CN104630387B CN104630387B (en) | 2017-07-18 |
Family
ID=53209631
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510058622.4A Active CN104630387B (en) | 2015-02-04 | 2015-02-04 | The LAMP detection kit of Porcine epidemic diarrhea virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104630387B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105177179A (en) * | 2015-08-11 | 2015-12-23 | 河北农业大学 | RT-LAMP (reverse transcription loop-mediated isothermal amplification) primer set and kit for detecting porcine epidemic diarrhea virus and application thereof |
| CN105349707A (en) * | 2015-12-16 | 2016-02-24 | 广西壮族自治区兽医研究所 | RT-LAMP (reverse transcriptase loop-mediated isothermal amplification) kit for porcine epidemic diarrhea viruses and applications thereof |
| CN108950072A (en) * | 2018-07-30 | 2018-12-07 | 珠海出入境检验检疫局检验检疫技术中心 | A kind of Porcine epidemic diarrhea virus fluorescence LAMP primer group, kit and detection method |
| CN112094945A (en) * | 2020-08-20 | 2020-12-18 | 宁波爱基因科技有限公司 | Primer and kit for efficiently detecting porcine epidemic diarrhea virus |
| CN112760418A (en) * | 2021-01-30 | 2021-05-07 | 福建傲农生物科技集团股份有限公司 | Primer and kit for porcine epidemic diarrhea virus and application of primer and kit |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103276103A (en) * | 2013-04-27 | 2013-09-04 | 华南农业大学 | Kit with RT-LAMP nucleic acid test strips for detecting porcine epidemic diarrhea virus and applications of kit |
-
2015
- 2015-02-04 CN CN201510058622.4A patent/CN104630387B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103276103A (en) * | 2013-04-27 | 2013-09-04 | 华南农业大学 | Kit with RT-LAMP nucleic acid test strips for detecting porcine epidemic diarrhea virus and applications of kit |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105177179A (en) * | 2015-08-11 | 2015-12-23 | 河北农业大学 | RT-LAMP (reverse transcription loop-mediated isothermal amplification) primer set and kit for detecting porcine epidemic diarrhea virus and application thereof |
| CN105349707A (en) * | 2015-12-16 | 2016-02-24 | 广西壮族自治区兽医研究所 | RT-LAMP (reverse transcriptase loop-mediated isothermal amplification) kit for porcine epidemic diarrhea viruses and applications thereof |
| CN108950072A (en) * | 2018-07-30 | 2018-12-07 | 珠海出入境检验检疫局检验检疫技术中心 | A kind of Porcine epidemic diarrhea virus fluorescence LAMP primer group, kit and detection method |
| CN112094945A (en) * | 2020-08-20 | 2020-12-18 | 宁波爱基因科技有限公司 | Primer and kit for efficiently detecting porcine epidemic diarrhea virus |
| CN112760418A (en) * | 2021-01-30 | 2021-05-07 | 福建傲农生物科技集团股份有限公司 | Primer and kit for porcine epidemic diarrhea virus and application of primer and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104630387B (en) | 2017-07-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104630387A (en) | LAMP detection kit for porcine epidemic diarrhea virus | |
| CN107299155A (en) | A kind of primer and probe of goose astrovirus real-time fluorescence quantitative PCR detection | |
| Kuo et al. | Real-time quantitative PCR assay for monitoring of nervous necrosis virus infection in grouper aquaculture | |
| CN109735657A (en) | A kind of reagent, detection method and application for African swine fever virus detection | |
| CN101768641B (en) | Primer and probe for LAMP-LFD detecting of listonella anguillarum | |
| CN113234814B (en) | Multiplex RPA primer and probe composition for simultaneously detecting acute hepatopancreatic necrosis and hepatoenterosporidium of shrimp and detection method | |
| CN106048022A (en) | Kit for detecting enterocytozoonhepatopenaei | |
| CN105316422A (en) | Kit for rapidly detecting pathogeny of acute hepatopancreatic necrosis disease of prawns and application of kit | |
| CN104611466A (en) | Molecular kit for rapidly identifying three types of piglet virus diarrhea and application of molecular kit | |
| CN105349707A (en) | RT-LAMP (reverse transcriptase loop-mediated isothermal amplification) kit for porcine epidemic diarrhea viruses and applications thereof | |
| CN105112565A (en) | LAMP detection method for detecting pseudorabies virus GE gene | |
| CN103484571A (en) | LAMP (loop-mediated isothermal amplification) detection primer group, detection kit and detection method for infectious hypodermal and hematopoietic necrosis virus | |
| CN103276103B (en) | Kit with RT-LAMP nucleic acid test strips for detecting porcine epidemic diarrhea virus and applications of kit | |
| CN102399909B (en) | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) visual kit for detecting Japanese B encephalitis virus and application of kit | |
| CN109439775A (en) | A kind of multi-PCR detection method of porcine pathogen | |
| CN103451315B (en) | Loop-mediated isothermal amplification detection primer set and kit for rotaviruses as well as detection method | |
| CN103952496B (en) | A kind of duplex PCR method detecting transmissible gastro-enteritis virus and Porcine epidemic diarrhea virus | |
| CN108504782A (en) | Primer combination for 4 boar infectious disease viruses of synchronous detection and detection kit | |
| CN103333903A (en) | Target sequence, primer and probe for detecting helicobacter pylori and kit thereof | |
| CN104988246A (en) | Eriocheir sinensis white spot syndrome virus specificity PCR detection kit and method | |
| CN101381767B (en) | Universal real time fluorescent PCR detection method of trichinella | |
| CN101225440B (en) | Detection method of leptospira | |
| CN114015813A (en) | Method and kit for identifying African swine fever virus based on RPA (reverse transcriptase amplification) isothermal amplification technology | |
| CN101575651A (en) | LAMP detection kit of porcine parvovirus and detection method thereof | |
| CN101906482B (en) | Kit for diagnosing reovirus genes of grass carps and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |