KR101987852B1 - Primer set for diagnosing infection of Enterocytozoon hepatopenaei and diagnosis kit comprising the same - Google Patents

Abstract

TECHNICAL FIELD The present invention relates to a primer set for diagnosing infection with Enterocytozoon hepatopenaei, which is a microporous insect , and a diagnostic method using the primer set. More particularly, the present invention relates to a primer set for diagnosing infection with Enterocytozoon hepatopenaei which is excellent in sensitivity and specificity, The present invention relates to a primer set capable of detecting a weak level of infection.

Description

[0001] The present invention relates to a primer set for the detection of an infectious microorganism Enterocytozoon hepatopenaei infection and a diagnostic kit comprising the same,

The present invention relates to an EHP beta-tubulin base sequence-based microporous enterocytozone hepatophenae hepatopenaei ) infection, and a diagnostic method using the primer set.

Microporosites are intracellular parasites that infect hosts with major animals, including crustaceans or fish. Of these, Enterocytozoon hepatopenaei ( EHP) is an infectious microorganism that infects barley shrimp, which is a serious economic loss to many Asian shrimp farms and is considered a significant threat to shrimp aquaculture. Enterococci hepatopenia (EHP) infects organs such as the liver pancreas and the middle bowel and affects digestion and absorption, causing growth retardation. However, there is currently no specific clinical finding for EHP infection, and it is difficult to monitor the presence of EHP and manage shrimp farms affected by EHP.

Depending on the characteristics of the microstructure, the enterotoxin hepatophenae (EHP) can be expressed by a combination of enterocytosoonidae, Apansporoblastina, Microsporidia, Fungi, , And this classification is backed by phylogenetic studies based on small subunit rRNA (SSU rRNA). Many of the EHP diagnostic methods have been developed based on SSU rRNA, such as PCR, real-time PCR, in situ hybridization and LAMP (loop mediated isothermal amplification) analysis, Identification is not specific and SSU rRNA-based PCR methods show false positives in non-shrimp samples. For example, the SSU rRNA sequence shows 90% similarity with Enterospora canceri infecting lobsters . Therefore, a more specific PCR method is required for the diagnosis of enterocytosis hepatophenae (EHP).

CN 106636471 A CN 106591474 A CN 104928288 A

 2007. Analysis of the β-tubulin genes from Enterocytozoon bieneusi isolates from a human and rhesus macaque. Jpn. . J. Eukaryot. Microbiol. 54, 38-41.  Bateman, K.S., Wiredu-Boakye, D., Kerr, R., Williams, B.A.P., Stentiford, G. D., 2016. Single and multi-gene phylogeny of Hepatospora (Microsporidia) - a generalist pathogen of farmed and wild crustacean hosts. Parasitology 143, 971-982.  A nested PCR assay to avoid false positive detection of the microsporidian Enterocytozoon hepatopenaei (EHP) was carried out in the same manner as described in Example 1, ) in environmental samples in shrimp farms. PLoS ONE 11, e0166320.  Katoh, K., Toh, H., 2008. Recent developments in the MAFFT multiple sequence alignment program. Brief. Bioinform. 9, 286-298.  Kumar, S., Stecher, G., Tamura, K., 2016. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870-1874.  Liu, Z., Zhang, Q. L., Wan, X. Y., Ma, F., Huang, J., 2016. Development of real-time PCR assay for detecting microsporidian Enterocytozoon hepatopenaei and the application of shrimp samples with different growth rates. Prog. Fish. Sci. 37, 119-126 (in Chinese, English Abstract).  Minh, B. Q., Nguyen, M. A. T., von Haeseler, A., 2013. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 30, 1188-1195.  Nguyen, L.T., Schmidt, H. A., von Haeseler, A., Minh, B. Q., 2015. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 32, 268-274.  S., Hawkins, J., Corradi, N., 2015. Morphology and phylogeny of Agasoma penaei (Microsporidia) from the type host, Litopenaeus setiferus, and type locality, Louisiana, USA. Int. J. Parasitol. 45, 1-16.  Sritunyalucksana, K., Sanguanrut, P., Salachan, P. V., Thitamadee, S., Flegel, T.W., 2015. Urgent appeal to control spread of the shrimp microsporidian parasite Enterocytozoon hepatopenaei (EHP). Network of Aquaculture Centers in Asia-Pacific (NACA) (www.enaca.org).  Stentiford, G. D., Feist, S. W., Stone, D. M., Bateman, K. S., Dunn, A. M., 2013. Microsporidia: diverse, dynamic, and emergent pathogens in aquatic systems. Trends Parasitol. 29, 567-578.  Suebsing, R., Prombun, P., Srisala, J., Kiatpathomchai, W., 201. Loop-mediated isothermal amplification combined with colorimetric nanogold detection of the microsporidian Enterocytozoon hepatopenaei in penaeid shrimp. J. Appl. Microbiol. 114, 1254-1263.  Tang, K. F., Aranguren, L. F., Piamsomboon, P., Han, J. E., Maskaykina, I. Y., Schmidt, M.M., 2017. Detection of the microsporidian Enterocytozoon hepatopenaei (EHP) and Taura syndrome virus in Penaeus vannamei cultured in Venezuela. Aquaculture 480, 17-21.  Dans populations of the microsporidian Enterocytozoon hepatopenaei (EHP) were found to be similar to those of E. coli. In addition, TFI, KF, Han, JE, Aranguren, LF, White-Noble, B., Schmidt, MM, Piamsomboon, P., Risdiana, E., Hanggono, in feces of Penaeus vannamei exhibiting white feces syndrome and pathways of their transmission to healthy shrimp. J. Invertebr. Pathol. 140, 1-7.  Tong, KF, Pantoja, CR, Redman, RM, Han, JE, Tran, LH, Lightner, DV, 2015. Development of in situ hybridization and PCR assays for detection of Enterocytozoon hepatopenaei (EHP), a microsporidian parasite infecting penaeid shrimp . J. Invertebr. Pathol. 130, 37-41.  The microsporidian Enterocytozoon hepatopenaei is isoforms are known to be involved in the development of the microsporidian Enterocytozoon hepatopenaei is, not the cause of white feces syndrome in whiteleg shrimp Penaeus (Litopenaeus) vannamei. BMC Vet. Res. 9, 139-148.

In order to solve the above problem, in the present invention, an EHP-beta-tubulin base (EHP) is added to improve the specificity and sensitivity of detection of enterokinase hepatophene (EHP) (EHP) infection based on sequence-based primers and a diagnostic method using the primer set.

One aspect of the present invention includes primer set 1 (EHP-947F and EHP-947R) represented by the nucleotide sequences of SEQ ID NOS: 1 and 2, primer set 2 represented by the nucleotide sequences of SEQ ID NOS: 3 and 4 (EHP-618F and EHP (EHP-2318R), which comprises at least one nucleotide sequence selected from the group consisting of primers set 3 (EHP-237F and EHP-237R) represented by SEQ ID NOS: 5 and 6, , Enterocytozoon hepatopenaei ) infection, and the primer set 1, 2 or 3 is used for the amplification of β-tubulin of microporosid.

The primer set 1, 2 or 3 is characterized by amplifying beta-tubulin of microporous insect, and the microporous enterotoxin hepatophenae (EHP) It is especially desirable to diagnose infections of shrimp farms.

Another aspect of the present invention provides a kit for diagnosing microporosal infection of aquacultural shrimp using the primer set.

The primer set according to the present invention is more excellent in sensitivity and specificity than the conventional PCR method, and simple and rapid diagnosis is possible. In addition, it is possible to detect the infectious state of the enterotoxin hepatophene A (EHP) at a slight level.

Fig. 1 is a systematic view of an EHP β-tubulin fragment gene-based system.
Figure 2 is an amplicon generated by primary and secondary PCR methods.
Figure 3 shows the results of EHP diagnosis and detection of (a) primer set 2 (EHP-618F / R) and (b) secondary nested-PCR using primer set 3 (EHP-237F / R).

Hereinafter, a primer set for the detection of infectious microorganism Enterococcus hepatopenaei (EHP) infection and a diagnostic method using the primer set will be described in detail. In the following description of the present invention, a detailed description of known functions and configurations incorporated herein will be omitted when it may make the subject matter of the present invention rather unclear.

Unless otherwise defined, all technical terms used in the present invention have the following definitions and are consistent with the meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

The term "primer " in the present invention means a short-lived gene sequence complementary to a specific gene sequence, and functions as a starting point for DNA synthesis.

The term "polymerase chain reaction (PCR) " in the present invention means a technique of amplifying a specific DNA region using a DNA polymerase. The PCR is basically composed of three steps of denaturation, binding, and extension. In the denaturation step of the first step, the template DNA is separated into a single strand. In the second step, the two primers are complementary to each other in the single strand DNA is cloned by the DNA polymerase in the third step, the extension step.

Unless defined otherwise, all terms (including technical and scientific terms) used herein may be used in a sense commonly understood by one of ordinary skill in the art to which this invention belongs. Also, commonly used predefined terms are not ideally or excessively interpreted unless explicitly defined otherwise.

Hereinafter, the present invention will be described in more detail with reference to examples. However, the following examples are intended to illustrate the present invention, and the scope of the present invention is not limited thereto.

In order to confirm the diagnosis of EHP infection of a primer set for detecting EHP ( Enterocytozoon hepatopenaei ) infection of the present invention, 22 samples of P. vannamei-infected P. vannamei (EHP) gene was detected by histopathological examination and SSU rRNA - based PCR analysis, and the infection was detected.

Table 1 below shows the Enterococcus hepatophenae (EHP) -infected shrimp samples used for PCR analysis.

host
(organism) origin Collection year Histopathology PCR analysis SSU rRNA β-tubulin Primary PCR Secondary PCR CJ1402-5
(n = 4) P. vannamei Vietnam 2014 - + + + CJ17171-9
(n = 9) P. vannamei India 2015 + + + + CJ1501
(n = 1) P. vannamei Indonesia 2015 + + + + CJ1611-7
(n = 7) P. vannamei Thailand 2016 + + + + CJ17177
(n = 1) P. vannamei Vietnam 2015 + + + + CJ17142-7
(n = 5) Artemia United States of America 2014 - + - + CJ17145
(n = 1) Artemia United States of America 2015 - + - +

Example  One. primer  Design and gene amplification

DNA was extracted from the hepatic pancreas of shrimp (n = 22) infected with Enterococcus hepatopenae (EHP) using QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) and stored at -20 ° C until use.

First, two microsporidia species closely related to the enterotoxin hepatophenae (EHP) β-tubulin gene sequence, Hepatospora infecting Chinese crabs Primer set 1 (EHP-947F / R) was designed from the eriocheir and human-infecting E. bieneusi β-tubulin sequences. Then, P. vannamei isolated from Indonesian samples (CJ1501) was used as a template and the initial denaturation at 94 DEG C for 3 minutes, the final extension at 94 DEG C for 30 seconds, at 53 DEG C for 30 seconds, at 72 DEG C for 1 minute, at 72 DEG C for 7 minutes (EHP) β-tubulin was amplified by PCR using PuReTaq Ready-To-Go PCR beads (GE Healthcare, Little Chalfont, UK). After PCR, the PCR product was analyzed on a 1.5% agarose gel containing ethidium bromide. The positive PCR amplified product was purified and sequenced.

Table 2 below shows PCR primers for EHP detection.

Primer Sequence (5 'to 3') Amplicon size (bp) Reference ssrRNA EHP-510F GCCTGAGAGATGGCTCCCACGT 510 Tang et al. (2015) EHP-510R GCGTACTATCCCCAGAGCCCGA β-tubulin sequence EHP-947F GGTAATAATTGGGCTAAAGGT 947 Invention EHP-947R GCTTCAGCCTCAGTAAATTC β-tubulin primary PCR EHP-618F CAGCTGGTTGAAAATGCAAA 618 Invention EHP-618R GTGCAAAAATGCCTTTCGTT β-tubulin secondary PCR EHP-237F GATATGCGCCTCTGTGTTCA 237 Invention EHP-237R TGTTTGGAATCCACTCGACA

Example  2. Nested PCR

DNA extracted from the shrimp samples (n = 22) infected with EHP collected from four countries (Vietnam, India, Thailand and Indonesia) for detection of Enterococcus hepatopenae (EHP) DNA of EHP positive Artemia spp. (N = 6) (KP759285) and shrimp P. vannamei (n = 8), which was not infected with enterotoxin hepatophene A (EHP) 5), P. monodon (n = 3), P. indicus (n = 2), P. stylirostri (n = 2), Macrobrachium rosenbergii (n = 2), Artemia spp. (n = 9) was used as a template.

The first PCR was carried out using Primer Set 2 (EHP-618F / R) at 94 ° C for 3 minutes, followed by 35 cycles at 94 ° C for 30 seconds, 58 ° C for 30 seconds, and 72 ° C for 30 seconds, The final extension was carried out at 72 ° C for 7 minutes.

In order to increase sensitivity, nested-PCR was performed with primer set 3 (EHP-237F / R), and 1 μl of the first PCR product was used as a template and denatured for 3 minutes at 94 ° C., 30 seconds at 58 占 폚 for 30 seconds, 20 cycles at 72 占 폚 for 30 seconds, and 72 占 폚 for 7 minutes. In order to determine the detection limit of Nested-PCR, DNA (100 ng / μl) of shrimp (CJ1501) infected with EHP was continuously diluted (10-fold dilution, 10 ^-1 to 10 ^{- 5} ) and amplified by nested-PCR.

As a result, the β-tubulin gene fragment (870 bp, KX842357) was successfully amplified and the nucleotide sequence from the EHP strain obtained in Indonesia using primer set 1 (EHP-947F / R) Respectively. The nucleotide sequence obtained from the BlastN search was β-tubulin (EHP) of the enterotoxin hepatophenae (EHP) strain obtained in Vietnam (KY593130) and Thailand (KY593131) And 100% identity with the nucleotide sequence. β-tubulin The nucleotide sequence is identical to the entire genome sequence (MNPJ00000000) of the Enterococcus hepatopenae isolate (EHP) isolate from Thailand (Wiredu Boakye et al., 2017), and two other microsporidia infecting humans, E. bieneusi H206 (DQ242639 ) And E. bieneusi M231 (DQ242640) with 75% nucleotide sequence identity and 94% amino acid sequence identity.

As shown in FIG. 2 (a) and FIG. 2 (b), 618 bp from all the EHP strains (n = 22) in four countries (Indonesia, Thailand, Vietnam and India) Amplification product was generated. Second PCR using these 22 samples as a template yielded amplified product of 237 bp in size. Primary PCR was performed using EHP positive Artemia spp. No amplicons were produced in the sample (n = 22), which is believed to be due to a weak infection. In contrast, as shown in Fig. 2 (c), after the second nested-PCR, Artemia spp. A strong DNA fragment of 237 bp was observed in all the EEH samples, including the sample (CJ17142-CJ17147). The detection limit was increased 10-100 fold in the nested-PCR step and lower detection limits were determined with 100 pg template DNA (FIG. 3). The primers were specific for enterocytosine hepatophenae (EHP) and did not amplify the genomic DNA of healthy P. vannamei , P. monodon , P. indicus , P. stylirostris , M. rosenbergii and Artemia spp. As described above, since the β-tubulin gene sequence is conserved in the genetically mutated Enterococcus hepatopenae (EHP) strain, it is confirmed that the β-tubulin gene is suitable as a detection target for the diagnosis of the mutation.

2. Phylogenetic analysis

A phylogenetic analysis was performed to investigate the relationship between EHP and other microbial strains. For this purpose, the EHP and E. bieneusi β-tubulin sequences and GenBank Were identified by MAFFT 7.110 (Katoh and Toh, 2008), and the phylogenetic tree was reconstructed using two methods.

First, the neighbor-joining (NJ) tree was analyzed using the Jukes-Cantor distances matrix implemented in MEGA ver.7 (Kumar et al., 2016) and the stability of the tree was assessed by performing 1,000 bootstrap replicas.

Second, the phylogenetic model was tested, and the maximum-likelihood (ML) tree survey and its bootstrap analysis were performed with 1,000 replicates (-bb 1,000) (Minh et al., 2013; Nguyen et al., 2015) And the conventional β-tubulin sequence (AY167990 and BC029529) was used as an outgroup.

As a result, the enterotoxin hepatophene A (EHP) in the ML tree phylogenetic tree was placed in a unique branchstrap support 100 (Fig. 1) and was most closely related to the E. bieneusi isolate. In addition, the Enterococcus hepatopenae (EHP) is the only known species of fungi used for phylogenetic analysis to infect crustacean hosts Agmasoma penaei (KJ579183) and Hepatospora eriocheir (KU695718 and KU695720). A. penaei was obtained from white shrimp P. setiferus (Sokolova et al., 2015), and H. eriocheir was obtained from Chinese crepe Eriocheir sinensis ) (Bateman et al., 2016). SSU rRNA-based phylogeny has been classified as E. bieneusi (Stentiford et al., 2013; Tourtip et al., 2009) and clustered enterotoxin hepatophenea (EHP).

Through the above examples, the nested-PCR using the primer set of the present invention is superior to the one-step PCR and has a weaker level of detection of the infectious state of the Enterococcus hepatopenae (EHP) .

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments. Accordingly, the embodiments disclosed herein are intended to be illustrative rather than limiting, and the spirit and scope of the present invention is not limited by these embodiments. The scope of protection of the present invention should be construed according to the following claims, and all the techniques within the scope of equivalents should be construed as falling within the scope of the present invention.

<110> KRIBB <120> Primer set for diagnosing infection of Enterocytozoon          hepatopenaei and diagnosis kit comprising the same <130> M18-5153 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> RNA <213> Enterocytozoon hepatopenaei <400> 1 ggtaataatt gggctaaagg t 21 <210> 2 <211> 20 <212> RNA <213> Enterocytozoon hepatopenaei <400> 2 gcttcagcct cagtaaattc 20 <210> 3 <211> 20 <212> RNA <213> Enterocytozoon hepatopenaei <400> 3 cagctggttg aaaatgcaaa 20 <210> 4 <211> 20 <212> RNA <213> Enterocytozoon hepatopenaei <400> 4 gtgcaaaaat gcctttcgtt 20 <210> 5 <211> 20 <212> RNA <213> Enterocytozoon hepatopenaei <400> 5 gatatgcgcc tctgtgttca 20 <210> 6 <211> 20 <212> RNA <213> Enterocytozoon hepatopenaei <400> 6 tgtttggaat ccactcgaca 20

Claims (5)

Primer set 1 (EHP-947F & EHP-947R) represented by the nucleotide sequences of SEQ ID NOS: 1 and 2; Primer set 2 (EHP-618F & EHP-618R) represented by the nucleotide sequences of SEQ ID NOS: 3 and 4; And SEQ ID NO: 5 and 6, the primer set 3 (EHP-237F & EHP- 237R) represented by; County US Cryptosporidium the Enterobacter Saito zone HEPA Sat Pena A. (Enterocytozoon hepatopenaei, EHP) containing any primer set selected from the consisting of Primer set for infection diagnosis
2. The diagnostic primer set according to claim 1, wherein the primer set 1, 2 or 3 is an amplification target of beta-tubulin of a microporosid.
The diagnostic primer set according to claim 1, wherein the enterotoxin hepatophene A (EHP) infects crustaceans or fishes
The diagnostic primer set according to claim 3, wherein the crustaceans are shrimp
A method for diagnosing a microporosal infection in a shrimp comprising a primer set according to any one of claims 1 to 4

Images