CN104911187B - Mycobacterium tuberculosis type strain H37DNA aptamer of Rv and preparation method thereof - Google Patents
Mycobacterium tuberculosis type strain H37DNA aptamer of Rv and preparation method thereof Download PDFInfo
- Publication number
- CN104911187B CN104911187B CN201510378910.8A CN201510378910A CN104911187B CN 104911187 B CN104911187 B CN 104911187B CN 201510378910 A CN201510378910 A CN 201510378910A CN 104911187 B CN104911187 B CN 104911187B
- Authority
- CN
- China
- Prior art keywords
- aptamer
- selex
- mycobacterium tuberculosis
- buffer
- type strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides a kind of mycobacterium tuberculosis type strain H37DNA aptamer of Rv and preparation method thereof, mycobacterium tuberculosis type strain H of the invention37SsDNA aptamer compatibility, the specificity of Rv is high, and mycobacterium tuberculosis, non-tuberculous mycobacteria and non-branch bacillus can be detected with high specificity by being used for bacteriological detection, can provide advantageous foundation for laboratory diagnosis lungy.
Description
Technical field
The present invention relates to molecular biology field more particularly to a kind of mycobacterium tuberculosis type strain H37The DNA of Rv is adapted to
Son and preparation method thereof.
Background technique
Tuberculosis is chronic caused by mycobacterium tuberculosis (Mycobacterium Tuberculosis, MTB) infection
Communicable disease is the serious public health problem faced both at home and abroad, is listed in one of China's serious infectious diseases.Tuberculosis is
One of illness rate and the highest disease of the death rate in history.Global tuberculosis infection patient is about 9,000,000 within 2013, and because of tuberculosis
The number died of dying of illness reaches 1,500,000；China is one of global tuberculosis high burden country, therefore establishes one kind and quickly and accurately examine
The method for surveying mycobacterium tuberculosis has great significance to the treatment of tuberculosis disease early diagnosis.
Currently, the bacteriological detection of mycobacterium tuberculosis is the goldstandard of Laboratory Diagnosis in Tuberculosis.The direct microscopy of sputum smear
Method is the most basic bacteriology checking method in tuberculosis laboratory, its main feature is that it is easy, quick, inexpensive, but can not distinguish dead bacterium
Viable bacteria；Sensibility is low, poor specificity, the various equal pigmentables of acid-fast bacilli.But still there is practicability, tuberculosis disease early diagnosis is risen
To important function；The use more bacteriological detection method such as Russell medium time is longer both at home and abroad at present, cultivates positive rate
It is low.Though nowadays can be shortened incubation time using rapid culture system detection mycobacterium tuberculosis, improving culture positive rate, still need to
4-6 weeks, it is unable to satisfy clinical quickly diagnosis and treatment demand.Although diagnosis of molecular biology is able to satisfy that speed is fast, specificity is high, Tu Yangbiao
The requirement such as this recall rate height.But its Gao Chengben, and it is complicated for operation, height is required to experiment condition and technical staff, limits it
Popularization and application in clinical examination.
There is the problems such as time-consuming, sensitivity is low in current diagnosis lungy, it is consistent to explore fast and convenient diagnostic method
It is the focus of domestic and foreign scholars' research.Fas lignand system evolution technology (the Systematic evolution of of index concentration
Ligand by exponential enrichment, SELEX) it is that Ellington and Szostak (1990) is reported make at first
With being a kind of novel in vitro screening technique.The basic principle of the technology be can be formed in space using oligonucleotide molecules it is a variety of
The three-dimensional structure of multiplicity, by the random oligonucleotide library of building, being screened out from it has specific recognition work with target target molecule
The oligonucleotide molecules of high-affinity, then through amplification, repeated screening, it is enriched with such oligonucleotide molecules, the richness
The oligonucleotide molecules of collection are known as aptamer.Compared with antibody protein, aptamer have molecule distinguishability is strong, stability is high,
The advantages that preparation is simple, economic, quick.The technology has successfully applied to the screening of many target molecules, including metal ion, organic
Dyestuff, protein, cell, drug, amino acid and various cell factors etc. can be used for the detection identification of corresponding target molecule.Mesh
The preceding technology is widely used in terms of human pathogen's microorganism detection.
Existing research, as antagonist, it is raw to be suitable for tumour by the aptamer of SELEX technology screening to corresponding target substance
Vascular endothelial growth factor, thrombus when long generate the factor, some toxin proteins and somatomedin etc., have reached treatment mesh
's.In terms of microorganism detection, especially to some unknown pathogenic bacterias or viral research, although not knowing inside it
The epitope of structure, function and these substances, but as target substance, it is screened corresponding thereto by SELEX process
Aptamer detects target substance, it has also become the research and probe hot spot in the field.
Summary of the invention
In order to solve above-mentioned the problems of the prior art, the present invention provides a kind of mycobacterium tuberculosis type strain H37Rv
DNA aptamer and preparation method thereof.
In order to achieve the object of the present invention, a kind of mycobacterium tuberculosis type strain H of the invention37The ssDNA of Rv is adapted to
Son, the nucleotide sequence of DNA aptamer are as follows:
5’-GGGAGCTCAGAATAAACGCTCAACGGATTAGTCAATAGACTGGTG GCTTTGTGTGGTGTTCGAC
ATGAGGCCCGGATC-3’
Another object of the present invention is using above-mentioned aptamer in bacteriological detection, especially detection clinical strains, bacterium
Strain includes mycobacterium tuberculosis (MTB), non-tuberculous mycobacteria (Non-Tuberculosis Mycobacteria, NTM) and non-
Mycobacteria.
Of the invention also provides a kind of Mycobacterium tuberculosis detection kit, includes above-mentioned DNA adaptation in kit
Son.
On the other hand, the present invention also provides above-mentioned mycobacterium tuberculosis type strain H37The preparation method of the DNA aptamer of Rv,
The following steps are included:
Step 1, random single chain oligonucleotide library is constructed: the random single chain DNA library of design 78 base-pairs of synthesis: 5 '-
GGGAGCTCAGAATAAACGCTCAA-N35- TTCGACATGAGGCCCGG ATC-3 ', wherein N represents any in base AGCT
One, the capacity in library is 1014-1015, and the single-stranded library ssDNA further purified is used for mycobacterium tuberculosis standard
Strain H37The SELEX technology screening of Rv aptamer；
Step 2, SELEX technology screening H is utilized37Rv aptamer: use coating buffer by mycobacterium tuberculosis type strain
H37Rv is coated in microwell plate, while setting blank counter-selection hole, non-tuberculous mycobacteria and non-branch bacillus counter-selection hole；SsDNA text
Library and SELEX combination buffer are first incubated for blank counter-selection hole after mixing；It is then transferred into H37Rv coating hole is incubated for,
The elution of SELEX elution buffer and H is added in the washing of SELEX dcq buffer liquid after drying37The ssDNA that Rv is combined, product is through phenol
Chloroform, ethanol precipitation purify, and after PCR amplification, carry out 10 wheel screenings, the saturation library after screening is obtained through cloning and sequencing
Single aptamer.
To advanced optimize above-mentioned preparation method, the measure that the present invention takes further include:
It further include to mycobacterium tuberculosis type strain H in step 137The culture of Rv and other bacteriums are collected, and bacterium and ratio are ground
It is turbid.
SELEX combination buffer is used in step 2 are as follows: 20mmol/L Hepes, pH value 7.35,120mmol/L NaCl,
5mmol/L KCl, 1mmol/LCaCl2, 1mmol/LMgCl2。
SELEX dcq buffer liquid is used in step 2 are as follows: SELEX combination buffer+0.05%Tween 20.
SELEX elution buffer is used in step 2 are as follows: 20mmol/L Tris-HCl, 4mol/L guanidinium isothiocyanate,
1mmol/L DTT, pH value 8.3.
Last aspect, the present invention also provides apply above-mentioned mycobacterium tuberculosis type strain H37The ssDNA aptamer of Rv into
The detection method of row sandwich ELISA selects aptamer of the invention to be suitably adapted to sub-portfolio building with other and is based on
The sandwich ELISA detection architecture of aptamer.
Mycobacterium tuberculosis type strain H of the invention37SsDNA aptamer compatibility, the specificity of Rv is high, is used for bacterium
Mycobacterium tuberculosis and non-branch bacillus can be detected with high specificity by learning detection, can be provided for laboratory diagnosis lungy
Advantageous foundation.
Detailed description of the invention
Fig. 1 is mycobacterium tuberculosis type strain H of the invention37The secondary structure map of Rv aptamer；
Fig. 2 is mycobacterium tuberculosis type strain H37Rv and aptamer fluorescence microscope result figure of the invention；
Fig. 3 is non-tuberculous mycobacteria and aptamer fluorescence microscope result figure of the invention；
Fig. 4 is non-mycobacteria and aptamer fluorescence microscope result figure of the invention；
Specific embodiment
The present invention provides a kind of mycobacterium tuberculosis type strain H37The DNA aptamer of Rv and bacterium based on the aptamer
Learn detection method and application and the preparation method of the aptamer.
A kind of mycobacterium tuberculosis type strain H of the invention37The DNA aptamer of Rv, the nucleotide sequence of DNA aptamer
Are as follows:
5’-GGGAGCTCAGAATAAACGCTCAACGGATTAGTCAATAGACTGGTGGCT
TTGTGTGGTGTTCGACATGAGGCCCGGATC-3’。
The present invention also provides application of the above-mentioned DNA aptamer in bacteriological detection, especially in detection tuberculosis branch
Application in bacillus.
The present invention also provides a kind of Mycobacterium tuberculosis detection kits, include above-mentioned DNA aptamer.
The present invention also provides a kind of mycobacterium tuberculosis type strain H37The ssDNA aptamer preparation method of Rv, including it is following
Step:
Step 1, random single chain oligonucleotide library is constructed: the random single chain DNA library of design 78 base-pairs of synthesis: 5 '-
GGGAGCTCAGAATAAACGCTCAA-N35- TTCGACATGAGGCCCGG ATC-3 ', wherein N represents any in base AGCT
One, capacity 1014-1015, and the single-stranded library ssDNA further purified is used for type strain H37Rv aptamer
SELEX technology screening；
Step 2, aptamer technology screening H is utilized by separating medium of microwell plate37Rv aptamer: will with coating buffer
H37Rv is coated in microwell plate, while setting blank counter-selection hole, non-tuberculous mycobacteria and non-branch bacillus counter-selection hole；SsDNA text
Library and SELEX combination buffer are first incubated for counter-selection hole after mixing；It is then transferred into H37Rv coating hole is incubated for,
The elution of SELEX elution buffer and H is added in the washing of SELEX dcq buffer liquid after drying37The ssDNA that Rv is combined, product is through phenol chlorine
Imitative extracting, ethanol precipitation purifying after PCR amplification, carry out 10 wheel screenings, and the saturation library after screening is obtained through cloning and sequencing
Single aptamer.
Using above-mentioned mycobacterium tuberculosis type strain H37The ssDNA aptamer of Rv carries out sandwich ELISA detection
Method selects the sandwich ELISA detection architecture of above-mentioned aptamer or adaptation sub-portfolio building based on aptamer.
The present invention is obtaining H37It, can be by selecting H after Rv aptamer37Rv aptamer or adaptation sub-portfolio building are based on suitable
The sandwich ELISA detection architecture of gamete carries out the detections of clinical strains.
The present invention is by the research field of SELEX technology transfer mycobacterium tuberculosis, with H37Rv is target substance, and screening obtains
H37The aptamer of Rv, further to provide foundation using the diagnosis detection that aptamer technology carries out mycobacterium tuberculosis.
The specific embodiment applied through the invention explains the present invention below.
Embodiment 1
In the present embodiment, mycobacterium tuberculosis type strain H is prepared first37Then the ssDNA aptamer of Rv utilizes it
Carry out bacteriological detection, comprising the following steps:
Step 1:
(1) prepared by strain to be tested:
By mycobacterium tuberculosis type strain H37Rv and 15 kinds of non-tuberculous mycobacteria (NTM) transferred speciess are to containing 10%OADC
In the Michaelis 7H9 fluid nutrient medium of (containing oleic acid, albumin, glucose and catalase) nutritional additive, 37 DEG C of cultures are extremely
Logarithmic growth phase is gone in 1.5ml centrifuge tube, and 12000rpm is centrifuged 5min, and 1 × PBS is washed twice, 80 DEG C of water-baths, fire extinguishing
30min.Mill tube is gone to after fire extinguishing, adjusts turbidity to 1mg/ml after grinding bacterium.
8 kinds of non-branch bacillus scrape well-grown bacterium colony from blood plate, with above-mentioned same method processing fire extinguishing
It is to be checked.
(2) single-stranded DNA banks for constructing random single chain oligonucleotide library and being purified:
Construct random single chain oligonucleotide library: the random single-stranded DNA banks of design 78 base-pairs of synthesis: 5 '-
GGGAGCTCAGAATAAACGCTCAA-N35- TTCGACATGAGGCCCGG ATC-3 ', wherein N represents any in base AGCT
One, capacity 1014-1015；Upstream primer: 5 '-GGGAGCTCAGAATAAACGCTCAA-3 ' is constructed, downstream primer is constructed
5'- -TTCGACATGAGGCCCGGATC-3'.And the single-stranded library ssDNA further purified is used for H37Rv aptamer
SELEX technology screening.
It designs and the single-stranded DNA banks purified can be expanded, no by general PCR (polymerase chain reaction)
Symmetrical PCR method and phenol chloroform method purify to obtain.
Step 2
Utilize SELEX technology screening mycobacterium tuberculosis type strain H37Rv aptamer:
With coating buffer (0.05mol/L carbonate buffer solution, pH value 9.6) by H37Rv is coated in microwell plate, simultaneously
If blank counter-selection hole, non-tuberculous mycobacteria and non-branch bacillus counter-selection hole；H37Rv is coated with hole and counter-selection hole with 3%BSA
(bovine serum albumin(BSA)) closing；The library ssDNA and SELEX combination buffer are first incubated at 37 DEG C with counter-selection hole after mixing
It educates, removes the ssDNA in conjunction with BSA and microwell plate；It is then transferred into H37Rv coating hole is incubated at 37 DEG C, SELEX punching
SELEX elution buffer is added in 80 DEG C of effect 10min, elution and H in wash buffer washing after drying37The ssDNA that Rv is combined,
Product is purified through phenol chloroform, ethanol precipitation, after PCR amplification, carries out next round screening.10 wheel screenings are carried out altogether.1-4 wheel
Blank well counter-selection is carried out, 5-7 wheel carries out counter-selection by background of non-branch bacillus, and 8-10 wheel is carried out with non-tuberculous mycobacteria
For the counter-selection of background.
Saturation library after screening obtains single aptamer through cloning and sequencing.The aptamer is energy and H37Rv is combined
DNA aptamer, sequence are as follows:
5’-GGGAGCTCAGAATAAACGCTCAACGGATTAGTCAATAGACTGGTG GCTTTGTGTGGTGTTCGAC
ATGAGGCCCGGATC-3’
And carry out the secondary structure map (Fig. 1) that structural analysis obtains the aptamer.
SELEX combination buffer used in the embodiment of the present invention are as follows: 20mmol/L Hepes, pH value 7.35,
120mmol/L NaCl, 5mmol/L KCl, 1mmol/LCaCl2, 1mmol/L MgCl2；SELEX dcq buffer liquid are as follows: SELEX
Combination buffer+0.05%Tween 20；SELEX elution buffer are as follows: 20mmol/L Tris-HCl, 4mol/L isothiocyanic acid
Guanidine, 1mmol/L DTT, pH value 8.3.
Step 3:
Using H of the present invention37Rv aptamer constructs detection architecture, and detects clinical strains.
Select the H with high-affinity37Rv aptamer or adaptation sub-portfolio construct the sandwich based on aptamer
ELISA detection architecture, for the detections of 102 plants of clinical strains, (totally 64 plants of MTB, NTM is 28 plants and non-branch bacillus is 10
Strain).
Ultraviolet lamp treatment with irradiation 12h of the ELISA Plate through 30W 75cm.Aptamer measures concentration with spectrophotometric, and through 94 DEG C
It is denaturalized 5min, ice bath 10min is pre-processed；Treated, and aptamer use is coated with buffer (0.05mol/L carbonate buffer
Liquid, pH value 9.6) dilution, it is coated with elisa plate as capture aptamer according to the concentration of every 1 μ g of hole, 4 DEG C are overnight；Then 3%BSA
1h is closed at 37 DEG C of (bovine serum albumin(BSA))；
Thallus sample is diluted to 10 μ g/mL with PBS, the ELISA Plate after closing, 37 DEG C of incubations are added with 100 holes μ L/
1h is added PBST and washs 3 times, 3min/ times；
Using another aptamer of the end 5` biotin labeling as detection aptamer, SELEX combination buffer is diluted to 0.5
ELISA Plate is added in the hole μ g/, and 37 DEG C, 40min, SELEX washing buffer is washed 5 times, 3min/ times；
Horseradish peroxidase 100 the μ l, 37 DEG C of incubation 30min of the marked by streptavidin of 1:1000 is added；It is added
PBST is washed 5 times, 3min/ times；
Colour reagent A and colour reagent B is mixed according to the ratio of 1:1 and is added, and it is whole that terminate liquid is added in 37 DEG C of incubation 10min
Only develop the color；PBST is added to wash 3 times, 3min/ times；
Utilize the absorbance value (A450, A620) of microplate reader dual wavelength (450nm and 620nm) detection sample.
As a result judge: the OD value for carrying out result judgement should be the difference of OD450nm and OD620nm.Positive controls (including
One plant of type strain H37Rv and 63 plant of MTB bacterial strain) OD value average 0.66；Negative control group mean OD value=0.35 (including 28 plants of NTM
With 10 plants of non-branch bacillus, OD mean value is respectively 0.38 and 0.29).Wherein mycobacterium tuberculosis group and non-tuberculous mycobacteria
Different statistically significant (P < 0.01 of OD value difference between group；AUC=0.9810,95%CI:0.9598-1.002)；Tuberculosis point
Different statistically significant (P < 0.01 of OD value difference between branch bacillus group and non-branch bacillus group；AUC=1.000,95%CI:
1.000-1.000)。
As a result it explains: H in the application present invention37The detection architecture of the ssDNA adaptation sub-portfolio building of Rv can be specifically
Detect M. tuberculosis strains, non-tuberculous mycobacteria and non-branch bacillus.
H of the invention37Rv aptamer can specifically detect M. tuberculosis strains for bacteriological detection.
Step 4:
FITC marks H37Rv aptamer, the result of fluorescence microscopy microscopic observation clinical strains.
Strain to be tested: mycobacterium tuberculosis type strain H37Rv, 3 kinds of NTM (mycobacterium kansasii, mycobacterium gordonae, birds
Mycobacteria) and 3 kinds of non-branch bacillus (Escherichia coli, Acinetobacter bauamnnii, staphylococcus aureus).
By the H in the present invention37Rv aptamer FITC fluorescent marker, and through 94 DEG C of denaturation 5min, ice bath 15min progress
Pretreatment；With the PBS of 500 μ L mix that treated aptamer and different thallus (2 × 107CFU), 37 DEG C of mild concussion effects
40min, 12000rpm are centrifuged 5min, use ddH2O washing precipitating four times, precipitating is resuspended in ddH2In O, 10 μ L precipitating is taken to apply respectively
Piece is in fluorescence microscope.
As a result it observes: mycobacterium tuberculosis type strain H37Rv visible stronger green fluorescence (figure under fluorescence microscope
2), non-tuberculous mycobacteria and non-branch bacillus do not observe green fluorescence (Fig. 3 and Fig. 4) under the microscope.
Specific embodiments of the present invention are described in detail above, but it is merely an example, the present invention is simultaneously unlimited
It is formed on particular embodiments described above.To those skilled in the art, any couple of present invention carries out equivalent modifications and
Substitution is also all among scope of the invention.Therefore, without departing from the spirit and scope of the invention made by equal transformation and
Modification, all should be contained within the scope of the invention.
<110>Shanghai Pulmonary Hospital
<120>DNA aptamer and preparation method thereof of mycobacterium tuberculosis type strain H37Rv
<160> 4
<210> 1
<211> 78
<212> DNA
<213>artificial sequence
<220>
<223>aptamer
<400> 1
gggagctcag aataaacgct caacggatta gtcaatagac tggtggcttt gtgtggtgtt 60
cgacatgagg cccggatc 78
<210> 2
<211> 78
<212> DNA
<213>artificial sequence
<220>
<223>random single-stranded DNA banks
<220>
<221> misc_feature
<222> (24)..(58)
<223>n=a or g or c or t
<400> 2
gggagctcag aataaacgct caannnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnntt 60
cgacatgagg cccggatc 78
<210> 3
<211> 23
<212> DNA
<213>artificial sequence
<220>
<223>PCR amplification primer
<400> 3
gggagctcag aataaacgct caa 23
<210> 4
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>PCR amplification primer
<400> 4
ttcgacatga ggcccggatc 20
Claims (6)
1. a kind of mycobacterium tuberculosis type strain H37The DNA aptamer of Rv is preparing answering in Mycobacterium tuberculosis detection kit
With, which is characterized in that the nucleotide sequence of the DNA aptamer are as follows:
5’-GGGAGCTCAGAATAAACGCTCAACGGATTAGTCAATAGACTGGTGGCTTTGTGTGGTGTTCGACATGAG
GCCCGGATC-3'；
Wherein, the amplimer of the nucleotide sequence of the DNA aptamer is
Upstream primer: 5 '-GGGAGCTCAGAATAAACGCTCAA-3 '；
And downstream primer: 5 '-TTCGACATGAGGCCCGGATC-3 '；
Wherein, the DNA aptamer is using enzyme label, fluorescein label or biotin labeling.
2. application according to claim 1, which is characterized in that the preparation of the DNA aptamer the following steps are included:
Step 1, random single chain oligonucleotide library is constructed: the random single-stranded DNA banks of design 78 bases of synthesis: 5 '-
GGGAGCTCAGAATAAACGCTCAA-N35- TTCGACATGAGGCCCGGATC-3 ', wherein N represents any in base AGCT
One, library capacity is 1014-1015, and the single-stranded library ssDNA is further purified for mycobacterium tuberculosis type strain H37Rv is suitable
The SELEX technology screening of gamete；
Step 2, SELEX technology screening H is utilized37Rv aptamer: use coating buffer by mycobacterium tuberculosis type strain H37Rv packet
By in microwell plate, while blank counter-selection hole is set, non-tuberculous mycobacteria and non-branch bacillus counter-selection hole；The library ssDNA and
SELEX combination buffer is first incubated for blank counter-selection hole after mixing；It is then transferred into H37Rv coating hole is incubated for,
SsDNA of the SELEX elution buffer elution in conjunction with H37Rv is added in the washing of SELEX dcq buffer liquid after drying, product is through phenol
Chloroform, ethanol precipitation purify, and after PCR amplification, carry out 10 wheel screenings, the saturation library after screening is obtained through cloning and sequencing
Single aptamer.
3. application according to claim 2, it is characterised in that: SELEX combination buffer ingredient used in step 2 are as follows:
20mmol/L Hepes, 120mmol/L NaCl, 5mmol/L KCl, 1mmol/L CaCl2, 1mmol/L MgCl2；SELEX knot
Closing pH of buffer is 7.35.
4. application according to claim 2, it is characterised in that: use SELEX dcq buffer liquid ingredient in step 2 are as follows:
20mmol/L Hepes, 120mmol/L NaCl, 5mmol/L KCl, 1mmol/L CaCl2, 1mmol/L MgCl2, 0.05%
Tween 20。
5. application according to claim 2, it is characterised in that: use SELEX elution buffer components in step 2 are as follows:
20mmol/L Tris-HCl, 4mol/L guanidinium isothiocyanate, 1mmol/L DTT；SELEX elution buffer pH is 8.3.
6. application according to claim 1, which is characterized in that the DNA aptamer is applied to a kind of sandwich
ELISA detection method.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510378910.8A CN104911187B (en) | 2015-07-01 | 2015-07-01 | Mycobacterium tuberculosis type strain H37DNA aptamer of Rv and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510378910.8A CN104911187B (en) | 2015-07-01 | 2015-07-01 | Mycobacterium tuberculosis type strain H37DNA aptamer of Rv and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104911187A CN104911187A (en) | 2015-09-16 |
| CN104911187B true CN104911187B (en) | 2019-04-12 |
Family
ID=54080629
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510378910.8A Active CN104911187B (en) | 2015-07-01 | 2015-07-01 | Mycobacterium tuberculosis type strain H37DNA aptamer of Rv and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104911187B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106047882A (en) * | 2016-06-01 | 2016-10-26 | 湖南大学 | Aptamer group in specific binding with mycobacterium tuberculosis and application of aptamer group |
| CN110551726B (en) * | 2019-09-06 | 2021-04-09 | 上海市肺科医院 | Bacillus tuberculosis arabinogalactan aptamer and application thereof |
| CN111218449A (en) * | 2020-01-17 | 2020-06-02 | 上海孚清生物科技有限公司 | Mycobacterium tuberculosis nucleic acid aptamer and preparation method thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101109013A (en) * | 2006-07-20 | 2008-01-23 | 武汉大学 | Micromolecule nucleotide DNA adaptorprotein against tubercle bacillus infection and method of preparing the same |
| CN102081092A (en) * | 2009-11-30 | 2011-06-01 | 武汉大学 | Kit and detection method for mycobacterium tuberculosis |
| CN102719438A (en) * | 2012-07-12 | 2012-10-10 | 章晓联 | Nucleic acid aptamer capable of being specifically bound to tubercle bacillus antigen and application thereof |
| CN103543275A (en) * | 2013-11-07 | 2014-01-29 | 中国人民解放军第三军医大学第一附属医院 | Method for rapidly detecting PP65 based on magnetic bead |
-
2015
- 2015-07-01 CN CN201510378910.8A patent/CN104911187B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101109013A (en) * | 2006-07-20 | 2008-01-23 | 武汉大学 | Micromolecule nucleotide DNA adaptorprotein against tubercle bacillus infection and method of preparing the same |
| CN102081092A (en) * | 2009-11-30 | 2011-06-01 | 武汉大学 | Kit and detection method for mycobacterium tuberculosis |
| CN102719438A (en) * | 2012-07-12 | 2012-10-10 | 章晓联 | Nucleic acid aptamer capable of being specifically bound to tubercle bacillus antigen and application thereof |
| CN103543275A (en) * | 2013-11-07 | 2014-01-29 | 中国人民解放军第三军医大学第一附属医院 | Method for rapidly detecting PP65 based on magnetic bead |
Non-Patent Citations (1)
| Title |
|---|
| 肺结核患者巨细胞病毒感染的血清学检测及意义;王希英等;《现代预防医学》;20071231;全文 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104911187A (en) | 2015-09-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ooteman et al. | Evaluation of MAT, IgM ELISA and PCR methods for the diagnosis of human leptospirosis | |
| CN112159854B (en) | Primer composition for detecting CRISPR/Cas12a of escherichia coli O157-H7 and detection method | |
| CN104911187B (en) | Mycobacterium tuberculosis type strain H37DNA aptamer of Rv and preparation method thereof | |
| CN103436608B (en) | Rapid detection method based on nucleic acid aptamers and kit | |
| CN106987626A (en) | For a variety of fungies of quick detection and identify primer and probe and its application of strain | |
| US20200165664A1 (en) | Primer composition for analyzing intestinal flora and application thereof | |
| CN104131112A (en) | Primer group for gonococci detection, kit containing primer group and application thereof | |
| CN102010865B (en) | Nucleic acid aptamer capable of specifically recognizing Listeria monocytogenes, screening method and application thereof | |
| CN116042902A (en) | Real-time fluorescent nucleic acid isothermal amplification detection kit for simultaneously detecting six candida species and special primer and probe thereof | |
| CN109628617A (en) | For detecting the nucleic acid reagent, kit, system and method for Drug Resistance of Mycobacterium Tuberculosis | |
| CN103194536A (en) | Nucleic acid chromatography detection kit of Candida albicans, detection method and application thereof | |
| CN104946655A (en) | DNA aptamer of mycobacterium tuberculosis standard strain H37Rv and preparation method thereof | |
| CN102735669A (en) | Nucleic acid aptamer molecular beacon probe for detection of platelet-derived growth factor | |
| CN101565753A (en) | Rapid diagnostic kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof | |
| CN107653308B (en) | One group is combined and kit for distinguishing active tuberculosis patient with the primer pair of non-tuberculous pneumonia patient | |
| CN102827928B (en) | Rapid diagnosis method for plesimonas shigelloides | |
| CN104388558B (en) | The molecular beacon probe of a kind of quick detection streptococcus agalactiae and detection method | |
| CN101555529A (en) | Loop-mediated isothermal amplification technology-based Listeria monocytogenes rapid diagnostic kit and testing method thereof | |
| CN116479150A (en) | Single tube one-step method for rapidly detecting methicillin-resistant staphylococcus aureus by RPA-Cas12a/Cas13a | |
| CN105524988A (en) | Kit for rapid detection of Mycobacterium tuberculosis in sputum | |
| KR101836042B1 (en) | Dna aptamer specifically binding to gram positive bacteria and use thereof | |
| CN107190010B (en) | High-affinity aptamers specifically bound with vibrio vulnificus and application thereof | |
| CN104388422A (en) | Oligonucleotide sequence as well as preparation method and application thereof | |
| CN112175958B (en) | Optimized aptamer sequence for specifically recognizing Listeria monocytogenes and application thereof | |
| CN104278036B (en) | Set of oligonucleotide aptamers for specifically recognizing Sh.sonnei |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20150916 Assignee: SHANGHAI FULL GENE BIOTECHNOLOGY Co.,Ltd. Assignor: SHANGHAI PULMONARY HOSPITAL Contract record no.: X2020980001797 Denomination of invention: DNA aptamer of Mycobacterium tuberculosis standard strain h 37 RV and its preparation method Granted publication date: 20190412 License type: Exclusive License Record date: 20200426 |