CN104388422A - Oligonucleotide sequence as well as preparation method and application thereof - Google Patents
Oligonucleotide sequence as well as preparation method and application thereof Download PDFInfo
- Publication number
- CN104388422A CN104388422A CN201410576464.7A CN201410576464A CN104388422A CN 104388422 A CN104388422 A CN 104388422A CN 201410576464 A CN201410576464 A CN 201410576464A CN 104388422 A CN104388422 A CN 104388422A
- Authority
- CN
- China
- Prior art keywords
- ssdna
- bacterium
- binding buffer
- buffer liquid
- vibrio harveyi
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an oligonucleotide sequence as well as a preparation method and application thereof, and relates to the identification and detection of inactivated Vibrio harveyi. The oligonucleotide sequence has the characteristics of quickness in detection, high simplicity in operation, higher stability than the stability of antibodies, simple preparation method, short preparation period, and so on. The oligonucleotide sequence is SEQ ID No. 1 which can be used to identify and detect the inactivated Vibrio harveyi. The preparation method comprises the following steps: synthesizing an ssDNA oligonucleotide library for screening; mixing the ssDNA oligonucleotide library with the inactivated Vibrio harveyi and screening the mixture by using the SELEX technology until the affinity no longer increases obviously; carrying out clone sequencing and selecting high copy ssDNA to undergo affinity and specificity verification and affinity constant determination, thereby obtaining the corresponding aptamer; The oligonucleotide sequence can be used to identify and detect the inactivated Vibrio harveyi in various samples.
Description
Technical field
The present invention relates to the recognition detection of Vibrio harveyi, especially relate to oligonucleotide sequence that can be used for deactivation Vibrio harveyi recognition detection and preparation method thereof and application.
Background technology
In aquaculture, about have the aquatic animal of 10% to die from infectious disease every year, the disease that wherein vibrio infection causes account for sizable proportion.Pharmaceutical chemicals and microbiotic infect although can control it; but medical treatment often can produce adverse consequences; as at aquatic animal cylinder accumulation, residual; the problems such as easy generation Resistant strain and easy contaminate environment; therefore the Fast Detection Technique of pathogenic vibrio is set up, with the generation of ahead of time controlling disease be popularly still current Main Means.
At present, the detection method of vibrios, mainly according to uncle Jie Shi Bacteria Identification handbook, is identified by detecting the physiological and biochemical property of microorganism, and owing to needing the project of test more, therefore the method workload is comparatively large, operation is more loaded down with trivial details.Though the molecular biology method of 16SRNA has higher accuracy, need the 16SRNA extracting pathogenic bacteria, formality is more loaded down with trivial details, and there are certain requirements test set, is difficult to realize on-the-spot rapid detection needs; Though antiserum(antisera) prepared by immunological method can realize rapid detection, because the antiserum(antisera) of preparation is polyclonal antibody, in practical application, false positive or false negative may be there is, even if adopt monoclonal antibody.Because technology of preparing requirement is higher, the cycle is longer, therefore its application is restricted.
Index concentration part evolution technology (Systemic Evolution of Ligands by Exponential Enrichment), being called for short SELEX technology, is a kind of screening system technology that new development is in recent years got up.It utilizes oligonucleotide molecules can form diversified three-dimensional structure in space, by the random oligonucleotide storehouse built, therefrom filter out the oligonucleotide molecules of the high-affinity having specific recognition effect with target molecule---aptamer, its molecule distinguishability can meet or exceed the level of monoclonal antibody, and technology of preparing is then simpler than monoclonal antibody, quick.Use this technology to filter out the aptamer of tumour cell, anthrax bacillus etc. at present, can be used for the detection of tumour cell and anthrax bacillus, identification.
The rapid detection appearing as microorganism of SELEX technology provides new Research Thinking, and its application also will be more and more extensive.In SELEX screening, be that target screens with inactivated bacteria, not only there is good security, and make the form of object bacteria relatively stable and fixing, thus effectively improve efficiency and the effect of screening.Meanwhile, take inactivated bacteria as target, environmental factor effectively can also be avoided the impact of viable bacteria, the stability of screening is improved preferably.Therefore, carry out with inactivated bacteria be target SELEX screening, significant.
Vibrio harveyi (Vibrio harveyi) is the essential condition pathogenic bacterium in aquaculture, and it can not only cause multiple aquatic animal morbidity, can also cause food poisoning, threaten the health of the mankind by food chain.Therefore, use SELEX technology screening deactivation Vibrio harveyi aptamer, and be applied to the identification qualification of deactivation Vibrio harveyi, greatly can improve sensitivity and the specificity of Vibrio harveyi detection, become emphasis of the present invention.
The applicant has disclosed 3 adaptor sequence in Chinese patent 201110259244.8, as follows respectively:
Sequence 1:5 '-GAGACCCCAG AGGGAAGGAG GCGGCGAAGC GACTGGAAGGAGACGGCGAA GCGACTGA-3 ';
Sequence 2:5 '-TCAGTCGCTT CGCCGTCTCC TTCCAGTCGC TTCGCCGCCTCCTTCCCTCT GGGGTCTCCC TCTTGTGC-3 ';
Sequence 3:5 '-GCACAAGAGG GAGACCCCAG AGGGAAGGAG GCGGCGAAGCGACTGGAAGG AGACGGCGAA GCGACTGA-3 '.
The applicant has disclosed 4 adaptor sequence in Chinese patent 201110090419.7, as follows respectively:
No. 8 aptamers: 5 '-TCAGTCGCTT CGCCGTCTCC TTCAGAGTCG TGGAGAGGGTGAACGGAGGG GGGAAACAGC ACAAGAGGGA GACCCCAGAG GG-3 '
No. 10 aptamers: 5 '-TCAGTCGCTT CGCCGTCTCC TTCAGGTGGC GAGTTGCGAAGGACTGTGTC GAGTGTTG GC ACAAGAGGGA GACCCCAGAG GG-3 '
No. 37 aptamers: 5 '-TCAGTCGCTT CGCCGTCTCC TTCAGCGGGA TGAGGGAGTAGGAGGGCCAC AGTGGACT GCACAAGAGGGA GACCCCAGAG GG-3 '
No. 46 aptamers: 5 '-TCAGTCGCTT CGCCGTCTCC TTCCAGTCGC TTCGCCGCCTCCTTCCCTCT GGGGTCTC-3 '.
The applicant has disclosed 4 adaptor sequence in Chinese patent 201210079530.0, as follows respectively:
Sequence 1:5 '-TCAGTCGCTTCGCCGTCTCCTTC GGGGGCGCGGTGAGGGGCTGCACAAGAGGGAG GCACAAGAGGGAGACCCCAGAGGG-3 ';
Sequence 2:5 '-TCAGTCGCTTCGCCGTCTCCTTC TGCAGGGCCAGAACAGGGGGAAGGCACAAGAGGGA GCACAAGAGGGAGACCCCAGAGGG-3 ';
Sequence 3:5 '-TCAGTCGCTTCGCCGTCTCCTTC GGGGGCGCGGTGAGGGGCTGCACAAGAGGGAGGCACAAGAGGGAG GCACAAGAGGGAGACCCCAGAGGG-3 ';
Sequence 4:5 '-TCAGTCGCTTCGCCGTCTCCTTC TGCAGGGCCAGAACAGGGGGAAGGCACAAGAGGGAGCACAAGAGGGAG GCACAAGAGGGAGACCCCAGAGGG-3 ';
The applicant has disclosed 6 adaptor sequence in Chinese patent 201210552569.X, as follows respectively:
Sequence 1:5 '-TCA GTC GCT TCG CCG TCT CCT TCGGGGGCGCGGTGAGGGGCTGCACAAGAGGGAG GCA CAA GAG GGA GAC CCC AGAGGG-3 ';
Sequence 2:5 '-TCA GTC GCT TCG CCG TCT CCT TCGGACGAGATGGGCGGGAAACGAGGCACAAGAGGGA GCA CAA GAG GGA GAC CCCAGA GGG-3 ';
Sequence 3:5 '-TCA GTC GCT TCG CCG TCT CCT TCGTAGGAGGTAGTCGGAGAGGCGAATGAGAGGGGAAGCACAAGAGGGA GCA CAA GAGGGA GAC CCC AGA GGG-3 ';
Sequence 4:5 '-TCA GTC GCT TCG CCG TCT CCT TC AGCCGGGGTGGTCAGTAGGAGCAGCA CAA GAG GGA GAC CCC AGA GGG-3 ';
Sequence 5:5 '-TCA GTC GCT TCG CCG TCT CCT TCAGCCGGGGTGGTCAGTAGGAGCAGCACAAGAGGGA GCA CAA GAG GGA GAC CCCAGA GGG-3 ';
Sequence 6:5 '-TCA GTC GCT TCG CCG TCT CCT TCTGCAGGGCCAGAACAGGGGGAAGGCACAAGAGGGA GCA CAA GAG GGA GAC CCCAGA GGG-3 ';
Summary of the invention
The object of the present invention is to provide not only to have and detect quick, simple to operate, stability higher than features such as antibody, and preparation method easily, the shorter oligonucleotide sequence of preparation cycle and preparation method thereof.
Another object of the present invention is to the application that described oligonucleotide sequence is provided.
Described oligonucleotide sequence, be SEQ ID No.1, described SEQ ID No.1 can be designated as " I9 aptamer "; Described SEQID No.1 is: 5 '-TCA GTC GCT TCG CCG TCT CCT TCGGGTGGAGGAGGACGAAGTGAGAGCACAAGAGGGA GCA CAA GAG GGA GAC CCCAGA GGG-3 '.
The preparation method of described oligonucleotide sequence, comprises the following steps:
1) the ssDNA oligonucleotide library (5 '-TCA GTC GCT TCG CCG TCT CCT TC----N35----GCA CAA GAG GGA GAC CCC AGA GGG-3 ') of synthesis for screening, wherein N35 is 35 random oligonucleotides;
2) SELEX screening is carried out after being mixed with deactivation Vibrio harveyi by oligonucleotide library, until avidity no longer obviously rises;
3) SELEX has screened and has carried out cloning and sequencing to aptamer enriched library afterwards, selects the copy of height wherein ssDNA to carry out the mensuration of affine specific checking and affinity costant, obtains corresponding aptamer.
In step 2) in, the concrete steps of described SELEX screening can be:
The preparation of 2.1 deactivation Vibrio harveyi bacterium liquid
With physiological saline, the Vibrio harveyi bacterium colony cultivating 24h is washed from inclined-plane, the centrifugal 5min of 6000rpm, abandon supernatant liquor, add physiological saline containing 6% formaldehyde again in 62.5 DEG C of water-bath 1h, centrifugal rear brine 3 times, use the bacterium precipitation of 2 × binding buffer liquid suspension fire extinguishing again, 4 DEG C of preservations.
2.2 are combined with vibrios
Get the ssDNA oligonucleotide library 4 μ L that synthetic concentration is 100 μMs, 100 μ L are diluted to 2 × binding buffer liquid, 95 DEG C of sex change 5min, join in the Vibrio harveyi bacteria suspension of 100 μ L deactivations after ice bath 10min, 30 DEG C of shaking tables are in conjunction with 2h, the more centrifugal 5min of 6000rpm, abandon supernatant, then use 1 × binding buffer liquid to wash precipitation 1 time, abandon supernatant, then sediment fraction is deactivation Vibrio harveyi precipitation and ssDNA combined with it;
In step 2.2, described 2 × binding buffer liquid is that 20 × binding buffer liquid distilled water dilutes the solution after 10 times, and described 1 × binding buffer liquid is that 20 × binding buffer liquid distilled water dilutes the solution after 20 times; Described 20 × binding buffer liquid formula is 1M NaCl, 50mM KCl, 500mM Tris-HCl, 10mM MgCl
2, pH 7.4.
The ssDNA of 2.3 separation and combination
In the sediment fraction of step 2.2 gained, add 1 × binding buffer liquid 100 μ L, 95 DEG C of heating 5min, make the ssDNA sex change be combined with vibrios, thus be separated with vibrios, then the centrifugal 10min of 15000rpm, gets supernatant liquor, then the separable ssDNA obtaining being combined with vibrios.
2.4 asymmetric PCR amplification ssDNA
Cumulative volume is that the amplification system of the asymmetric PCR of 25 μ L is as shown in table 1.
Table 1
| Composition | Volume (μ L) |
| Primer P1 (10uM) | 2 |
| Primer P2 (0.4uM) | 2 |
| dNTP(10mM) | 0.4 |
| 10 × PCR damping fluid | 2 |
| Template (ssDNA of screening) | 2 |
| Taq archaeal dna polymerase (5U/ μ L) | 0.2 |
| ddH 2O | 16.4 |
Primer P1 sequence is: 5 '-TCA GTC GCT TCG CCG TCT CCT TC-3 ';
Primer P2 sequence is: 5 '-CCC TCT GGG GTC TCC CTC TTG TGC-3 ';
Reaction conditions is: 94 DEG C of denaturation 4min, and then carry out 40 circulations (72 DEG C extend 20s for 94 DEG C of sex change 30s, 58 DEG C of annealing 30s), last 72 DEG C extend 7min.
The mensuration of 2.5 avidity
2.5.1 asymmetric PCR amplification: with the ssDNA library screened of increasing with the primer P1 of digoxigenin labeled and primer P2 asymmetric PCR, amplification condition is identical with the asymmetric PCR of step 2.4 with parameter.
2.5.2 mensuration avidity:
TMB Color Appearance System: with tetramethyl benzidine (TMB) for substrate, the Color Appearance System of horseradish peroxidase-labeled rabbit anti digoxin antibody IgG measures the aptamer amount being adsorbed onto vibrios surface.
In step 2.5.2, the concrete steps of described mensuration avidity can be:
2.5.2.1 TMB dehydrated alcohol is made into 1mg/mL, 4 DEG C of shadings are preserved, with front more further in proportion preparation (TMB: substrate buffer solution: 30% hydrogen peroxide=100: 900: 1), namely join and namely use.
2.5.2.2 be combined with bacterium: the PCR primer of getting step 2.5.1 amplification gained, by ultramicrospectrophotometer mensuration ssDNA concentration wherein, get 1 μ L PCR primer again, be diluted to 100 μ L with 2 × binding buffer liquid, 95 DEG C of sex change 5min, after ice bath 10min, add inactivated bacterial liquid 100 μ L to mix, 30 DEG C, 100rpm shaking table is in conjunction with 30min, then centrifugation bacterial precipitation, abandons supernatant liquor; Do a blank simultaneously, replace ssDNA with binding buffer liquid.
2.5.2.3 wash: in above-mentioned bacterial precipitation, add 1 × binding buffer liquid 500 μ L, after mixing, be transferred to by bacteria suspension in new centrifuge tube, the centrifugal 5min of 6000rpm, abandons supernatant, get bacterium precipitation.
2.5.2.4 be combined with enzyme mark rabbit anti digoxin antibody: in bacterium is precipitated, add excessive enzyme mark rabbit anti digoxin antibody (IgG-HRP) that 100 μ L 1: 900TBS are diluted, after mixing, reaction 10min, the ssDNA making it the digoxigenin labeled in precipitating with bacterium is combined.
2.5.2.5 wash: the centrifugal 5min of 6000rpm, abandon supernatant, then use 1 × binding buffer liquid 500 μ L to wash 3 times, bacteria suspension is all transferred in new centrifuge tube by each washing, finally abandons supernatant, obtains bacterium precipitation.
2.5.2.6TMB develop the color: add the resuspended bacterium precipitation of 400 μ L distilled water, then add 200 μ L TMB nitrite ions, after lucifuge colour developing 10min, with 2mol/L H
2sO
4100 μ L termination reactions, measure the light absorption value OD at 450nm place
450, namely this value reflects the avidity of the ssDNA be combined with bacterium, i.e. OD
in conjunction with, blank carries out above-mentioned steps 2.5.2.3,2.5.2.4,2.5.2.5 and 2.5.2.6 equally, obtains blank corresponding absorbancy OD
blank;
2.5.2.7 the avidity in corresponding library is calculated:
2.6 repeat screening
Take turns the screening library of product as next round of asymmetric PCR using each, repeat above-mentioned SELEX and screen step 2.1 ~ 2.5, until avidity no longer obviously rises, final screening obtains the enriched library of aptamer.
In step 3) in, describedly carry out cloning and sequencing to aptamer enriched library, select the copy of height wherein ssDNA to carry out the mensuration of affine specific checking and affinity costant, obtain corresponding aptamer, its concrete grammar can be:
By step 2) the aptamer enriched library that filters out carries out asymmetric PCR amplification (amplification condition is with step 2.4), amplified production send order-checking company to clone, and random picking more than 5 clone carries out check order (also being completed by order-checking company), can obtain a series of oligonucleotide sequence or ssDNA.Then compare analysis to a series of ssDNA obtained, can find that some ssDNA is identical, some ssDNA has the copy of more than 2 in sequencing result in other words; If do not find this multiple copied ssDNA, then repeating step 3), continue cloning and sequencing, until obtain the ssDNA of at least one multiple copied, then select these multiple copieies ssDNA to carry out affine specificity verification, obtain corresponding aptamer, detailed process is as follows:
3.1 synthesis need the ssDNA sequence (being synthesized by Shanghai Sheng Gong biotechnology company limited) carrying out verifying, and in 5 ' end mark digoxin;
The preparation of 3.2 inactivating microbial
Choose the pathogenic micro-organism that culture environment of aquatic products is common---vibrio alginolyticus (V.alginolyticus), Aeromonas hydrophila (Aeromonas hydrophila), Edwardsiella tarda (Edwardsiella tarda) bacterium in contrast, together with Ha Weishi vibrios (Vibrio harveyi), aseptically be inoculated in pancreas peptone soybean broth substratum (TSB) respectively, at 30 DEG C, 8 ~ 10h cultivated by 100rpm shaking table, then bacterium liquid is got centrifugal, abandon supernatant nutrient solution, add physiological saline containing 6% formaldehyde again in 62.5 DEG C of water-bath 1h, centrifugal rear brine 3 times, use the bacterium precipitation of 2 × binding buffer liquid suspension fire extinguishing again, 4 DEG C of preservations.
The mensuration of 3.3 avidity and affine specificity verification
3.3.1 be combined with bacterium: get the ssDNA sequence 10pmol 2 × binding buffer liquid synthesized and be diluted to 100 μ l, 95 DEG C of sex change 5min, after ice bath 10min, 100 μ l each with the bacterium liquid of above-mentioned 4 kinds of inactivated bacteria mix that (bacterium quantity is about 3 × 10 respectively
8individual), 28 DEG C, 100rpm shaking table in conjunction with 40min, the then centrifugal 5min of 6000rpm, isolate precipitation and supernatant liquor, do simultaneously one do not add ssDNA (with 2 × binding buffer liquid replacement) blank;
3.3.2 wash: the bacterium of above-mentioned inactivated bacteria precipitation is washed 1 time with 1 × binding buffer liquid 500 μ l, and the centrifugal 5min of 6000rpm, abandons supernatant, get bacterium precipitation;
3.3.3 be combined with horseradish peroxidase-labeled rabbit anti digoxin antibody: in bacterium is precipitated, add the excessive horseradish peroxidase-labeled rabbit anti digoxin antibody that 100 μ l TBS dilute, the Dilution ratio of TBS is 1: 900, hybrid reaction 10min;
3.3.4 wash: the centrifugal 5min of 10000rpm, then use 1 × binding buffer liquid 500 μ l to wash 3 times, abandon supernatant, get bacterium precipitation;
3.3.5 develop the color: add the resuspended bacterium precipitation of 400 μ l distilled water, then add 200 μ l TMB nitrite ions, after lucifuge colour developing 10min, with 2mol/L H
2sO
4200 μ l termination reactions, measure the light absorption value OD at 450nm place
450, namely this value reflects the OD value of the anti-digoxin of enzyme mark of combination, is OD
in conjunction with, blank carries out above-mentioned steps 5.3.2,5.3.3,5.3.4 and 5.3.5 equally, obtains blank corresponding absorbancy OD
blank, the avidity=OD of corresponding aptamer
in conjunction with-OD
blank;
3.3.6 Data Management Analysis
Data processing is carried out with the statistical function in EXCEL software, statistical indicator adopts T inspection to carry out statistical study, statistical probability p<0.05 is significant difference, p<0.01 is extremely significant difference, corresponding sequence is obtained to above-mentioned four kinds of bacterium: vibrio alginolyticus (V.alginolyticus) after statistical study, Aeromonas hydrophila (Aeromonas hydrophila), Edwardsiella tarda (Edwardsiella tarda), the recognition effect of Ha Weishi vibrios (Vibrio harveyi), thus determine whether this sequence pair deactivation vibrio alginolyticus has affine specificity, the recognition detection of deactivation vibrio alginolyticus can be used for.
Experimental result:
By SELEX screening and affine specificity verification, I9 aptamer all has extremely significant avidity (p<0.01) to deactivation Vibrio harveyi, and this aptamer is all significantly higher than the avidity (p<0.01) to other 3 strain inactivated bacteria (vibrio alginolyticus, Aeromonas hydrophila and slow type tarda) in pole to the avidity of deactivation Vibrio harveyi, illustrate that this aptamer has significant specific recognition capability to deactivation Vibrio harveyi, can be applicable to the recognition detection of deactivation Vibrio harveyi.
The mensuration of 3.4 affinity costants
After affine specificity verification, select good this aptamer (I9) of affine specificity to carry out the mensuration of affinity costant, concrete grammar can be:
Synthesize this aptamer (being synthesized by Shanghai Sheng Gong biotechnology company limited), and in 5 ' end mark digoxin; Be diluted to ssDNA final concentration with 2 × binding buffer liquid and be respectively 10nM, 20nM, 40nM, 60nM, 80nM, 100nM, 120nM, 140nM, after being combined with deactivation Vibrio harveyi again, measuring avidity by the method in step 3.3 respectively, do the graph of a relation between avidity and ssDNA concentration, carry out with origin 8 software the affinity costant that the Fitting Calculation can obtain corresponding aptamer, corresponding affinity costant is Kd=29.17 ± 7.24nM.
The oligonucleotide sequence that can be used for deactivation Vibrio harveyi recognition detection of the present invention has the function of recognition detection deactivation Vibrio harveyi, and can be applied to separately the detection of deactivation Vibrio harveyi.
The described oligonucleotide sequence that can be used for deactivation Vibrio harveyi recognition detection can be used for the recognition detection of deactivation Vibrio harveyi in all kinds of sample, and described application is not used in medical diagnosis on disease.
Embody rule detection method is as follows:
1) preparation of inactivated bacterial liquid to be measured: sample thief, distilled water is inoculated in pancreas peptone soybean broth substratum (TSB) substratum after dissolving and soaking, and at 30 DEG C, about 8 ~ 10h cultivated by 100rpm shaking table.Then get bacterium liquid centrifugal, abandon supernatant nutrient solution, then the physiological saline added containing 6% formaldehyde is in 62.5 DEG C of water-bath 1h, centrifugal rear brine 3 times, then use the bacterium of 2 × binding buffer liquid suspension deactivation to precipitate, 4 DEG C of preservations.
2) applying detection method 1 (digoxin method): get inactivated bacterial liquid to be measured, the above-mentioned oligonucleotide sequence (I9) being marked with digoxin with 5 ' end detects inactivated bacterial liquid to be measured by the avidity measuring method of step 3.3; Replace bacterium liquid to be measured with deactivation Vibrio harveyi simultaneously, detect by the avidity measuring method of step 3.3 equally, obtain positive control; Replace inactivated bacterial liquid to be measured with sterile distilled water, detect by the avidity measuring method of step 3.3 equally, obtain negative control.Result shows, and positive controls color is yellow, and negative control group does not develop the color.If testing sample detected result presents yellow, then having Vibrio harveyi in interpret sample, is the positive, if testing sample detected result does not develop the color, does not then have Vibrio harveyi in interpret sample.
3) applying detection method 2 (the qualitative detection method of PCR-based): idiographic flow is divided into combination, washing, separation, amplification and electrophoresis detection.Specific as follows: to get the above-mentioned ssDNA (I9) that 5 μ L concentration are 10uM, be diluted to 100 μ L, 95 DEG C of sex change 5min with 2 × binding buffer liquid, after ice bath 10min, (bacteria concentration is 10 to add the bacteria suspension to be measured of deactivation respectively
2individual/more than mL) in, rotating speed 100rpm shaking table is in conjunction with 30min; Then the centrifugal 5min of 6000rpm, abandons supernatant, and sediment fraction is bacterium precipitation and its ssDNA combined, and washs 5 times with 500 μ L 1 × binding buffer liquid; Then in precipitation, 1 × binding buffer liquid 100ul is added, 95 DEG C of heating 5min, make the ssDNA sex change that it is combined with bacterium, thus be separated with vibrios, then the centrifugal 10min of 15000rpm, gets supernatant liquor, then the separable ssDNA to being combined with bacterium, then regular-PCR amplification is carried out in sampling, and reaction system is that the regular-PCR parameter of 25 μ L is as shown in table 3.
Table 3
| Composition | Unit (μ L) |
| ddH 2O | 19.4 |
| Primer P1 (10uM) | 1 |
| Primer P2 (10uM) | 1 |
| dNTP(10mM) | 0.4 |
| 10×PCR buffer | 2 |
| Template (ssDNA of screening) | 2 |
| Taq enzyme (5U/ μ L) | 0.2 |
Reaction conditions: 94 DEG C of denaturation 4min, then carry out 35 circulations (72 DEG C extend 20s for 94 DEG C of sex change 30s, 58 DEG C of annealing 30s), last 72 DEG C extend 7min.Obtain the PCR primer (being called for short the PCR primer of bacterium to be measured) of the ssDNA that bacterium to be measured with deactivation is combined.
(concentration is respectively 10 to use deactivation Vibrio harveyi bacterium liquid respectively
2, 10
3, 10
4individual/mL) and sterilized water replace inactivated bacterial liquid to be measured, carry out equally as stated above combining, wash, be separated and increase, obtain the PCR primer of the positive control of 3 gradients and the PCR primer of negative control.Finally the PCR primer agarose electrophoresis of the PCR primer of bacterium to be measured for deactivation, the PCR primer of Positive contrast bacteria and negative control is detected.Ultraviolet is taken pictures display, and negative control does not have bright band, three groups of positive controls have bright band.If to be measured group has bright band, having Vibrio harveyi in interpret sample, is the positive, if to be measured group does not have bright band, does not then have Vibrio harveyi in interpret sample.
The present invention not only detect quick, simple to operate, stability is high, and aptamer synthesis preparation is easily, and preparation cycle is shorter.
Accompanying drawing explanation
Fig. 1 is that I9 aptamer in the embodiment of the present invention 1 or SEQ ID No.1 are to the affine specificity of 4 kinds of inactivated bacteria.In figure, X-coordinate is inactivated bacteria, and ordinate zou is avidity.
Embodiment
Embodiment 1
The preparation process that can be used for the oligonucleotide sequence of deactivation Vibrio harveyi recognition detection of the present embodiment mainly comprises:
1, the ssDNA oligonucleotide library (5 '-TCA GTC GCT TCG CCG TCT CCT TC----N35----GCA CAA GAG GGA GAC CCC AGA GGG-3 ') for screening is synthesized: by the chemosynthesis of Shanghai Sheng Gong biotechnology company limited.
2, SELEX screening: concrete steps are as follows:
2.1 deactivation Vibrio harveyi bacterium solution preparations
With physiological saline, the Vibrio harveyi bacterium colony cultivating 24h is washed from inclined-plane, the centrifugal 5min of 6000rpm, abandon supernatant liquor, add physiological saline containing 6% formaldehyde again in 62.5 DEG C of water-bath 1h, centrifugal rear brine 3 times, the bacterium of 2 × binding buffer liquid suspension deactivation is used to precipitate again, 4 DEG C of preservations.
2.2 are combined with vibrios
Get the ssDNA oligonucleotide library 4 μ L that synthetic concentration is 100 μMs, 100 μ L are diluted to 2 × binding buffer liquid, 95 DEG C of sex change 5min, join in the Vibrio harveyi bacteria suspension of 100 μ L deactivations after ice bath 10min, 30 shaking tables are in conjunction with 2h, the more centrifugal 5min of 6000rpm, abandon supernatant, then use 1 × binding buffer liquid to wash precipitation 1 time, abandon supernatant, then sediment fraction is deactivation Vibrio harveyi precipitation and ssDNA combined with it;
In step 2.2, described 2 × binding buffer liquid is that 20 × binding buffer liquid distilled water dilutes the solution after 10 times, and described 1 × binding buffer liquid is that 20 × binding buffer liquid distilled water dilutes the solution after 20 times; Described 20 × binding buffer liquid formula is 1M NaCl, 50mM KCl, 500mM Tris-HCl, 10mM MgCl
2, pH 7.4.
The ssDNA of 2.3 separation and combination
In the sediment fraction of step 2.2 gained, add 1 × binding buffer liquid 100 μ L, 95 DEG C of heating 5min, make the ssDNA sex change be combined with vibrios, thus be separated with vibrios, then the centrifugal 10min of 15000rpm, gets supernatant liquor, then the separable ssDNA obtaining being combined with vibrios.
2.4 asymmetric PCR amplification ssDNA
Cumulative volume is that the amplification system of the asymmetric PCR of 25 μ L is as shown in table 4.
Table 4
| Composition | Volume (μ L) |
| Primer P1 (10uM) | 2 |
| Primer P2 (0.4uM) | 2 |
| dNTP(10mM) | 0.4 |
| 10 × PCR damping fluid | 2 |
| Template (ssDNA of screening) | 2 |
| Taq archaeal dna polymerase (5U/ μ L) | 0.2 |
| ddH 2O | 16.4 |
Primer P1 sequence is: 5 '-TCA GTC GCT TCG CCG TCT CCT TC-3 ', and primer P2 sequence is: 5 '-CCC TCTGGG GTC TCC CTC TTG TGC-3 '.Reaction conditions is: 94 DEG C of denaturation 4min, and then carry out 40 circulations (72 DEG C extend 20s for 94 DEG C of sex change 30s, 58 DEG C of annealing 30s), last 72 DEG C extend 7min.
The mensuration of 2.5 avidity
2.5.1 asymmetric PCR amplification: with the ssDNA library screened of increasing with the primer P1 of digoxigenin labeled and primer P2 asymmetric PCR, amplification condition is identical with parameter with the asymmetric PCR amplification system of step 2.4 with parameter.
2.5.2 mensuration avidity:
TMB Color Appearance System: with tetramethyl benzidine (TMB) for substrate, the Color Appearance System of horseradish peroxidase-labeled rabbit anti digoxin antibody IgG measures the aptamer amount being adsorbed onto vibrios surface.
The concrete steps of described mensuration avidity are as follows:
2.5.2.1 TMB dehydrated alcohol is made into 1mg/mL, 4 DEG C of shadings are preserved, and with front proportionally preparation, (TMB: substrate buffer solution: 30% hydrogen peroxide=100: 900: 1), namely join and namely use.
2.5.2.2 be combined with bacterium: the PCR primer of getting step 2.5.1 amplification gained, by ultramicrospectrophotometer mensuration ssDNA concentration wherein.Then get 1 μ L PCR primer, be diluted to 100 μ L with 2 × binding buffer liquid, 95 DEG C of sex change 5min, after ice bath 10min, add inactivated bacterial liquid 100 μ L and mix, 30 DEG C, 100rpm shaking table is in conjunction with 30min, and then centrifugation bacterial precipitation, abandons supernatant liquor.Do the blank that does not add ssDNA (replacing with binding buffer liquid) simultaneously.
2.5.2.3 wash: in above-mentioned bacterial precipitation, add 1 × binding buffer liquid 500 μ L, after mixing, be transferred to by bacteria suspension in new centrifuge tube, the centrifugal 5min of 6000rpm, abandons supernatant, get bacterium precipitation.
2.5.2.4 be combined with enzyme mark rabbit anti digoxin antibody: in bacterium is precipitated, add excessive enzyme mark rabbit anti digoxin antibody (IgG-HRP) that 100 μ L 1:900TBS are diluted, after mixing, reaction 10min, the ssDNA making it the digoxigenin labeled in precipitating with bacterium is combined.
2.5.2.5 wash: the centrifugal 5min of 6000rpm, abandon supernatant, then use 1 × binding buffer liquid 500 μ L to wash 3 times, bacteria suspension is all transferred in new centrifuge tube by each washing, finally abandons supernatant, obtains bacterium precipitation.
2.5.2.6TMB develop the color: add the resuspended bacterium precipitation of 400 μ L distilled water, then add 200 μ L TMB nitrite ions, after lucifuge colour developing 10min, with 2mol/L H
2sO
4100 μ L termination reactions, measure the light absorption value OD at 450nm place
450, namely this value reflects the avidity of the ssDNA be combined with bacterium, i.e. OD
in conjunction with, blank carries out above-mentioned steps 2.5.2.3,2.5.2.4,2.5.2.5 and 2.5.2.6 equally, obtains blank corresponding absorbancy OD
blank;
2.5.2.7 the avidity in corresponding library is calculated:
2.6 repeat screening
Take turns the screening library of product as next round of asymmetric PCR using each, repeat above-mentioned SELEX and screen step 2.1 ~ 2.5, until avidity no longer obviously rises, final screening obtains the enriched library of aptamer.
3, cloning and sequencing: carry out asymmetric PCR amplification (amplification condition is with step 2.4) by screening the aptamer enriched library obtained, amplified production send order-checking company to clone, and random picking 100 clones carry out check order (completing cloning and sequencing work by Shanghai Major Biological Medical Technology Co., Ltd.), obtain 95 effective ssDNA (being numbered 1-95), wherein there are 3 ssDNA for high copy sequence, numbering is respectively I3, I9, I23 etc.
4,3 the high copy ssDNA obtained step 3 carry out the mensuration of affine specific checking and affinity costant, and this ssDNA of final certification I9 has good affine specificity, and obtains the affinity costant of this aptamer.Concrete grammar is as follows:
3 high copy ssDNA sequences (being synthesized by Shanghai Sheng Gong biotechnology company limited) that the above-mentioned needs of 4.1 synthesis carry out verifying, and in 5 ' end mark digoxin;
The preparation of 4.2 inactivating microbial
Choose the pathogenic micro-organism that culture environment of aquatic products is common---vibrio alginolyticus (Vibrio alginolyticus), Aeromonas hydrophila (Aeromonas hydrophila), Edwardsiella tarda (Edwardsiella tarda) bacterium in contrast, together with Vibrio harveyi (Vibrio harveyi), aseptically be inoculated in pancreas peptone soybean broth substratum (TSB) respectively, at 30 DEG C, about 8 ~ 10h cultivated by 100rpm shaking table.Then get bacterium liquid centrifugal, abandon supernatant nutrient solution, then the physiological saline added containing 6% formaldehyde is in 62.5 DEG C of water-bath 1h, centrifugal rear brine 3 times, then use the bacterium of 2 × binding buffer liquid suspension deactivation to precipitate, 4 DEG C of preservations.
The mensuration of 4.3 avidity and affine specificity verification
4.3.1 be combined with bacterium: get the ssDNA sequence 10pmol 2 × binding buffer liquid synthesized and be diluted to 100 μ l, 95 DEG C of sex change 5min, after ice bath 10min, 100 μ l each with the bacterium liquid of above-mentioned 4 kinds of inactivated bacteria mix that (bacterium quantity is about 3 × 10 respectively
8individual), 28 DEG C, 100rpm shaking table in conjunction with 40min, the then centrifugal 5min of 6000rpm, separation of bacterial precipitation and supernatant liquor, do simultaneously one do not add ssDNA (with 2 × binding buffer liquid replacement) blank;
4.3.2 wash: the bacterium of above-mentioned inactivated bacteria precipitation is washed 1 time with 1 × binding buffer liquid 500 μ l, and the centrifugal 5min of 6000rpm, abandons supernatant, get bacterium precipitation;
4.3.3 be combined with horseradish peroxidase-labeled rabbit anti digoxin antibody: in bacterium is precipitated, add the excessive horseradish peroxidase-labeled rabbit anti digoxin antibody that 100 μ l TBS dilute, Dilution ratio is 1: 900, hybrid reaction 10min;
4.3.4 wash: the centrifugal 5min of 10000rpm, then use 1 × binding buffer liquid 500 μ l to wash 3 times, abandon supernatant, get bacterium precipitation;
4.3.5 develop the color: add the resuspended bacterium precipitation of 400 μ l distilled water, then add 200 μ l TMB nitrite ions, after lucifuge colour developing 10min, with 2mol/L H
2sO
4200 μ l termination reactions, measure the light absorption value OD at 450nm place
450, namely this value reflects the OD value of the anti-digoxin of enzyme mark of combination, is OD
in conjunction with, blank carries out above-mentioned steps 5.3.2,5.3.3,5.3.4 and 5.3.5 equally, obtains blank corresponding absorbancy OD
blank, the avidity=OD of corresponding aptamer
in conjunction with-OD
blank;
4.3.6 Data Management Analysis
Data processing is carried out with the statistical function in EXCEL software, statistical indicator adopts T inspection to carry out statistical study, statistical probability p<0.05 is significant difference, p<0.01 is extremely significant difference, the recognition effect of corresponding sequence to above-mentioned four kinds of bacterium is obtained after statistical study, thus determine can whether this sequence pair deactivation Vibrio harveyi has affine specificity, be used for the recognition detection of deactivation Vibrio harveyi.
Experimental result:
By SELEX screening and affine specificity verification, I9 aptamer has significant avidity (p<0.05) to deactivation Vibrio harveyi, and this aptamer is all significantly higher than the avidity (p<0.05) to other 3 strain inactivated bacteria (vibrio alginolyticus, Aeromonas hydrophila and slow type tarda) to the avidity of deactivation Vibrio harveyi, illustrate that this aptamer has significant specific recognition capability (as shown in Figure 1) to deactivation Vibrio harveyi, can be applicable to the recognition detection of deactivation Vibrio harveyi.
The mensuration of 4.4 affinity costants
After affine specificity verification, select the better aptamer of affine specificity (I9) to carry out the mensuration of affinity costant, the concrete grammar that affinity costant measures is as follows:
Synthesize this aptamer (being synthesized by Shanghai Sheng Gong biotechnology company limited), and in 5 ' end mark digoxin; Be diluted to ssDNA final concentration with 2 × binding buffer liquid and be respectively 10nM, 20nM, 40nM, 60nM, 80nM, 100nM, 120nM, 140nM, after being combined with deactivation Vibrio harveyi, the method for pressing respectively in 3.3 measures avidity, does the graph of a relation between avidity and ssDNA concentration again, carry out with origin 8 software the affinity costant that the Fitting Calculation can obtain corresponding aptamer, be specially Kd=29.17 ± 7.24nM.
Embodiment 2
This oligonucleotide sequence has the purposes of recognition detection deactivation Vibrio harveyi: the concrete step that uses is as follows:
1) get the aquaculture water having infected vibriosis, distilled water is inoculated in pancreas peptone soybean broth substratum (TSB) substratum after dissolving, and at 30 DEG C, about 8 ~ 10h cultivated by 100rpm shaking table.Then get bacterium liquid centrifugal, abandon supernatant nutrient solution, then the physiological saline added containing 6% formaldehyde is in 62.5 DEG C of water-bath 1h, centrifugal rear brine 3 times, then use the bacterium of 2 × binding buffer liquid suspension deactivation to precipitate, obtain inactivated bacterial liquid to be measured, 4 DEG C of preservations.Get inactivated bacterial liquid to be measured, the aptamer I9 (SEQ ID No.1) being marked with digoxin with 5 ' end detects inactivated bacterial liquid to be measured by the avidity measuring method of step 3.3; Replace bacterium liquid to be measured with deactivation Vibrio harveyi simultaneously, detect by the avidity measuring method of step 3.3 equally, obtain positive control; Replace inactivated bacterial liquid to be measured with sterile distilled water, detect by the avidity measuring method of step 3.3 equally, obtain negative control.Result display positive controls and experimental group its colour changed into yellow, negative control group color is constant, has Vibrio harveyi in interpret sample, illustrates that this aquaculture water has infected Vibrio harveyi.
2) get the water sample of normal aquaculture water, distilled water is inoculated in pancreas peptone soybean broth substratum (TSB) substratum after dissolving, and at 30 DEG C, about 8 ~ 10h cultivated by 100rpm shaking table.Then get bacterium liquid centrifugal, abandon supernatant nutrient solution, then the physiological saline added containing 6% formaldehyde is in 62.5 DEG C of water-bath 1h, centrifugal rear brine 3 times, then use the bacterium of 2 × binding buffer liquid suspension deactivation to precipitate, obtain inactivated bacterial liquid to be measured, 4 DEG C of preservations.Get inactivated bacterial liquid to be measured, the aptamer I9 (SEQ ID No.1) being marked with digoxin with 5 ' end detects inactivated bacterial liquid to be measured by the avidity measuring method of step 3.3; Replace bacterium liquid to be measured with deactivation vibrio alginolyticus simultaneously, detect by the avidity measuring method of step 3.3 equally, obtain positive control; Replace inactivated bacterial liquid to be measured with sterile distilled water, detect by the avidity measuring method of step 3.3 equally, obtain negative control.Result display positive controls its colour changed into yellow, negative control group and experimental group color constant, there is no Vibrio harveyi in interpret sample, illustrate that this aquaculture water does not infect Vibrio harveyi.
3) get the sea area water sample that vibriosis is popular, distilled water is inoculated in pancreas peptone soybean broth substratum (TSB) substratum after dissolving, and at 30 DEG C, about 8 ~ 10h cultivated by 100rpm shaking table.Then get bacterium liquid centrifugal, abandon supernatant nutrient solution, then the physiological saline added containing 6% formaldehyde is in 62.5 DEG C of water-bath 1h, centrifugal rear brine 3 times, then use the bacterium of 2 × binding buffer liquid suspension deactivation to precipitate, obtain inactivated bacterial liquid to be measured, 4 DEG C of preservations.Then get I9 (the SEQ ID No.1) aptamer that 5 μ L concentration are 10uM, be diluted to 100ul, 95 DEG C of sex change 5min with 2 × binding buffer liquid, after ice bath 10, (bacteria concentration is 10 to add the bacteria suspension to be measured of deactivation respectively
2individual/more than mL) in, rotating speed 100rpm shaking table is in conjunction with 30min; Then the centrifugal 5min of 6000rpm, abandons supernatant, and sediment fraction 500 μ L 1 × binding buffer liquid wash 5 times; Then in precipitation, add 1 × binding buffer liquid 100 μ L, 95 DEG C of heating 5min, make the ssDNA sex change that it is combined with bacterium, thus be separated with bacterium, then the centrifugal 10min of 15000rpm, gets supernatant liquor, carry out regular-PCR amplification, reaction system is that the regular-PCR of 25 μ L is see table 5.
Table 5
| Composition | Unit (μ L) |
| ddH 2O | 19.4 |
| Primer P1 (10uM) | 1 |
| Primer P2 (10uM) | 1 |
| dNTP(10mM) | 0.4 |
| 10×PCR buffer | 2 |
| Template (ssDNA of screening) | 2 |
| Taq enzyme (5U/ μ L) | 0.2 |
Reaction conditions: 94 DEG C of denaturation 4min, then carry out 35 circulations (72 DEG C extend 20s for 94 DEG C of sex change 30s, 58 DEG C of annealing 30s), last 72 DEG C extend 7min.Obtain the PCR primer of deactivation bacterium to be measured.
(concentration is respectively 10 to use deactivation Vibrio harveyi bacterium liquid respectively
2, 10
3, 10
4individual/mL) and sterilized water replace inactivated bacterial liquid to be measured, carry out equally as stated above combining, wash, be separated and increase, obtain the PCR primer of the positive control of 3 gradients and the PCR primer of negative control.Finally the PCR primer agarose electrophoresis of the PCR primer of bacterium to be measured for deactivation, the PCR primer of positive control and negative control is detected.Ultraviolet is taken pictures display, and negative control does not have bright band, three groups of positive controls and bacterium to be measured to have bright band, and have Vibrio harveyi in interpret sample, Vibrio harveyi has been infected in this sea area.
Claims (8)
1. oligonucleotide sequence, is characterized in that described SEQ ID No.1 is designated as " I9 aptamer " for the oligonucleotide sequence shown in SEQ ID No.1; Described SEQ ID No.1 is: 5 '-TCA GTC GCT TCG CCG TCT CCT TCGGGTGGAGGAGGACGAAGTGAGAGCACAAGAGGGA GCA CAA GAG GGA GAC CCCAGA GGG-3 '.
2. the preparation method of oligonucleotide sequence as claimed in claim 1, is characterized in that comprising the following steps:
1) the ssDNA oligonucleotide library (5 '-TCA GTC GCT TCG CCG TCT CCT TC----N35----GCA CAA GAG GGA GAC CCC AGA GGG-3 ') of synthesis for screening, wherein N35 is 35 random oligonucleotides;
2) SELEX screening is carried out after being mixed with deactivation Vibrio harveyi by oligonucleotide library, until avidity no longer obviously rises;
3) SELEX has screened and has carried out cloning and sequencing to aptamer enriched library afterwards, selects the copy of height wherein ssDNA to carry out the mensuration of affine specific checking and affinity costant, obtains corresponding aptamer.
3. the preparation method of oligonucleotide sequence as claimed in claim 2, is characterized in that in step 2) in, the concrete steps of described SELEX screening are:
The preparation of 2.1 deactivation Vibrio harveyi bacterium liquid
With physiological saline, the Vibrio harveyi bacterium colony cultivating 24h is washed from inclined-plane, the centrifugal 5min of 6000rpm, abandon supernatant liquor, add physiological saline containing 6% formaldehyde again in 62.5 DEG C of water-bath 1h, centrifugal rear brine 3 times, use the bacterium precipitation of 2 × binding buffer liquid suspension fire extinguishing again, 4 DEG C of preservations;
2.2 are combined with vibrios
Get the ssDNA oligonucleotide library 4 μ L that synthetic concentration is 100 μMs, 100 μ L are diluted to 2 × binding buffer liquid, 95 DEG C of sex change 5min, join in the Vibrio harveyi bacteria suspension of 100 μ L deactivations after ice bath 10min, 30 DEG C of shaking tables are in conjunction with 2h, the more centrifugal 5min of 6000rpm, abandon supernatant, then use 1 × binding buffer liquid to wash precipitation 1 time, abandon supernatant, then sediment fraction is deactivation Vibrio harveyi precipitation and ssDNA combined with it;
The ssDNA of 2.3 separation and combination
In the sediment fraction of step 2.2 gained, add 1 × binding buffer liquid 100 μ L, 95 DEG C of heating 5min, make the ssDNA sex change be combined with vibrios, thus be separated with vibrios, then the centrifugal 10min of 15000rpm, gets supernatant liquor, be then separated the ssDNA obtaining being combined with vibrios;
2.4 asymmetric PCR amplification ssDNA
Cumulative volume is that the amplification system of the asymmetric PCR of 25 μ L is as shown in table 1;
Table 1
Primer P1 sequence is: 5 '-TCA GTC GCT TCG CCG TCT CCT TC-3 ';
Primer P2 sequence is: 5 '-CCC TCT GGG GTC TCC CTC TTG TGC-3 ';
Reaction conditions is: 94 DEG C of denaturation 4min, and then carry out 40 circulations (72 DEG C extend 20s for 94 DEG C of sex change 30s, 58 DEG C of annealing 30s), last 72 DEG C extend 7min;
The mensuration of 2.5 avidity
2.5.1 asymmetric PCR amplification: with the ssDNA library screened of increasing with the primer P1 of digoxigenin labeled and primer P2 asymmetric PCR, amplification condition is identical with the asymmetric PCR of step 2.4 with parameter;
2.5.2 mensuration avidity:
TMB Color Appearance System: take tetramethyl benzidine as substrate, the Color Appearance System of horseradish peroxidase-labeled rabbit anti digoxin antibody IgG measures the aptamer amount being adsorbed onto vibrios surface;
2.6 repeat screening
Take turns the screening library of product as next round of asymmetric PCR using each, repeat above-mentioned SELEX and screen step 2.1 ~ 2.5, until avidity no longer obviously rises, final screening obtains the enriched library of aptamer.
4. the preparation method of oligonucleotide sequence as claimed in claim 3, it is characterized in that in step 2.2, described 2 × binding buffer liquid is that 20 × binding buffer liquid distilled water dilutes the solution after 10 times, and described 1 × binding buffer liquid is that 20 × binding buffer liquid distilled water dilutes the solution after 20 times; Described 20 × binding buffer liquid formula is 1M NaCl, 50mM KCl, 500mM Tris-HCl, 10mM MgCl
2, pH 7.4.
5. the preparation method of oligonucleotide sequence as claimed in claim 3, it is characterized in that in step 2.5.2, the concrete steps of described mensuration avidity are:
2.5.2.1 TMB dehydrated alcohol is made into 1mg/mL, 4 DEG C of shadings are preserved, and prepare in proportion further, TMB: substrate buffer solution: 30% hydrogen peroxide=100: 900: 1 again, namely join and namely use with front;
2.5.2.2 be combined with bacterium: the PCR primer of getting step 2.5.1 amplification gained, by ultramicrospectrophotometer mensuration ssDNA concentration wherein, get 1 μ L PCR primer again, be diluted to 100 μ L with 2 × binding buffer liquid, 95 DEG C of sex change 5min, after ice bath 10min, add inactivated bacterial liquid 100 μ L to mix, 30 DEG C, 100rpm shaking table is in conjunction with 30min, then centrifugation bacterial precipitation, abandons supernatant liquor; Do a blank simultaneously, replace ssDNA with binding buffer liquid;
2.5.2.3 wash: in above-mentioned bacterial precipitation, add 1 × binding buffer liquid 500 μ L, after mixing, be transferred to by bacteria suspension in new centrifuge tube, the centrifugal 5min of 6000rpm, abandons supernatant, get bacterium precipitation;
2.5.2.4 be combined with enzyme mark rabbit anti digoxin antibody: in bacterium is precipitated, add the excessive enzyme mark rabbit anti digoxin antibody that 100 μ L 1: 900TBS are diluted, after mixing, reaction 10min, the ssDNA making it the digoxigenin labeled in precipitating with bacterium is combined;
2.5.2.5 wash: the centrifugal 5min of 6000rpm, abandon supernatant, then use 1 × binding buffer liquid 500 μ L to wash 3 times, bacteria suspension is all transferred in new centrifuge tube by each washing, finally abandons supernatant, obtains bacterium precipitation;
2.5.2.6TMB develop the color: add the resuspended bacterium precipitation of 400 μ L distilled water, then add 200 μ L TMB nitrite ions, after lucifuge colour developing 10min, with 2mol/L H
2sO
4100 μ L termination reactions, measure the light absorption value OD at 450nm place
450, namely this value reflects the avidity of the ssDNA be combined with bacterium, i.e. OD
in conjunction with, blank carries out above-mentioned steps 2.5.2.3,2.5.2.4,2.5.2.5 and 2.5.2.6 equally, obtains blank corresponding absorbancy OD
blank;
2.5.2.7 the avidity in corresponding library is calculated:
6. the preparation method of oligonucleotide sequence as claimed in claim 2, it is characterized in that in step 3) in, described cloning and sequencing is carried out to aptamer enriched library, the copy of height wherein ssDNA is selected to carry out the mensuration of affine specific checking and affinity costant, obtain corresponding aptamer, its concrete grammar is:
By step 2) the aptamer enriched library that filters out carries out asymmetric PCR amplification, and amplification condition is with step 2.4, and amplified production send order-checking company to clone, and random picking more than 5 clone checks order, and obtains a series of oligonucleotide sequence or ssDNA; Then compare analysis to a series of ssDNA obtained, find that some ssDNA is identical, some ssDNA has the copy of more than 2 in sequencing result in other words; If do not find this multiple copied ssDNA, then repeating step 3), continue cloning and sequencing, until obtain the ssDNA of at least one multiple copied, then select these multiple copieies ssDNA to carry out affine specificity verification, obtain corresponding aptamer, detailed process is as follows:
3.1 synthesis need the ssDNA sequence carrying out verifying, and in 5 ' end mark digoxin;
The preparation of 3.2 inactivating microbial
Choose the pathogenic micro-organism that culture environment of aquatic products is common---vibrio alginolyticus (V.alginolyticus), Aeromonas hydrophila (Aeromonas hydrophila), Edwardsiella tarda (Edwardsiella tarda) bacterium in contrast, together with Ha Weishi vibrios (Vibrio harveyi), aseptically be inoculated into respectively in pancreas peptone soybean broth substratum, at 30 DEG C, 8 ~ 10h cultivated by 100rpm shaking table, then bacterium liquid is got centrifugal, abandon supernatant nutrient solution, add physiological saline containing 6% formaldehyde again in 62.5 DEG C of water-bath 1h, centrifugal rear brine 3 times, use the bacterium precipitation of 2 × binding buffer liquid suspension fire extinguishing again, 4 DEG C of preservations,
The mensuration of 3.3 avidity and affine specificity verification
3.3.1 be combined with bacterium: get the ssDNA sequence 10pmol 2 × binding buffer liquid synthesized and be diluted to 100 μ l, 95 DEG C of sex change 5min, after ice bath 10min, 100 μ l each with the bacterium liquid of above-mentioned 4 kinds of inactivated bacteria mix respectively, and bacterium quantity is about 3 × 10
8individual, 28 DEG C, 100rpm shaking table in conjunction with 40min, the then centrifugal 5min of 6000rpm, isolate precipitation and supernatant liquor, do the blank that does not add ssDNA simultaneously, replace with 2 × binding buffer liquid;
3.3.2 wash: the bacterium of above-mentioned inactivated bacteria precipitation is washed 1 time with 1 × binding buffer liquid 500 μ l, and the centrifugal 5min of 6000rpm, abandons supernatant, get bacterium precipitation;
3.3.3 be combined with horseradish peroxidase-labeled rabbit anti digoxin antibody: in bacterium is precipitated, add the excessive horseradish peroxidase-labeled rabbit anti digoxin antibody that 100 μ l TBS dilute, the Dilution ratio of TBS is 1: 900, hybrid reaction 10min;
3.3.4 wash: the centrifugal 5min of 10000rpm, then use 1 × binding buffer liquid 500 μ l to wash 3 times, abandon supernatant, get bacterium precipitation;
3.3.5 develop the color: add the resuspended bacterium precipitation of 400 μ l distilled water, then add 200 μ l TMB nitrite ions, after lucifuge colour developing 10min, with 2mol/L H
2sO
4200 μ l termination reactions, measure the light absorption value OD at 450nm place
450, namely this value reflects the OD value of the anti-digoxin of enzyme mark of combination, is OD
in conjunction with, blank carries out above-mentioned steps 5.3.2,5.3.3,5.3.4 and 5.3.5 equally, obtains blank corresponding absorbancy OD
blank, the avidity=OD of corresponding aptamer
in conjunction with-OD
blank;
3.3.6 Data Management Analysis
Data processing is carried out with the statistical function in EXCEL software, statistical indicator adopts T inspection to carry out statistical study, statistical probability p<0.05 is significant difference, p<0.01 is extremely significant difference, corresponding sequence is obtained to above-mentioned four kinds of bacterium: vibrio alginolyticus (V.alginolyticus) after statistical study, Aeromonas hydrophila (Aeromonas hydrophila), Edwardsiella tarda (Edwardsiella tarda), the recognition effect of Ha Weishi vibrios (Vibrio harveyi), thus determine whether this sequence pair deactivation vibrio alginolyticus has affine specificity, the recognition detection of deactivation vibrio alginolyticus can be used for,
The mensuration of 3.4 affinity costants
After affine specificity verification, select good this aptamer I9 of affine specificity to carry out the mensuration of affinity costant, concrete grammar is:
Synthesize this aptamer, and in 5 ' end mark digoxin; Be diluted to ssDNA final concentration with 2 × binding buffer liquid and be respectively 10nM, 20nM, 40nM, 60nM, 80nM, 100nM, 120nM, 140nM, after being combined with deactivation Vibrio harveyi again, measuring avidity by the method in step 3.3 respectively, do the graph of a relation between avidity and ssDNA concentration, carry out with origin 8 software the affinity costant that the Fitting Calculation obtains corresponding aptamer, corresponding affinity costant is Kd=29.17 ± 7.24nM.
7. oligonucleotide sequence is to the application in deactivation Vibrio harveyi recognition detection in all kinds of sample as claimed in claim 1, and described application is not used in medical diagnosis on disease.
8. apply as claimed in claim 7, it is characterized in that the concrete grammar of described recognition detection is:
1) preparation of inactivated bacterial liquid to be measured: sample thief, after distilled water dissolves and soaks, be inoculated in pancreas peptone soybean broth substratum, at 30 DEG C, about 8 ~ 10h cultivated by 100rpm shaking table, then gets bacterium liquid centrifugal, abandons supernatant nutrient solution, add physiological saline containing 6% formaldehyde again in 62.5 DEG C of water-bath 1h, centrifugal rear brine 3 times, then use the bacterium of 2 × binding buffer liquid suspension deactivation to precipitate, 4 DEG C of preservations;
2) applying detection method 1 i.e. digoxin method: get inactivated bacterial liquid to be measured, the above-mentioned oligonucleotide sequence (I9) being marked with digoxin with 5 ' end detects inactivated bacterial liquid to be measured by the avidity measuring method of step 3.3; Replace bacterium liquid to be measured with deactivation Vibrio harveyi simultaneously, detect by the avidity measuring method of step 3.3 equally, obtain positive control; Replace inactivated bacterial liquid to be measured with sterile distilled water, detect by the avidity measuring method of step 3.3 equally, obtain negative control; Result shows, and positive controls color is yellow, and negative control group does not develop the color; If testing sample detected result presents yellow, then having Vibrio harveyi in interpret sample, is the positive, if testing sample detected result does not develop the color, does not then have Vibrio harveyi in interpret sample; Or
The applying detection method 2 i.e. qualitative detection method of PCR-based: idiographic flow is divided into combination, washing, separation, amplification and electrophoresis detection, specific as follows: to get the above-mentioned ssDNA (I9) that 5 μ L concentration are 10uM, 100 μ L are diluted to 2 × binding buffer liquid, 95 DEG C of sex change 5min, after ice bath 10min, add respectively in the bacteria suspension to be measured of deactivation, bacteria concentration is 10
2individual/more than mL, rotating speed 100rpm shaking table is in conjunction with 30min; Then the centrifugal 5min of 6000rpm, abandons supernatant, and sediment fraction is bacterium precipitation and its ssDNA combined, and washs 5 times with 500 μ L 1 × binding buffer liquid; Then in precipitation, 1 × binding buffer liquid 100ul is added, 95 DEG C of heating 5min, make the ssDNA sex change that it is combined with bacterium, thus be separated with vibrios, then the centrifugal 10min of 15000rpm, gets supernatant liquor, be then separated to the ssDNA that can be combined with bacterium, then regular-PCR amplification is carried out in sampling, and reaction system is that the regular-PCR parameter of 25 μ L is as shown in table 3;
Table 3
Reaction conditions: 94 DEG C of denaturation 4min, then carries out 35 circulations, 94 DEG C of sex change 30s, 58 DEG C of annealing 30s, and 72 DEG C extend 20s, and last 72 DEG C extend 7min, obtain the PCR primer of the ssDNA that bacterium to be measured with deactivation is combined, be called for short the PCR primer of bacterium to be measured;
Inactivated bacterial liquid to be measured is replaced respectively with deactivation Vibrio harveyi bacterium liquid and sterilized water, combine equally as stated above, washing, be separated and amplification, obtain the PCR primer of the positive control of 3 gradients and the PCR primer of negative control, finally by the PCR primer of bacterium to be measured for deactivation, the PCR primer of Positive contrast bacteria and the PCR primer agarose electrophoresis of negative control detect, ultraviolet is taken pictures display, negative control does not have bright band, three groups of positive controls have bright band, if to be measured group has bright band, Vibrio harveyi is had in interpret sample, for the positive, if to be measured group does not have bright band, then there is no Vibrio harveyi in interpret sample, the concentration of described deactivation Vibrio harveyi bacterium liquid is respectively 10
2, 10
3, 10
4individual/mL.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410576464.7A CN104388422B (en) | 2014-10-24 | 2014-10-24 | Oligonucleotide sequence and preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410576464.7A CN104388422B (en) | 2014-10-24 | 2014-10-24 | Oligonucleotide sequence and preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104388422A true CN104388422A (en) | 2015-03-04 |
| CN104388422B CN104388422B (en) | 2017-08-25 |
Family
ID=52606383
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410576464.7A Active CN104388422B (en) | 2014-10-24 | 2014-10-24 | Oligonucleotide sequence and preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104388422B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109187966A (en) * | 2018-09-17 | 2019-01-11 | 集美大学 | Fluorescent marker and micro- knowledge method for distinguishing are carried out to Vibrio harveyi using aptamers |
| CN110578010A (en) * | 2019-09-03 | 2019-12-17 | 集美大学 | Four groups of oligonucleotide sequences for identifying and identifying vibrio anguillarum and screening method thereof |
| CN112210557A (en) * | 2020-10-26 | 2021-01-12 | 集美大学 | Aptamer H10 with targeted inhibition effect on vibrio anguillarum and application thereof |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001009159A1 (en) * | 1990-06-11 | 2001-02-08 | Gilead Sciences, Inc. | Nucleic acid ligands to hepatocyte growth factor/scatter factor (hgf/sf) or its receptor c-met and to integrins |
| WO2007043784A1 (en) * | 2005-10-07 | 2007-04-19 | Industry-Academic Cooperation Foundation, Dankook University | Rna aptamers and the uses thereof |
| CN101475986A (en) * | 2009-01-20 | 2009-07-08 | 中国水产科学研究院黄海水产研究所 | Chip for gene detection of multiple vibrios at the same time, and detection and use thereof |
| CN101691608A (en) * | 2009-06-03 | 2010-04-07 | 宁波大学 | Gene chip of aquatic product cultivation pathogenic bacterium |
| CN101879317A (en) * | 2010-05-21 | 2010-11-10 | 中国海洋大学 | Preparation method and application of Vibro harveyi and Vibrio parahaemolyticus bigeminy DNA vaccine |
| CN102329862A (en) * | 2011-09-02 | 2012-01-25 | 集美大学 | Three oligonucleotide sequences for identification and detection of vibrio alginolyticus as well as preparation method and application thereof |
| CN102605075A (en) * | 2012-03-22 | 2012-07-25 | 集美大学 | A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences |
| CN103060326A (en) * | 2012-12-17 | 2013-04-24 | 集美大学 | Six oligonucleotide sequences and application thereof |
-
2014
- 2014-10-24 CN CN201410576464.7A patent/CN104388422B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001009159A1 (en) * | 1990-06-11 | 2001-02-08 | Gilead Sciences, Inc. | Nucleic acid ligands to hepatocyte growth factor/scatter factor (hgf/sf) or its receptor c-met and to integrins |
| WO2007043784A1 (en) * | 2005-10-07 | 2007-04-19 | Industry-Academic Cooperation Foundation, Dankook University | Rna aptamers and the uses thereof |
| CN101475986A (en) * | 2009-01-20 | 2009-07-08 | 中国水产科学研究院黄海水产研究所 | Chip for gene detection of multiple vibrios at the same time, and detection and use thereof |
| CN101691608A (en) * | 2009-06-03 | 2010-04-07 | 宁波大学 | Gene chip of aquatic product cultivation pathogenic bacterium |
| CN101879317A (en) * | 2010-05-21 | 2010-11-10 | 中国海洋大学 | Preparation method and application of Vibro harveyi and Vibrio parahaemolyticus bigeminy DNA vaccine |
| CN102329862A (en) * | 2011-09-02 | 2012-01-25 | 集美大学 | Three oligonucleotide sequences for identification and detection of vibrio alginolyticus as well as preparation method and application thereof |
| CN102605075A (en) * | 2012-03-22 | 2012-07-25 | 集美大学 | A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences |
| CN103060326A (en) * | 2012-12-17 | 2013-04-24 | 集美大学 | Six oligonucleotide sequences and application thereof |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109187966A (en) * | 2018-09-17 | 2019-01-11 | 集美大学 | Fluorescent marker and micro- knowledge method for distinguishing are carried out to Vibrio harveyi using aptamers |
| CN110578010A (en) * | 2019-09-03 | 2019-12-17 | 集美大学 | Four groups of oligonucleotide sequences for identifying and identifying vibrio anguillarum and screening method thereof |
| CN112210557A (en) * | 2020-10-26 | 2021-01-12 | 集美大学 | Aptamer H10 with targeted inhibition effect on vibrio anguillarum and application thereof |
| CN112210557B (en) * | 2020-10-26 | 2022-03-22 | 集美大学 | Aptamer H10 with targeted inhibition effect on vibrio anguillarum and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104388422B (en) | 2017-08-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103060326A (en) | Six oligonucleotide sequences and application thereof | |
| CN102329862B (en) | Three oligonucleotide sequences for identification and detection of vibrio alginolyticus as well as preparation method and application thereof | |
| CN102605075B (en) | A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences | |
| Linton et al. | Molecular identification of unusual pathogenic yeast isolates by large ribosomal subunit gene sequencing: 2 years of experience at the United Kingdom mycology reference laboratory | |
| CN105018644B (en) | A kind of respiratory pathogen detection kit | |
| CN102199667A (en) | Oligonucleotide sequence for detecting vibrio alginolyticus and application thereof | |
| Zhang et al. | A Myb transcription factor of Phytophthora sojae, regulated by MAP kinase PsSAK1, is required for zoospore development | |
| CN102816840A (en) | Multiplex fluorescent PCR kit for detection of vibrios in water body and detection method. | |
| CN108977582B (en) | A kind of real-time fluorescence quantitative RT-PCR detection method of avian infectious bronchitis virus | |
| Ruzicka et al. | Inside arbuscular mycorrhizal roots–molecular probes to understand the symbiosis | |
| CN104164508A (en) | LAMP (Loop-Mediated Isothermal Amplification) primer group, kit and method for detecting streptococcus pneumoniae | |
| CN104388422A (en) | Oligonucleotide sequence as well as preparation method and application thereof | |
| CN109778321A (en) | A kind of banking process, kit and sequencing approach for macro gene order-checking | |
| CN107653308B (en) | One group is combined and kit for distinguishing active tuberculosis patient with the primer pair of non-tuberculous pneumonia patient | |
| CN102851384A (en) | Multi-PCR (polymerase chain reaction) detection method of four diarrhoeic Escherichia coli and primer group thereof | |
| CN105063228B (en) | The detection kit and detection method of a kind of flavobacterium columnare | |
| CN108486279A (en) | A method of pigeon with newcastle disease is detected based on fluorescent quantitative PCR technique | |
| Gu et al. | Quantitative multiplexed detection of common pulmonary fungal pathogens by labeled primer polymerase chain reaction | |
| CN103451305A (en) | Primers, probe, method and kit for detecting diffusely adherent Escherichia coli | |
| CN103952483B (en) | DPO-PCR method is utilized to detect DPO primer sequence and the detection kit of vibrio alginolyticus | |
| CN102154270A (en) | Cronobacter sakazakii O antigen specific nucleotides and use thereof | |
| Wong et al. | Rapid authentication of Cordyceps by lateral flow dipstick | |
| CN103080312A (en) | Primer pairs for detecting orientia tsutsugamushi and detection method using the same | |
| CN102816841B (en) | Four-color fluorescent PCR kit for detection of vibrios in water body and detection method | |
| Frickmann et al. | Rapid identification of yeast by fluorescence in situ hybridisation from broth and blood cultures |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |