CN103060326A - Six oligonucleotide sequences and application thereof - Google Patents
Six oligonucleotide sequences and application thereof Download PDFInfo
- Publication number
- CN103060326A CN103060326A CN201210552569XA CN201210552569A CN103060326A CN 103060326 A CN103060326 A CN 103060326A CN 201210552569X A CN201210552569X A CN 201210552569XA CN 201210552569 A CN201210552569 A CN 201210552569A CN 103060326 A CN103060326 A CN 103060326A
- Authority
- CN
- China
- Prior art keywords
- bacterium
- ssdna
- binding buffer
- precipitation
- vibrio alginolyticus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to six oligonucleotide sequences and an application thereof, relating to the recognition detection of vibrio alginolyticus. The invention provides six oligonucleotide sequences capable of inactivating the recognition detection of vibrio alginolyticus, a preparation method and an application thereof. The oligonucleotide sequence has the characteristics of being quick in detection, simple in operation, superior to that of antibody and the like in stability, and the preparation method is easy and relatively short in preparation period. The six oligonucleotide sequences comprise oligonucleotide sequences of SEQ ID No.1-6, and the recognition detection of vibrio alginolyticus can be inactivated by adopting one of the oligonucleotide sequences. The preparation method comprises the following steps: synthesizing an ssDNA oligonucleotide library used for filtering; carrying out SELEX filtering after the oligonucleotide library is mixed with inactivated vibrio alginolyticus till the affinity is not raised obviously; then cloning and sequencing; and selecting a highly copied ssDNA thereof to carry out verification of affinity specificity and determination of affinity constants so as to obtain corresponding an aptamer. The six oligonucleotide sequences can be used for recognition detection of inactivated vibrio alginolyticus.
Description
Technical field
The present invention relates to the recognition detection of vibrio alginolyticus, especially relate to 6 oligonucleotide sequence and application thereof that can be used for the vibrio alginolyticus recognition detection.
Background technology
In aquaculture, annual have 10% aquatic animal to die from infectious disease approximately, and wherein the disease that causes of vibrio infection has accounted for sizable proportion.Although pharmaceutical chemicals and microbiotic can be controlled its infection; but medical treatment often can produce adverse consequences; as at aquatic animal cylinder accumulation, residual; produce easily the problems such as Resistant strain and easy contaminate environment; therefore set up the Fast Detection Technique of pathogenic vibrio, with the generation that prevents and treats ahead of time disease with popularly be still present Main Means.
At present, the detection method of vibrios mainly is according to uncle Jie Shi Bacteria Identification handbook, detect by the physiological and biochemical property to microorganism and identify, owing to need the project of test more, so the method workload is large, operation is more loaded down with trivial details.Though the molecular biology method of 16SRNA has higher accuracy, need to extract the 16SRNA of pathogenic bacteria, formality is more loaded down with trivial details, and test set is had certain requirement, is difficult to realize on-the-spot rapid detection needs; Though the antiserum(antisera) of immunological method preparation can be realized rapid detection, because the antiserum(antisera) of preparation is polyclonal antibody, false positive or false negative may occur in the practical application, even adopt monoclonal antibody.Because technology of preparing is had relatively high expectations, the cycle is longer, so its application is restricted.
Index concentration part evolution technology (Systemic Evolution ofLigands by Exponential Enrichment) is called for short the SELEX technology, is a kind of screening system technology that in recent years new development is got up.It utilizes oligonucleotide molecules can form in the space diversified three-dimensional structure, by the random oligonucleotide storehouse that makes up, therefrom filter out the oligonucleotide molecules that the high-affinity of specific recognition effect is arranged with the target molecule---aptamer, its molecule distinguishability can meet or exceed the level of monoclonal antibody, and technology of preparing is then simple, quick than monoclonal antibody.Use this technology to filter out at present the aptamer of tumour cell, anthrax bacillus etc., can be used for detection, the identification of tumour cell and anthrax bacillus.
The rapid detection that appears as microorganism of SELEX technology provides new Research Thinking, and its application will be more and more extensive also.In SELEX screening, screen take inactivated bacteria as target, not only have preferably security, and make the form of object bacteria relatively stable and fixing, thus Effective Raise efficient and the effect of screening.Simultaneously, take inactivated bacteria as target, can also effectively avoid environmental factor on the impact of viable bacteria, the stability of screening is improved preferably.Therefore, carry out the SELEX screening take inactivated bacteria as target, significant.
Vibrio alginolyticus is a kind of a kind of pathogenic micro-organism of seawater and place, river mouth all over the world that is distributed widely in, its quantity occupies first of the seawater class vibrios, be present in the multiple marine animal, it is the conditioned pathogen of the marine cultured animals such as fish, shrimp, shellfish, and can cause the diseases such as the people poisons by food, ear's inflammation, public health security is consisted of very serious threat.Therefore, use SELEX technology screening deactivation vibrio alginolyticus aptamer, and be applied to the identification evaluation of deactivation vibrio alginolyticus, can greatly improve sensitivity and specificity that vibrio alginolyticus detects, become emphasis of the present invention.
The applicant discloses 4 aptamer sequences in Chinese patent 201110090419.7, as follows respectively:
No. 8 aptamers: 5 '-TCAGTCGCTT CGCCGTCTCC TTCAGAGTCG TGGAGAGGGTGAACGGAGGG GGGAAACAGC ACAAGAGGGA GACCCCAGAG GG-3 '
No. 10 aptamers: 5 '-TCAGTCGCTT CGCCGTCTCC TTCAGGTGGC GAGTTGCGAAGGACTGTGTC GAGTGTTGGC ACAAGAGGGA GACCCCAGAG GG-3 '
No. 37 aptamers: 5 '-TCAGTCGCTT CGCCGTCTCC TTCAGCGGGA TGAGGGAGTAGGAGGGCCAC AGTGGACTGC ACAAGAGGGA GACCCCAGAG GG-3 '
No. 46 aptamers: 5 '-TCAGTCGCTT CGCCGTCTCC TTCCAGTCGC TTCGCCGCCTCCTTCCCTCT GGGGTCTC-3 '.
The applicant discloses 3 aptamer sequences in Chinese patent 201110259244.8, as follows respectively:
Sequence 1:5 '-GAGACCCCAG AGGGAAGGAG GCGGCGAAGC GACTGGAAGGAGACGGCGAA GCGACTGA-3 ';
Sequence 2:5 '-TCAGTCGCTT CGCCGTCTCC TTCCAGTCGC TTCGCCGCCTCCTTCCCTCT GGGGTCTCCC TCTTGTGC-3 ';
Sequence 3:5 '-GCACAAGAGG GAGACCCCAG AGGGAAGGAG GCGGCGAAGCGACTGGAAGG AGACGGCGAA GCGACTGA-3 '.
Summary of the invention
The object of the present invention is to provide 6 oligonucleotide sequences that can be used for deactivation vibrio alginolyticus recognition detection and preparation method thereof.This oligonucleotide sequence not only has and detects quick, simple to operate, stability and be higher than the characteristics such as antibody, and the preparation method easily, preparation cycle is shorter.
Another object of the present invention is to provide the application of 6 oligonucleotide sequences.
Described 6 oligonucleotide sequences, comprise SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6 totally 6 oligonucleotide sequences, and adopt the wherein recognition detection that just can finish the deactivation vibrio alginolyticus;
Described SEQ ID No.1 can be designated as " #7 aptamer ", described SEQ ID No.2 can be designated as " #14 aptamer ", described SEQ ID No.3 can be designated as " #23 aptamer ", described SEQ ID No.4 can be designated as " #4 aptamer ", described SEQ ID No.5 can be designated as " #8 aptamer ", and described SEQ IDNo.6 can be designated as " #9 aptamer ".
Described SEQ ID No.1 is: 5 '-TCA GTC GCT TCG CCG TCT CCT TCGGGGGCGCGGTGAGGGGCTGCACAAGAGGGAG GCA CAA GAG GGA GAC CCC AGAGGG-3 ';
Described SEQ ID No.2 is: 5 '-TCA GTC GCT TCG CCG TCT CCT TCGGACGAGATGGGCGGGAAACGAGGCACAAGAGGGA GCA CAA GAG GGA GAC CCCAGAGGG-3 ';
Described SEQ ID No.3 is: 5 '-TCA GTC GCT TCG CCG TCT CCT TCGTAGGAGGTAGTCGGAGAGGCGAATGAGAGGGGAAGCACAAGAGGGA GCA CAA GAGGGA GAC CCC AGA GGG-3 ';
Described SEQ ID No.4 is: 5 '-TCA GTC GCT TCG CCG TCT CCT TCAGCCGGGGTGGTCAGTAGGAGCA GCA CAA GAG GGA GAC CCC AGA GGG-3 ';
Described SEQ ID No.5 is: 5 '-TCA GTC GCT TCG CCG TCT CCT TCAGCCGGGGTGGTCAGTAGGAGCAGCACAAGAGGGA GCA CAA GAG GGA GAC CCCAGAGGG-3 ';
Described SEQ ID No.6 is: 5 '-TCA GTC GCT TCG CCG TCT CCT TCTGCAGGGCCAGAACAGGGGGAAGGCACAAGAGGGA GCA CAA GAG GGA GAC CCCAGAGGG-3 ';
The preparation method of described 6 oligonucleotide sequences may further comprise the steps:
1) the synthetic ssDNA oligonucleotide library that is used for screening (5 '-TCA GTC GCT TCG CCG TCT CCT TC----N35----GCACAAGAG GGAGAC CCCAGAGGG-3 '), wherein N35 is 35 random oligonucleotides;
2) with oligonucleotide library with carry out the SELEX screening after the deactivation vibrio alginolyticus mixes, until avidity no longer obviously rises;
3) after the SELEX screening is finished the aptamer enriched library is carried out cloning and sequencing, select height wherein to copy the mensuration that ssDNA carries out affine specific checking and affinity costant, obtain corresponding aptamer.
In step 2) in, the concrete steps of described SELEX screening can be:
2.1 the preparation of deactivation vibrio alginolyticus bacterium liquid
The vibrio alginolyticus bacterium colony that to cultivate 24h with physiological saline washs from the inclined-plane, and the centrifugal 5min of 6000rpm abandons supernatant liquor, add again and contain the physiological saline of 6% formaldehyde in 62.5 ℃ of water-bath 1h, centrifugal rear physiological saline washing 3 times uses the bacterium of 2 * binding buffer liquid suspension fire extinguishing to precipitate 4 ℃ of preservations again.
2.2 be combined with vibrios
Getting synthetic concentration is the ssDNA oligonucleotide library 4 μ L of 100 μ M, be diluted to 100 μ L with 2 * binding buffer liquid, 95 ℃ of sex change 5min, join behind the ice bath 10min in the vibrio alginolyticus bacteria suspension of 100 μ L deactivations, 30 shaking tables are in conjunction with 2 hours, the more centrifugal 5min of 6000rpm, abandon supernatant, then use 1 * binding buffer liquid to wash precipitation 1 time, abandon supernatant, then the precipitation part is deactivation vibrio alginolyticus precipitation and ssDNA combined with it;
In step 2.2, described 2 * binding buffer liquid is the solution after 20 * binding buffer liquid dilutes 10 times with distilled water, and described 1 * binding buffer liquid is the solution after 20 * binding buffer liquid dilutes 20 times with distilled water; Described 20 * binding buffer liquid formula is 1M NaCl, 50mM KCl, 500mM Tris-HCl, 10mM MgCl
2, pH 7.4.
2.3 the ssDNA of separation and combination
Add 1 * binding buffer liquid, 100 μ L in the precipitation part of step 2.2 gained, 95 ℃ of heating 5min make the ssDNA sex change of being combined with vibrios, thereby separate with vibrios, then the centrifugal 10min of 15000rpm gets supernatant liquor, then the separable ssDNA of being combined with vibrios of obtaining.
2.4 asymmetric PCR amplification ssDNA
Cumulative volume is that the amplification system of asymmetric PCR of 25 μ L is as shown in table 1.
Table 1
| Composition | Volume (μ L) |
| Primer P1(10uM) | 2 |
| Primer P2(0.4uM) | 2 |
| dNTP(10mM) | 0.4 |
| 10 * PCR damping fluid | 2 |
| Template (ssDNA of screening) | 2 |
| Taq archaeal dna polymerase (5U/ μ L) | 0.2 |
| ddH 2O | 16.4 |
Primer P1 sequence is: 5 '-TCA GTC GCT TCG CCG TCT CCT TC-3 ', primer P2 sequence is: 5 '-CCC TCTGGG GTC TCC CTC TTG TGC-3 '; Reaction conditions is: 94 ℃ of denaturation 4min, then carry out 40 circulations (72 ℃ are extended 20s for 94 ℃ of sex change 30s, 58 ℃ of annealing 30s), and last 72 ℃ are extended 7min.
2.5 the mensuration of avidity
2.5.1 asymmetric PCR amplification: the ssDNA library of using primer P1 and the amplification of primer P2 asymmetric PCR with digoxigenin labeled to screen, amplification condition is identical with asymmetric PCR amplification system and the parameter of step 2.4 with parameter.
2.5.2 mensuration avidity:
The TMB Color Appearance System: take tetramethyl benzidine (TMB) as substrate, the Color Appearance System of horseradish peroxidase-labeled rabbit anti digoxin antibody IgG is measured the aptamer amount that is adsorbed onto the vibrios surface.
In step 2.5.2, the concrete steps of described mensuration avidity can be:
Preserve 2.5.2.1 TMB is made into 4 ℃ of shadings of 1mg/mL with dehydrated alcohol, prepare according to following ratio with front: TMB: substrate buffer solution: 30% hydrogen peroxide=100: 900: 1, namely join namely and use.
2.5.2.2 be combined with bacterium: get the PCR product of step 2.5.1 amplification gained, with ultramicrospectrophotometer mensuration ssDNA concentration wherein.Then get 1 μ L PCR product, be diluted to 100 μ L with 2 * binding buffer liquid, 95 ℃ of sex change 5min behind the ice bath 10min, add inactivated bacterial liquid 100 μ L and fully mix, and 30 ℃, the 100rpm shaking table is in conjunction with 30min, and then the centrifugation bacterial precipitation is abandoned supernatant liquor.Doing simultaneously one does not add ssDNA(and replaces with binding buffer liquid) blank.
2.5.2.3 washing: add 1 * binding buffer liquid, 500 μ L in above-mentioned bacterial precipitation, fully behind the mixing, bacteria suspension is transferred in the new centrifuge tube, the centrifugal 5min of 6000rpm abandons supernatant, gets the bacterium precipitation.
2.5.2.4 be combined with enzyme mark rabbit anti digoxin antibody: in the bacterium precipitation, add the excessive enzyme mark rabbit anti digoxin antibody (IgG-HRP) that 100 μ L 1: 900TBS diluted, after fully mixing, reaction 10min, the ssDNA that makes it the digoxigenin labeled in the bacterium precipitation is combined.
2.5.2.5 washing: the centrifugal 5min of 6000rpm, abandon supernatant, use again 1 * binding buffer liquid, 500 μ L washing 3 times, each washing is all transferred to bacteria suspension in the new centrifuge tube, abandons at last supernatant, gets the bacterium precipitation.
2.5.2.6TMB colour developing: add the resuspended bacterium precipitation of 400 μ L distilled waters, add again 200 μ L TMB nitrite ions, behind the lucifuge colour developing 10min, with 2mol/L H
2SO
4100 μ L termination reactions, the light absorption value OD at mensuration 450nm place
450, the avidity of the ssDNA that the i.e. reflection of this value is combined with bacterium, i.e. OD
In conjunction with, blank is carried out above-mentioned steps 2.5.2.3 equally, 2.5.2.4, and 2.5.2.5 and 2.5.2.6 obtain blank corresponding absorbancy OD
Blank
2.5.2.7 calculate the avidity in corresponding library:
2.6 repeat screening
Take turns the product of asymmetric PCR as the screening library of next round with each, repeat above-mentioned SELEX screening step 2.1～2.5, until avidity no longer obviously rises, final screening obtains the enriched library of aptamer.
In step 3), described the aptamer enriched library is carried out cloning and sequencing, select wherein height copy ssDNA to carry out the mensuration of affine specific checking and affinity costant, obtain corresponding aptamer, its concrete grammar can be:
With step 2) the aptamer enriched library that filters out carries out asymmetric PCR amplification (amplification condition is with step 2.4), amplified production send order-checking company to clone, and picking is cloned check order (also being finished by order-checking company) more than 5 at random, can obtain a series of oligonucleotide sequences or ssDNA.Then a series of ssDNA that obtain are compared analysis, can find that some ssDNA is identical, some ssDNA has the copy more than 2 in sequencing result in other words; If do not find this multiple copied ssDNA, then repeating step 3), continue cloning and sequencing, until obtain the ssDNA of at least one multiple copied.Then select these multiple copieies ssDNA to carry out affine specificity checking, obtain corresponding aptamer, detailed process is as follows:
3.1 the synthetic ssDNA sequence that need to verify (giving birth to worker's biotechnology company limited by Shanghai synthesizes), and in 5 ' end mark digoxin;
3.2 the preparation of deactivation microorganism
Choose the common pathogenic micro-organism of culture environment of aquatic products---Ha Weishi vibrios (Vibrio harveyi), Aeromonas hydrophila (Aeromonas hydrophila), blunt tarda (Edwardsiella tarda) be bacterium in contrast, with vibrio alginolyticus (V.alginolyticus), be inoculated into respectively under aseptic condition in the pancreas peptone soybean broth substratum (TSB), 30 ℃ of lower 100rpm shaking tables are cultivated about 8～10h.Then it is centrifugal to get bacterium liquid, abandons the supernatant nutrient solution, add again contain 6% formaldehyde physiological saline in 62.5 ℃ of water-bath 1h, centrifugal rear physiological saline washing 3 times is used the suspend bacterium precipitation of fire extinguishing of 2 * binding buffer liquid, 4 ℃ of preservations again.
3.3 the mensuration of avidity and the checking of affine specificity
3.3.1 be combined with bacterium: get the ssDNA sequence 10pmol that synthesizes and be diluted to 100 μ l with 2 * binding buffer liquid, 95 ℃ of sex change 5min behind the ice bath 10min, mix with each 100 μ l of the bacterium liquid of above-mentioned 4 kinds of inactivated bacteria respectively that (bacterium quantity is about 3 * 10
8Individual), in conjunction with 40min, the centrifugal 5min of 6000rpm then, separation of bacterial precipitation and supernatant liquor are done simultaneously one and are not added ssDNA(with the replacement of 2 * binding buffer liquid at 28 ℃, 100rpm shaking table) blank;
3.3.2 washing: the bacterium precipitation of above-mentioned inactivated bacteria is washed 1 time with 1 * binding buffer liquid, 500 μ l, and the centrifugal 5min of 6000rpm abandons supernatant, gets the bacterium precipitation;
3.3.3 be combined with horseradish peroxidase-labeled rabbit anti digoxin antibody: in the bacterium precipitation, add the excessive horseradish peroxidase-labeled rabbit anti digoxin antibody of 100 μ l1: 900TBS dilution, after fully mixing, reaction 10min;
3.3.4 washing: the centrifugal 5min of 10000rpm, use again 1 * binding buffer liquid, 500 μ l washing 3 times, abandon supernatant, get the bacterium precipitation;
3.3.5 colour developing: add the resuspended bacterium precipitation of 400 μ l distilled waters, add again 200 μ l TMB nitrite ions, behind the lucifuge colour developing 10min, with 2mol/L H
2SO
4200 μ l termination reactions, the light absorption value OD at mensuration 450nm place
450, this value namely reflects the OD value of the anti-digoxin of enzyme mark of combination, is OD
In conjunction with, blank is carried out above-mentioned steps 5.3.2,5.3.3,5.3.4 and 5.3.5 equally, obtains blank corresponding absorbancy OD
Blank, the avidity=OD of corresponding aptamer
In conjunction with-OD
Blank
3.3.6 Data Management Analysis
Carry out data processing with the statistical function in the EXCEL software, statistical indicator adopts the T check to carry out statistical study, statistical probability p＜0.05 is significant difference, p＜0.01 is extremely significant difference, obtain corresponding sequence after the statistical study to the recognition effect of above-mentioned four kinds of bacterium, thereby determine whether this sequence has affine specificity to the deactivation vibrio alginolyticus, can be used for the recognition detection of deactivation vibrio alginolyticus.
Experimental result:
By SELEX screening and the checking of affine specificity, #4, #7, #8, #9, #14, #23 aptamer all have extremely significant avidity (p＜0.01) to the deactivation vibrio alginolyticus, and these 6 aptamers to the avidity of deactivation vibrio alginolyticus all the utmost point be significantly higher than avidity (p＜0.01) to other 3 strain inactivated bacteria (Vibrio harveyi, Aeromonas hydrophila and slow type tarda), illustrate that these 6 aptamers have significant specific recognition capability to vibrio alginolyticus, can be applicable to the recognition detection of vibrio alginolyticus.
3.4 the mensuration of affinity costant
After the affine specificity checking, select better these 6 aptamers (#4, #7, #8, #9, #14, #23) of affine specificity to carry out the mensuration of affinity costant, concrete grammar can be:
Synthetic these 6 aptamers (giving birth to worker's biotechnology company limited by Shanghai synthesizes), and in 5 ' end mark digoxin; Be diluted to the ssDNA final concentration with 2 * binding buffer liquid and be respectively 10nM, 20nM, 40nM, 60nM, 80nM, 100nM, 120nM, 140nM, after the deactivation vibrio alginolyticus was combined, the method for pressing respectively in 3.3 was measured avidity, does the graph of a relation between avidity and ssDNA concentration again, carry out the affinity costant that the Fitting Calculation can obtain corresponding aptamer with origin 8 softwares, corresponding affinity costant is as shown in table 2.
Table 2
6 oligonucleotide sequences that can be used for deactivation vibrio alginolyticus recognition detection of the present invention have the function of recognition detection deactivation vibrio alginolyticus, and adopt any detection that just can be applied to separately the deactivation vibrio alginolyticus in described 6 oligonucleotide sequences that can be used for deactivation vibrio alginolyticus recognition detection.
Described 6 oligonucleotide sequences that can be used for deactivation vibrio alginolyticus recognition detection can be used for the recognition detection of deactivation vibrio alginolyticus in all kinds of samples, and concrete applying detection method is as follows:
1) preparation of inactivated bacterial liquid to be measured: sample thief, be inoculated into behind the dissolved in distilled water in pancreas peptone soybean broth substratum (TSB) substratum, 30 ℃ of lower 100rpm shaking tables are cultivated about 8～10h.Then it is centrifugal to get bacterium liquid, abandons the supernatant nutrient solution, add again contain 6% formaldehyde physiological saline in 62.5 ℃ of water-bath 1h, centrifugal rear physiological saline washing 3 times is used the suspend bacterium precipitation of fire extinguishing of 2 * binding buffer liquid, 4 ℃ of preservations again.
2) applying detection method 1(digoxin method): get inactivated bacterial liquid to be measured, with 5 ' any avidity measuring method by 3.3 that end is marked with in above-mentioned 6 oligonucleotide sequences of digoxin detects inactivated bacterial liquid to be measured; Replace bacterium liquid to be measured with the deactivation vibrio alginolyticus simultaneously, same avidity measuring method by 3.3 detects, and obtains positive control; Replace inactivated bacterial liquid to be measured with sterile distilled water, same avidity measuring method by 3.3 detects, and obtains negative control.The result shows the positive controls color for yellow, and negative control group does not develop the color.If the testing sample detected result presents yellow, vibrio alginolyticus is arranged in the interpret sample, positive, if the testing sample detected result does not develop the color, then there is not vibrio alginolyticus in the interpret sample.
3) the qualitative detection method of applying detection method 2(PCR-based): idiographic flow is divided into combination, washing, separation, amplification and electrophoresis detection.Specific as follows: get 5 μ L concentration and be any among above-mentioned 6 ssDNA of 10uM, be diluted to 100 μ L with 2 * binding buffer liquid, 95 ℃ of sex change 5min, behind the ice bath 10, (bacteria concentration is 10 to add respectively the bacteria suspension to be measured of deactivation
2Individual/more than the mL) in, rotating speed 100rpm shaking table is in conjunction with 30min; Then the centrifugal 5min of 6000rpm abandons supernatant, and the precipitation part is bacterium precipitation and its ssDNA that combines, with 500 μ L, 1 * binding buffer liquid washing 5 times; Then in precipitation, add 1 * binding buffer liquid 100ul, 95 ℃ of heating 5min, the ssDNA sex change that it is combined with bacterium, thereby separate with vibrios, then the centrifugal 10min of 15000rpm gets supernatant liquor, then separable ssDNA to being combined with bacterium, then the regular-PCR amplification is carried out in sampling, and reaction system is that the regular-PCR parameter of 25 μ L is as shown in table 3.
Table 3
| Composition | Unit (μ L) |
| ddH 2O | 19.4 |
| Primer P1(10uM) | 1 |
| Primer P2(10uM) | 1 |
| dNTP(10mM) | 0.4 |
| 10×PCR?buffer | 2 |
| Template (ssDNA of screening) | 2 |
| Taq enzyme (5U/ μ L) | 0.2 |
Reaction conditions: 94 ℃ of denaturation 4min, then carry out 35 circulations (72 ℃ are extended 20s for 94 ℃ of sex change 30s, 58 ℃ of annealing 30s), last 72 ℃ are extended 7min.Obtain the PCR product of deactivation bacterium to be measured.
(concentration is respectively 10 to use respectively deactivation vibrio alginolyticus bacterium liquid
2, 10
3, 10
4Individual/mL) and sterilized water replace inactivated bacterial liquid to be measured, carry out equally as stated above in conjunction with, washing, separate and amplification, obtain the PCR product of positive control bacterium of 3 gradients and the PCR product of negative control.At last the PCR product of deactivation bacterium to be measured, the PCR product of positive control bacterium and the PCR product of negative control are detected with agarose electrophoresis.The ultraviolet demonstration of taking pictures, negative control does not have bright band, three groups of positive controls that bright band is arranged.If to be measured group has bright band, vibrio alginolyticus is arranged in the interpret sample, positive, if to be measured group does not have bright band, then there is not vibrio alginolyticus in the interpret sample.
The present invention has detection fast, and simple to operate, the stability of aptamer is higher than the characteristics of antibody, and synthetic preparation easily, and preparation cycle is shorter.
Description of drawings
Fig. 1 is that #4 aptamer in the embodiment of the invention 1 or SEQ ID No.4 are to the affine specificity of 4 kinds of inactivated bacteria.
Fig. 2 is that #7 aptamer in the embodiment of the invention 1 or SEQ ID No.1 are to the affine specificity of 4 kinds of inactivated bacteria.
Fig. 3 is that #8 aptamer in the embodiment of the invention 1 or SEQ ID No.5 are to the affine specificity of 4 kinds of inactivated bacteria.
Fig. 4 is that #9 aptamer in the embodiment of the invention 1 or SEQ ID No.6 are to the affine specificity of 4 kinds of inactivated bacteria.
Fig. 5 is that #14 aptamer in the embodiment of the invention 1 or SEQ ID No.2 are to the affine specificity of 4 kinds of inactivated bacteria.
Fig. 6 is that #23 aptamer in the embodiment of the invention 1 or SEQ ID No.3 are to the affine specificity of 4 kinds of inactivated bacteria.
In Fig. 1 ~ 6, X-coordinate is inactivated bacteria, and ordinate zou is avidity.
Embodiment
6 preparation processes that can be used for the oligonucleotide sequence of deactivation vibrio alginolyticus recognition detection of present embodiment mainly comprise:
1, the synthetic ssDNA oligonucleotide library that is used for screening (5 '-TCA GTC GCT TCG CCG TCT CCT TC----N35----GCACAAGAG GGAGAC CCCAGAGGG-3 '): give birth to the chemosynthesis of worker's biotechnology company limited by Shanghai.
2, SELEX screening: concrete steps are as follows:
2.1 deactivation vibrio alginolyticus bacterium solution preparation
The vibrio alginolyticus bacterium colony that to cultivate 24h with physiological saline washs from the inclined-plane, and the centrifugal 5min of 6000rpm abandons supernatant liquor, add again and contain the physiological saline of 6% formaldehyde in 62.5 ℃ of water-bath 1h, centrifugal rear physiological saline washing 3 times uses the bacterium of 2 * binding buffer liquid suspension fire extinguishing to precipitate 4 ℃ of preservations again.
2.2 be combined with vibrios
Getting synthetic concentration is the ssDNA oligonucleotide library 4 μ L of 100 μ M, be diluted to 100 μ L with 2 * binding buffer liquid, 95 ℃ of sex change 5min, join behind the ice bath 10min in the vibrio alginolyticus bacteria suspension of 100 μ L deactivations, 30 shaking tables are in conjunction with 2 hours, the more centrifugal 5min of 6000rpm, abandon supernatant, then use 1 * binding buffer liquid to wash precipitation 1 time, abandon supernatant, then the precipitation part is deactivation vibrio alginolyticus precipitation and ssDNA combined with it;
In step 2.2, described 2 * binding buffer liquid is the solution after 20 * binding buffer liquid dilutes 10 times with distilled water, and described 1 * binding buffer liquid is the solution after 20 * binding buffer liquid dilutes 20 times with distilled water; Described 20 * binding buffer liquid formula is 1M NaCl, 50mM KCl, 500mM Tris-HCl, 10mM MgCl
2, pH 7.4.
2.3 the ssDNA of separation and combination
Add 1 * binding buffer liquid, 100 μ L in the precipitation part of step 2.2 gained, 95 ℃ of heating 5min make the ssDNA sex change of being combined with vibrios, thereby separate with vibrios, then the centrifugal 10min of 15000rpm gets supernatant liquor, then the separable ssDNA of being combined with vibrios of obtaining.
2.4 asymmetric PCR amplification ssDNA
Cumulative volume is that the amplification system of asymmetric PCR of 25 μ L is as shown in table 4.
Table 4
| Composition | Volume (μ L) |
| Primer P1(10uM) | 2 |
| Primer P2(0.4uM) | 2 |
| dNTP(10mM) | 0.4 |
| 10 * PCR damping fluid | 2 |
| Template (ssDNA of screening) | 2 |
| Taq archaeal dna polymerase (5U/ μ L) | 0.2 |
| ddH 2O | 16.4 |
Primer P1 sequence is: 5 '-TCA GTC GCT TCG CCG TCT CCT TC-3 ', primer P2 sequence is: 5 '-CCC TCTGGG GTC TCC CTC TTG TGC-3 '.Reaction conditions is: 94 ℃ of denaturation 4min, then carry out 40 circulations (72 ℃ are extended 20s for 94 ℃ of sex change 30s, 58 ℃ of annealing 30s), and last 72 ℃ are extended 7min.
2.5 the mensuration of avidity
2.5.1 asymmetric PCR amplification: the ssDNA library of using primer P1 and the amplification of primer P2 asymmetric PCR with digoxigenin labeled to screen, amplification condition is identical with asymmetric PCR amplification system and the parameter of step 2.4 with parameter.
2.5.2 mensuration avidity:
The TMB Color Appearance System: take tetramethyl benzidine (TMB) as substrate, the Color Appearance System of horseradish peroxidase-labeled rabbit anti digoxin antibody IgG is measured the aptamer amount that is adsorbed onto the vibrios surface.
The concrete steps of described mensuration avidity are as follows:
Preserve 2.5.2.1 TMB is made into 4 ℃ of shadings of 1mg/mL with dehydrated alcohol, prepare according to following ratio with front: TMB: substrate buffer solution: 30% hydrogen peroxide=100: 900: 1, namely join namely and use.
2.5.2.2 be combined with bacterium: get the PCR product of step 2.5.1 amplification gained, with ultramicrospectrophotometer mensuration ssDNA concentration wherein.Then get 1 μ L PCR product, be diluted to 100 μ L with 2 * binding buffer liquid, 95 ℃ of sex change 5min behind the ice bath 10min, add inactivated bacterial liquid 100 μ L and fully mix, and 30 ℃, the 100rpm shaking table is in conjunction with 30min, and then the centrifugation bacterial precipitation is abandoned supernatant liquor.Doing simultaneously one does not add ssDNA(and replaces with binding buffer liquid) blank.
2.5.2.3 washing: add 1 * binding buffer liquid, 500 μ L in above-mentioned bacterial precipitation, fully behind the mixing, bacteria suspension is transferred in the new centrifuge tube, the centrifugal 5min of 6000rpm abandons supernatant, gets the bacterium precipitation.
2.5.2.4 be combined with enzyme mark rabbit anti digoxin antibody: in the bacterium precipitation, add the excessive enzyme mark rabbit anti digoxin antibody (IgG-HRP) that 100 μ L 1:900TBS diluted, after fully mixing, reaction 10min, the ssDNA that makes it the digoxigenin labeled in the bacterium precipitation is combined.
2.5.2.5 washing: the centrifugal 5min of 6000rpm, abandon supernatant, use again 1 * binding buffer liquid, 500 μ L washing 3 times, each washing is all transferred to bacteria suspension in the new centrifuge tube, abandons at last supernatant, gets the bacterium precipitation.
2.5.2.6TMB colour developing: add the resuspended bacterium precipitation of 400 μ L distilled waters, add again 200 μ L TMB nitrite ions, behind the lucifuge colour developing 10min, with 2mol/L H
2SO
4100 μ L termination reactions, the light absorption value OD at mensuration 450nm place
450, the avidity of the ssDNA that the i.e. reflection of this value is combined with bacterium, i.e. OD
In conjunction with, blank is carried out above-mentioned steps 2.5.2.3 equally, 2.5.2.4, and 2.5.2.5 and 2.5.2.6 obtain blank corresponding absorbancy OD
Blank
2.5.2.7 calculate the avidity in corresponding library:
2.6 repeat screening
Take turns the product of asymmetric PCR as the screening library of next round with each, repeat above-mentioned SELEX screening step 2.1～2.5, until avidity no longer obviously rises, final screening obtains the enriched library of aptamer.
3, cloning and sequencing: the aptamer enriched library that screening is obtained carries out asymmetric PCR amplification (amplification condition is with step 2.4), amplified production send order-checking company to clone, and 100 clones of picking check order (Mei Ji biological medicine Science and Technology Ltd. finishes cloning and sequencing work by Shanghai) at random, obtain 95 effective ssDNA(and be numbered 1-95), wherein have 13 ssDNA to be high copy sequence, numbering is respectively #2, #4, #7, #8, #9, #14, #16, #23, #31, #53, #66, #82, #91.
4,13 high copy ssDNA that step 3 obtained carry out the mensuration of affine specific checking and affinity costant, final certification #4, #7, #8, #9, these six ssDNA of #14, #23 have preferably affine specificity, and obtain the affinity costant of these six aptamers.Concrete grammar is as follows:
4.1 13 high copy ssDNA sequences that synthetic above-mentioned needs are verified (giving birth to worker's biotechnology company limited by Shanghai synthesizes), and in 5 ' end mark digoxin;
4.2 the preparation of deactivation microorganism
Choose the common pathogenic micro-organism of culture environment of aquatic products---Ha Weishi vibrios (Vibrio harveyi), Aeromonas hydrophila (Aeromonas hydrophila), blunt tarda (Edwardsiella tarda) be bacterium in contrast, with vibrio alginolyticus (V.alginolyticus), be inoculated into respectively under aseptic condition in the pancreas peptone soybean broth substratum (TSB), 30 ℃ of lower 100rpm shaking tables are cultivated about 8～10h.Then it is centrifugal to get bacterium liquid, abandons the supernatant nutrient solution, add again contain 6% formaldehyde physiological saline in 62.5 ℃ of water-bath 1h, centrifugal rear physiological saline washing 3 times is used the suspend bacterium precipitation of fire extinguishing of 2 * binding buffer liquid, 4 ℃ of preservations again.
4.3 the mensuration of avidity and the checking of affine specificity
4.3.1 be combined with bacterium: get the ssDNA sequence 10pmol that synthesizes and be diluted to 100 μ l with 2 * binding buffer liquid, 95 ℃ of sex change 5min behind the ice bath 10min, mix with each 100 μ l of the bacterium liquid of above-mentioned 4 kinds of inactivated bacteria respectively that (bacterium quantity is about 3 * 10
8Individual), in conjunction with 40min, the centrifugal 5min of 6000rpm then, separation of bacterial precipitation and supernatant liquor are done simultaneously one and are not added ssDNA(with the replacement of 2 * binding buffer liquid at 28 ℃, 100rpm shaking table) blank;
4.3.2 washing: the bacterium precipitation of above-mentioned inactivated bacteria is washed 1 time with 1 * binding buffer liquid, 500 μ l, and the centrifugal 5min of 6000rpm abandons supernatant, gets the bacterium precipitation;
4.3.3 be combined with horseradish peroxidase-labeled rabbit anti digoxin antibody: in the bacterium precipitation, add the excessive horseradish peroxidase-labeled rabbit anti digoxin antibody of 100 μ l1: 900TBS dilution, after fully mixing, reaction 10min;
4.3.4 washing: the centrifugal 5min of 10000rpm, use again 1 * binding buffer liquid, 500 μ l washing 3 times, abandon supernatant, get the bacterium precipitation;
4.3.5 colour developing: add the resuspended bacterium precipitation of 400 μ l distilled waters, add again 200 μ l TMB nitrite ions, behind the lucifuge colour developing 10min, with 2mol/L H
2SO
4200 μ l termination reactions, the light absorption value OD at mensuration 450nm place
450, this value namely reflects the OD value of the anti-digoxin of enzyme mark of combination, is OD
In conjunction with, blank is carried out above-mentioned steps 5.3.2,5.3.3,5.3.4 and 5.3.5 equally, obtains blank corresponding absorbancy OD
Blank, the avidity=OD of corresponding aptamer
In conjunction with-OD
Blank
4.3.6 Data Management Analysis
Carry out data processing with the statistical function in the EXCEL software, statistical indicator adopts the T check to carry out statistical study, statistical probability p＜0.05 is significant difference, p＜0.01 is extremely significant difference, obtain corresponding sequence after the statistical study to the recognition effect of above-mentioned four kinds of bacterium, thereby determine whether this sequence has affine specificity to the deactivation vibrio alginolyticus, can be used for the recognition detection of deactivation vibrio alginolyticus.
Experimental result:
By SELEX screening and the checking of affine specificity, #4, #7, #8, #9, #14, #23 aptamer all have significant avidity (p＜0.05) to the deactivation vibrio alginolyticus, and these 6 aptamers all are significantly higher than avidity (p＜0.05) to other 3 strain inactivated bacteria (Vibrio harveyi, Aeromonas hydrophila and slow type tarda) to the avidity of deactivation vibrio alginolyticus, illustrate that these 6 aptamers have significant specific recognition capability (such as Fig. 1～Fig. 6), can be applicable to the recognition detection of vibrio alginolyticus to the deactivation vibrio alginolyticus.
4.4 the mensuration of affinity costant
After the affine specificity checking, select better these 6 aptamers (#4, #7, #8, #9, #14, #23) of affine specificity to carry out the mensuration of affinity costant, the concrete grammar that affinity costant is measured is as follows:
Synthetic these 6 aptamers (giving birth to worker's biotechnology company limited by Shanghai synthesizes), and in 5 ' end mark digoxin; Be diluted to the ssDNA final concentration with 2 * binding buffer liquid and be respectively 10nM, 20nM, 40nM, 60nM, 80nM, 100nM, 120nM, 140nM, after the deactivation vibrio alginolyticus was combined, the method for pressing respectively in 3.3 was measured avidity, does the graph of a relation between avidity and ssDNA concentration again, carry out the affinity costant that the Fitting Calculation can obtain corresponding aptamer with origin 8 softwares, specifically as shown in table 5.
Table 5
Embodiment 2
Any one all has the purposes of recognition detection deactivation vibrio alginolyticus six oligonucleotide sequences: specifically use step as follows:
1) get the aquaculture water that has infected vibriosis, be inoculated into behind the dissolved in distilled water in pancreas peptone soybean broth substratum (TSB) substratum, 30 ℃ of lower 100rpm shaking tables are cultivated about 8～10h.Then it is centrifugal to get bacterium liquid, abandons the supernatant nutrient solution, add again contain 6% formaldehyde physiological saline in 62.5 ℃ of water-bath 1h, the bacterium precipitation of 2 * binding buffer liquid suspension deactivation is used in centrifugal rear physiological saline washing 3 times again, obtains inactivated bacterial liquid to be measured, 4 ℃ of preservations.Get inactivated bacterial liquid to be measured, with 5 ' end is marked with the aptamer #7(SEQ ID No.1 of digoxin) avidity measuring method by 3.3 detects inactivated bacterial liquid to be measured; Replace bacterium liquid to be measured with the deactivation vibrio alginolyticus simultaneously, same avidity measuring method by 3.3 detects, and obtains positive control; Replace inactivated bacterial liquid to be measured with sterile distilled water, same avidity measuring method by 3.3 detects, and obtains negative control.The result shows positive controls and experimental group its colour changed into yellow, and the negative control group color is constant, and vibrio alginolyticus is arranged in the interpret sample, illustrates that this aquaculture water has infected vibrio alginolyticus.
2) get the water sample of normal aquaculture water, be inoculated into behind the dissolved in distilled water in pancreas peptone soybean broth substratum (TSB) substratum, 30 ℃ of lower 100rpm shaking tables are cultivated about 8～10h.Then it is centrifugal to get bacterium liquid, abandons the supernatant nutrient solution, add again contain 6% formaldehyde physiological saline in 62.5 ℃ of water-bath 1h, the suspend bacterium precipitation of fire extinguishing of 2 * binding buffer liquid is used in centrifugal rear physiological saline washing 3 times again, obtains inactivated bacterial liquid to be measured, 4 ℃ of preservations.Get inactivated bacterial liquid to be measured, with 5 ' end is marked with the aptamer #14(SEQ ID No.2 of digoxin) avidity measuring method by 3.3 detects inactivated bacterial liquid to be measured; Replace bacterium liquid to be measured with the deactivation vibrio alginolyticus simultaneously, same avidity measuring method by 3.3 detects, and obtains positive control; Replace inactivated bacterial liquid to be measured with sterile distilled water, same avidity measuring method by 3.3 detects, and obtains negative control.The result shows the positive controls its colour changed into yellow, and negative control group and experimental group color are constant, do not have vibrio alginolyticus in the interpret sample, illustrates that this aquaculture water does not infect vibrio alginolyticus.
3) get the popular sea area water sample of vibriosis, be inoculated into behind the dissolved in distilled water in pancreas peptone soybean broth substratum (TSB) substratum, 30 ℃ of lower 100rpm shaking tables are cultivated about 8～10h.Then it is centrifugal to get bacterium liquid, abandons the supernatant nutrient solution, add again contain 6% formaldehyde physiological saline in 62.5 ℃ of water-bath 1h, the bacterium precipitation of 2 * binding buffer liquid suspension deactivation is used in centrifugal rear physiological saline washing 3 times again, obtains inactivated bacterial liquid to be measured, 4 ℃ of preservations.Then get the #4(SEQ ID No.4 that 5 μ L concentration are 10uM) aptamer, be diluted to 100ul with 2 * binding buffer liquid, 95 ℃ of sex change 5min, behind the ice bath 10, (bacteria concentration is 10 to add respectively the bacteria suspension to be measured of deactivation
2Individual/more than the mL) in, rotating speed 100rpm shaking table is in conjunction with 30min; Then the centrifugal 5min of 6000rpm abandons supernatant, and the precipitation part is washed 5 times with 500 μ L, 1 * binding buffer liquid; Then in precipitation, add 1 * binding buffer liquid, 100 μ L, 95 ℃ of heating 5min, the ssDNA sex change that it is combined with bacterium, thereby separate with bacterium, then the centrifugal 10min of 15000rpm gets supernatant liquor, carry out regular-PCR amplification, reaction system is that the regular-PCR of 25 μ L is referring to table 6.
Table 6
| Composition | Unit (μ L) |
| ddH 2O | 19.4 |
| Primer P1(10uM) | 1 |
| Primer P2(10uM) | 1 |
| dNTP(10mM) | 0.4 |
| 10×PCR?buffer | 2 |
| Template (ssDNA of screening) | 2 |
| Taq enzyme (5U/ μ L) | 0.2 |
Reaction conditions: 94 ℃ of denaturation 4min, then carry out 35 circulations (72 ℃ are extended 20s for 94 ℃ of sex change 30s, 58 ℃ of annealing 30s), last 72 ℃ are extended 7min.Obtain the PCR product of deactivation bacterium to be measured.
(concentration is respectively 10 to use respectively deactivation vibrio alginolyticus bacterium liquid
2, 10
3, 10
4Individual/mL) and sterilized water replace inactivated bacterial liquid to be measured, carry out equally as stated above in conjunction with, washing, separate and amplification, obtain the PCR product of positive control bacterium of 3 gradients and the PCR product of negative control.At last the PCR product of deactivation bacterium to be measured, the PCR product of positive control bacterium and the PCR product of negative control are detected with agarose electrophoresis.The ultraviolet demonstration of taking pictures, negative control does not have bright band, three groups of positive controls and bacterium to be measured that bright band is arranged, and vibrio alginolyticus is arranged in the interpret sample, and vibrio alginolyticus has been infected in this sea area.
4) get the water sample of normal aquaculture water, be inoculated into behind the dissolved in distilled water in pancreas peptone soybean broth substratum (TSB) substratum, 30 ℃ of lower 100rpm shaking tables are cultivated about 8～10h.Then it is centrifugal to get bacterium liquid, abandons the supernatant nutrient solution, add again contain 6% formaldehyde physiological saline in 62.5 ℃ of water-bath 1h, the bacterium precipitation of 2 * binding buffer liquid suspension deactivation is used in centrifugal rear physiological saline washing 3 times again, obtains inactivated bacterial liquid to be measured, 4 ℃ of preservations.Then get the #8(SEQ ID No.5 that 5 μ L concentration are 10uM) aptamer, be diluted to 100ul with 2 * binding buffer liquid, 95 ℃ of sex change 5min, behind the ice bath 10, (bacteria concentration is 10 to add respectively the bacteria suspension to be measured of deactivation
2Individual/more than the mL) in, rotating speed 100rpm shaking table is in conjunction with 30min; Then the centrifugal 5min of 6000rpm abandons supernatant, and the precipitation part is washed 5 times with 500 μ L, 1 * binding buffer liquid; Then in precipitation, add 1 * binding buffer liquid, 100 μ L, 95 ℃ of heating 5min, the ssDNA sex change that it is combined with bacterium, thereby separate with bacterium, then the centrifugal 10min of 15000rpm gets supernatant liquor, carry out the regular-PCR amplification, reaction system is that the regular-PCR parameter of 25 μ L is as shown in table 7.
Table 7
| Composition | Unit (μ L) |
| ddH 2O | 19.4 |
| Primer P1(10uM) | 1 |
| Primer P2(10uM) | 1 |
| dNTP(10mM) | 0.4 |
| 10×PCR?buffer | 2 |
| Template (ssDNA of screening) | 2 |
| Taq enzyme (5U/ μ L) | 0.2 |
Reaction conditions: 94 ℃ of denaturation 4min, then carry out 35 circulations (72 ℃ are extended 20s for 94 ℃ of sex change 30s, 58 ℃ of annealing 30s), last 72 ℃ are extended 7min.Obtain the PCR product of deactivation bacterium to be measured.
(concentration is respectively 10 to use respectively deactivation vibrio alginolyticus bacterium liquid
2, 10
3, 10
4Individual/mL) and sterilized water replace inactivated bacterial liquid to be measured, carry out equally as stated above in conjunction with, washing, separate and amplification, obtain the PCR product of positive control bacterium of 3 gradients and the PCR product of negative control.At last the PCR product of deactivation bacterium to be measured, the PCR product of positive control bacterium and the PCR product of negative control are detected with agarose electrophoresis.The ultraviolet demonstration of taking pictures, negative control and bacterium to be measured do not have bright band, three groups of positive controls that bright band is arranged, and do not have vibrio alginolyticus in the interpret sample, and this aquaculture water does not infect vibrio alginolyticus.
Claims (8)
1.6 bar oligonucleotide sequence, it is characterized in that comprising SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQID No.4, SEQ ID No.5 and SEQ ID No.6 totally 6 oligonucleotide sequences, and adopt the wherein recognition detection that just can finish the deactivation vibrio alginolyticus;
Described SEQ ID No.1 can be designated as " #7 aptamer ", described SEQ ID No.2 can be designated as " #14 aptamer ", described SEQ ID No.3 can be designated as " #23 aptamer ", described SEQ ID No.4 can be designated as " #4 aptamer ", described SEQ ID No.5 can be designated as " #8 aptamer ", and described SEQ ID No.6 can be designated as " #9 aptamer ";
Described SEQ ID No.1 is: 5 '-TCA GTC GCT TCG CCG TCT CCT TC
GGGGGCGCGGTGAGGGGCTGCACAAGAGGGAG?GCA?CAA?GAG?GGA?GAC?CCC?AGAGGG-3′；
Described SEQ ID No.2 is: 5 '-TCA GTC GCT TCG CCG TCT CCT TCGGACGAGATGGGCGGGAAACGAGGCACAAGAGGGA GCA CAA GAG GGA GAC CCCAGAGGG-3 ';
Described SEQ ID No.3 is: 5 '-TCA GTC GCT TCG CCG TCT CCT TCGTAGGAGGTAGTCGGAGAGGCGAATGAGAGGGGAAGCACAAGAGGGA GCA CAA GAGGGA GAC CCC AGA GGG-3 ';
Described SEQ ID No.4 is: 5 '-TCA GTC GCT TCG CCG TCT CCT TCAGCCGGGGTGGTCAGTAGGAGCA GCA CAA GAG GGA GAC CCC AGA GGG-3 ';
Described SEQ ID No.5 is: 5 '-TCA GTC GCT TCG CCG TCT CCT TCAGCCGGGGTGGTCAGTAGGAGCAGCACAAGAGGGA GCA CAA GAG GGA GAC CCCAGAGGG-3 ';
Described SEQ ID No.6 is: 5 '-TCA GTC GCT TCG CCG TCT CCT TCTGCAGGGCCAGAACAGGGGGAAGGCACAAGAGGGA GCA CAA GAG GGA GAC CCCAGAGGG-3 '.
2. the preparation method of 6 oligonucleotide sequences as claimed in claim 1 is characterized in that may further comprise the steps:
1) the synthetic ssDNA oligonucleotide library that is used for screening (5 '-TCA GTC GCT TCG CCG TCT CCT TC----N35----GCACAAGAG GGAGAC CCCAGAGGG-3 '), wherein N35 is 35 random oligonucleotides;
2) with oligonucleotide library with carry out the SELEX screening after the deactivation vibrio alginolyticus mixes, until avidity no longer obviously rises;
3) after the SELEX screening is finished the aptamer enriched library is carried out cloning and sequencing, select height wherein to copy the mensuration that ssDNA carries out affine specific checking and affinity costant, obtain corresponding aptamer.
3. the preparation method of 6 oligonucleotide sequences as claimed in claim 2 is characterized in that in step 2) in, the concrete steps of described SELEX screening are:
2.1 the preparation of deactivation vibrio alginolyticus bacterium liquid
The vibrio alginolyticus bacterium colony that to cultivate 24h with physiological saline washs from the inclined-plane, and the centrifugal 5min of 6000rpm abandons supernatant liquor, add again and contain the physiological saline of 6% formaldehyde in 62.5 ℃ of water-bath 1h, centrifugal rear physiological saline washing 3 times uses the bacterium of 2 * binding buffer liquid suspension fire extinguishing to precipitate 4 ℃ of preservations again;
2.2 be combined with vibrios
Getting synthetic concentration is the ssDNA oligonucleotide library 4 μ L of 100 μ M, be diluted to 100 μ L with 2 * binding buffer liquid, 95 ℃ of sex change 5min, join behind the ice bath 10min in the vibrio alginolyticus bacteria suspension of 100 μ L deactivations, 30 shaking tables are in conjunction with 2 hours, the more centrifugal 5min of 6000rpm, abandon supernatant, then use 1 * binding buffer liquid to wash precipitation 1 time, abandon supernatant, then the precipitation part is deactivation vibrio alginolyticus precipitation and ssDNA combined with it;
2.3 the ssDNA of separation and combination
Add 1 * binding buffer liquid, 100 μ L in the precipitation part of step 2.2 gained, 95 ℃ of heating 5min make the ssDNA sex change of being combined with vibrios, thereby separate with vibrios, then the centrifugal 10min of 15000rpm gets supernatant liquor, then the separable ssDNA of being combined with vibrios of obtaining;
2.4 asymmetric PCR amplification ssDNA
Cumulative volume is that the amplification system of asymmetric PCR of 25 μ L is as shown in table 1;
Table 1
Primer P1 sequence is: 5 '-TCA GTC GCT TCG CCG TCT CCT TC-3 ', primer P2 sequence is: 5 '-CCC TCTGGG GTC TCC CTC TTG TGC-3 '; Reaction conditions is: 94 ℃ of denaturation 4min, then carry out 40 circulations (72 ℃ are extended 20s for 94 ℃ of sex change 30s, 58 ℃ of annealing 30s), and last 72 ℃ are extended 7min;
2.5 the mensuration of avidity
2.5.1 asymmetric PCR amplification: the ssDNA library of using primer P1 and the amplification of primer P2 asymmetric PCR with digoxigenin labeled to screen, amplification condition is identical with asymmetric PCR amplification system and the parameter of step 2.4 with parameter;
2.5.2 mensuration avidity:
The TMB Color Appearance System: take tetramethyl benzidine as substrate, the Color Appearance System of horseradish peroxidase-labeled rabbit anti digoxin antibody IgG is measured the aptamer amount that is adsorbed onto the vibrios surface;
2.6 repeat screening
Take turns the product of asymmetric PCR as the screening library of next round with each, repeat above-mentioned SELEX screening step 2.1～2.5, until avidity no longer obviously rises, final screening obtains the enriched library of aptamer.
4. the preparation method of 6 oligonucleotide sequences as claimed in claim 3, it is characterized in that in step 2.2, described 2 * binding buffer liquid is the solution after 20 * binding buffer liquid dilutes 10 times with distilled water, and described 1 * binding buffer liquid is the solution after 20 * binding buffer liquid dilutes 20 times with distilled water; Described 20 * binding buffer liquid formula is 1M NaCl, 50mM KCl, 500mM Tris-HCl, 10mM MgCl
2, pH 7.4.
5. the preparation method of 6 oligonucleotide sequences as claimed in claim 3 is characterized in that in step 2.5.2, the concrete steps of described mensuration avidity are:
Preserve 2.5.2.1 TMB is made into 4 ℃ of shadings of 1mg/mL with dehydrated alcohol, prepare according to following ratio with front: TMB: substrate buffer solution: 30% hydrogen peroxide=100: 900: 1, namely join namely and use;
2.5.2.2 be combined with bacterium: get the PCR product of step 2.5.1 amplification gained, with ultramicrospectrophotometer mensuration ssDNA concentration wherein; Then get 1 μ L PCR product, be diluted to 100 μ L with 2 * binding buffer liquid, 95 ℃ of sex change 5min behind the ice bath 10min, add inactivated bacterial liquid 100 μ L and fully mix, and 30 ℃, the 100rpm shaking table is in conjunction with 30min, and then the centrifugation bacterial precipitation is abandoned supernatant liquor; Do simultaneously a blank that adds binding buffer liquid;
2.5.2.3 washing: add 1 * binding buffer liquid, 500 μ L in above-mentioned bacterial precipitation, fully behind the mixing, bacteria suspension is transferred in the new centrifuge tube, the centrifugal 5min of 6000rpm abandons supernatant, gets the bacterium precipitation;
2.5.2.4 be combined with enzyme mark rabbit anti digoxin antibody: in the bacterium precipitation, add the excessive enzyme mark rabbit anti digoxin antibody that 100 μ L 1: 900TBS diluted, after fully mixing, reaction 10min, the ssDNA that makes it the digoxigenin labeled in the bacterium precipitation is combined;
2.5.2.5 washing: the centrifugal 5min of 6000rpm, abandon supernatant, use again 1 * binding buffer liquid, 500 μ L washing 3 times, each washing is all transferred to bacteria suspension in the new centrifuge tube, abandons at last supernatant, gets the bacterium precipitation;
2.5.2.6TMB colour developing: add the resuspended bacterium precipitation of 400 μ L distilled waters, add again 200 μ L TMB nitrite ions, behind the lucifuge colour developing 10min, with 2mol/L H
2SO
4100 μ L termination reactions, the light absorption value OD at mensuration 450nm place
450, the avidity of the ssDNA that the i.e. reflection of this value is combined with bacterium, i.e. OD
In conjunction with, blank is carried out above-mentioned steps 2.5.2.3 equally, 2.5.2.4, and 2.5.2.5 and 2.5.2.6 obtain blank corresponding absorbancy OD
Blank
2.5.2.7 calculate the avidity in corresponding library:
6. the preparation method of 6 oligonucleotide sequences as claimed in claim 2, it is characterized in that in step 3), described the aptamer enriched library is carried out cloning and sequencing, select height wherein to copy the mensuration that ssDNA carries out affine specific checking and affinity costant, obtain corresponding aptamer, its concrete grammar is:
With step 2) the aptamer enriched library that filters out carries out the asymmetric PCR amplification, and amplification condition is with step 2.4, and amplified production send order-checking company to clone, and picking is cloned more than 5 and checked order at random, obtains a series of oligonucleotide sequences or ssDNA; Then a series of ssDNA that obtain are compared analysis, find that some ssDNA is identical, some ssDNA has the copy more than 2 in sequencing result in other words; If do not find this multiple copied ssDNA, then repeating step 3), continue cloning and sequencing, until obtain the ssDNA of at least one multiple copied; Then select these multiple copieies ssDNA to carry out affine specificity checking, obtain corresponding aptamer, detailed process is as follows:
3.1 the synthetic ssDNA sequence that need to verify, and in 5 ' end mark digoxin;
3.2 the preparation of deactivation microorganism
Choose the common pathogenic micro-organism of culture environment of aquatic products---Ha Weishi vibrios (Vibrio harveyi), Aeromonas hydrophila (Aeromonas hydrophila), blunt tarda (Edwardsiella tarda) be bacterium in contrast, with vibrio alginolyticus (V.alginolyticus), be inoculated into respectively under aseptic condition in the pancreas peptone soybean broth substratum, 30 ℃ of lower 100rpm shaking tables are cultivated about 8～10h; Then it is centrifugal to get bacterium liquid, abandons the supernatant nutrient solution, add again contain 6% formaldehyde physiological saline in 62.5 ℃ of water-bath 1h, centrifugal rear physiological saline washing 3 times is used the suspend bacterium precipitation of fire extinguishing of 2 * binding buffer liquid, 4 ℃ of preservations again;
3.3 the mensuration of avidity and the checking of affine specificity
3.3.1 be combined with bacterium: get the ssDNA sequence 10pmol that synthesizes and be diluted to 100 μ l with 2 * binding buffer liquid, 95 ℃ of sex change 5min behind the ice bath 10min, mix with each 100 μ l of the bacterium liquid of above-mentioned 4 kinds of inactivated bacteria respectively that (bacterium quantity is about 3 * 10
8Individual), at 28 ℃, 100rpm shaking table in conjunction with 40min, the centrifugal 5min of 6000rpm then, separation of bacterial precipitation and supernatant liquor are done a blank that adds 2 * binding buffer liquid simultaneously;
3.3.2 washing: the bacterium precipitation of above-mentioned inactivated bacteria is washed 1 time with 1 * binding buffer liquid, 500 μ l, and the centrifugal 5min of 6000rpm abandons supernatant, gets the bacterium precipitation;
3.3.3 be combined with horseradish peroxidase-labeled rabbit anti digoxin antibody: in the bacterium precipitation, add the excessive horseradish peroxidase-labeled rabbit anti digoxin antibody of 100 μ l1: 900TBS dilution, after fully mixing, reaction 10min;
3.3.4 washing: the centrifugal 5min of 10000rpm, use again 1 * binding buffer liquid, 500 μ l washing 3 times, abandon supernatant, get the bacterium precipitation;
3.3.5 colour developing: add the resuspended bacterium precipitation of 400 μ l distilled waters, add again 200 μ l TMB nitrite ions, behind the lucifuge colour developing 10min, with 2mol/L H
2SO
4200 μ l termination reactions, the light absorption value OD at mensuration 450nm place
450, this value namely reflects the OD value of the anti-digoxin of enzyme mark of combination, is OD
In conjunction with, blank is carried out above-mentioned steps 5.3.2,5.3.3,5.3.4 and 5.3.5 equally, obtains blank corresponding absorbancy OD
Blank, the avidity=OD of corresponding aptamer
In conjunction with-OD
Blank
3.3.6 Data Management Analysis
Carry out data processing with the statistical function in the EXCEL software, statistical indicator adopts the T check to carry out statistical study, statistical probability p＜0.05 is significant difference, p＜0.01 is extremely significant difference, obtain corresponding sequence after the statistical study to the recognition effect of above-mentioned four kinds of bacterium, thereby determine whether this sequence has affine specificity to the deactivation vibrio alginolyticus, can be used for the recognition detection of deactivation vibrio alginolyticus.
7. as claimed in claim 16 application of oligonucleotide sequence in the deactivation vibrio alginolyticus detects.
8. use as claimed in claim 7, it is characterized in that its detection method is as follows:
1) preparation of inactivated bacterial liquid to be measured: sample thief, be inoculated into behind the dissolved in distilled water in pancreas peptone soybean broth substratum (TSB) substratum, 30 ℃ of lower 100rpm shaking tables are cultivated about 8～10h; Then it is centrifugal to get bacterium liquid, abandons the supernatant nutrient solution, add again contain 6% formaldehyde physiological saline in 62.5 ℃ of water-bath 1h, centrifugal rear physiological saline washing 3 times is used the suspend bacterium precipitation of fire extinguishing of 2 * binding buffer liquid, 4 ℃ of preservations again;
2) get inactivated bacterial liquid to be measured, with 5 ' any avidity measuring method by step 3.3 that end is marked with in above-mentioned 6 oligonucleotide sequences of digoxin detects inactivated bacterial liquid to be measured; Replace bacterium liquid to be measured with the deactivation vibrio alginolyticus simultaneously, the avidity measuring method by step 3.3 detects equally, obtains positive control; Replace inactivated bacterial liquid to be measured with sterile distilled water, the avidity measuring method by step 3.3 detects equally, obtains negative control; The result shows the positive controls color for yellow, and negative control group does not develop the color; If the testing sample detected result presents yellow, vibrio alginolyticus is arranged in the interpret sample, positive, if the testing sample detected result does not develop the color, then there is not vibrio alginolyticus in the interpret sample; Or
Get 5 μ L concentration and be any among above-mentioned 6 ssDNA of 10uM, be diluted to 100 μ L with 2 * binding buffer liquid, 95 ℃ of sex change 5min behind the ice bath 10, add respectively in the bacteria suspension to be measured of deactivation, and bacteria concentration is 10
2Individual/more than the mL, rotating speed 100rpm shaking table is in conjunction with 30min; Then the centrifugal 5min of 6000rpm abandons supernatant, and the precipitation part is bacterium precipitation and its ssDNA that combines, with 500 μ L, 1 * binding buffer liquid washing 5 times; Then in precipitation, add 1 * binding buffer liquid 100ul, 95 ℃ of heating 5min, the ssDNA sex change that it is combined with bacterium, thereby separate with vibrios, then the centrifugal 10min of 15000rpm gets supernatant liquor, then separable ssDNA to being combined with bacterium, then the regular-PCR amplification is carried out in sampling, and reaction system is that the regular-PCR parameter of 25 μ L is as shown in table 3:
Table 3
Reaction conditions: 94 ℃ of denaturation 4min, then carry out 35 circulations, 94 ℃ of sex change 30s, 58 ℃ of annealing 30s, 72 ℃ are extended 20s, and last 72 ℃ are extended 7min, obtain the PCR product of deactivation bacterium to be measured;
Be respectively 10 with concentration respectively
2, 10
3, 10
4Deactivation vibrio alginolyticus bacterium liquid and the sterilized water of individual/mL replace inactivated bacterial liquid to be measured, carry out combination, washing, separate and amplification, obtain the PCR product of positive control bacterium of 3 gradients and the PCR product of negative control, at last the PCR product of deactivation bacterium to be measured, the PCR product of positive control bacterium and the PCR product of negative control are detected with agarose electrophoresis, the ultraviolet demonstration of taking pictures, negative control does not have bright band, three groups of positive controls that bright band is arranged; If to be measured group has bright band, then in the interpret sample vibrio alginolyticus is arranged, positive; If to be measured group does not have bright band, then there is not vibrio alginolyticus in the interpret sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210552569XA CN103060326A (en) | 2012-12-17 | 2012-12-17 | Six oligonucleotide sequences and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210552569XA CN103060326A (en) | 2012-12-17 | 2012-12-17 | Six oligonucleotide sequences and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103060326A true CN103060326A (en) | 2013-04-24 |
Family
ID=48103222
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210552569XA Pending CN103060326A (en) | 2012-12-17 | 2012-12-17 | Six oligonucleotide sequences and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103060326A (en) |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104031137A (en) * | 2014-06-06 | 2014-09-10 | 杭州普英生物科技有限公司 | Aptamers of sea purse angiogenesis inhibiting factor 1 as well as screening method and application of aptamers |
| CN104388422A (en) * | 2014-10-24 | 2015-03-04 | 集美大学 | Oligonucleotide sequence as well as preparation method and application thereof |
| CN105646695A (en) * | 2014-06-06 | 2016-06-08 | 张勇 | Aptamer K16 of angiogenesis inhibiting factor 1 of skates as well as screening method and application of aptamer K16 |
| CN105669852A (en) * | 2014-06-06 | 2016-06-15 | 张勇 | Aptamer K10 of sea purse angiogenesis inhibitor 1 and screening method and application of aptamer K10 |
| CN105669851A (en) * | 2014-06-06 | 2016-06-15 | 张勇 | Aptamers K6 of ray angiogenesis inhibitor 1 and screening method and application of aptamers |
| CN105713081A (en) * | 2014-06-06 | 2016-06-29 | 张勇 | Aptamers K17 of ray angiogenesis inhibiting factor 1 and screening method and application thereof |
| CN107619850A (en) * | 2017-09-08 | 2018-01-23 | 集美大学 | A kind of method of the quantitative detection vibrio alginolyticus based on aptamer |
| CN107858358A (en) * | 2017-12-01 | 2018-03-30 | 广西科学院 | A kind of ssDNA aptamers that can be identified and combine vibrio alginolyticus and its application |
| CN107858359A (en) * | 2017-12-01 | 2018-03-30 | 广西科学院 | It is a kind of can specific recognition vibrio alginolyticus aptamer and its application |
| CN108004240A (en) * | 2017-12-01 | 2018-05-08 | 广西科学院 | SsDNA aptamer and its application of one species specificity for vibrio alginolyticus |
| CN108034659A (en) * | 2017-12-01 | 2018-05-15 | 广西科学院 | A kind of ssDNA aptamers and its vibrio alginolyticus quickly detection in application |
| CN110564815A (en) * | 2019-09-03 | 2019-12-13 | 集美大学 | method for obtaining ultra-short sequence aptamer through screening |
| CN110578010A (en) * | 2019-09-03 | 2019-12-17 | 集美大学 | Four groups of oligonucleotide sequences for identifying and identifying vibrio anguillarum and screening method thereof |
| CN113234727A (en) * | 2021-06-09 | 2021-08-10 | 集美大学 | Pseudomonas proteorns antibacterial aptamer and screening method thereof |
| CN113278622A (en) * | 2021-06-09 | 2021-08-20 | 集美大学 | Pseudomonas proteorum aptamer and screening method thereof |
| WO2023096575A3 (en) * | 2021-11-25 | 2023-08-10 | Agency For Science, Technology And Research | Method and sensor for detecting vibrio bacteria |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102605075A (en) * | 2012-03-22 | 2012-07-25 | 集美大学 | A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences |
-
2012
- 2012-12-17 CN CN201210552569XA patent/CN103060326A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102605075A (en) * | 2012-03-22 | 2012-07-25 | 集美大学 | A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences |
Cited By (33)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105713081A (en) * | 2014-06-06 | 2016-06-29 | 张勇 | Aptamers K17 of ray angiogenesis inhibiting factor 1 and screening method and application thereof |
| CN105541989A (en) * | 2014-06-06 | 2016-05-04 | 张勇 | Aptamers K20 of skate angiogenesis inhibitor 1 and screening method and application of aptamers K20 |
| CN104031137B (en) * | 2014-06-06 | 2016-08-24 | 艾堪生物科技（天津）有限公司 | The aptamer of ray Angiostatin 1 and screening technique thereof and application |
| CN105541986A (en) * | 2014-06-06 | 2016-05-04 | 张勇 | Aptamers K9 of skate angiogenesis inhibitor 1 and screening method and application of aptamers K9 |
| CN105541988A (en) * | 2014-06-06 | 2016-05-04 | 张勇 | Aptamers K14 of skate angiogenesis inhibitor 1 and screening method and application of aptamers K14 |
| CN105541990A (en) * | 2014-06-06 | 2016-05-04 | 张勇 | Aptamers K15 of skate angiogenesis inhibitor 1 and screening method and application of aptamers K15 |
| CN105567698A (en) * | 2014-06-06 | 2016-05-11 | 张勇 | Aptamer K19 of skate angiogenesis inhibitor 1 and screening method and application thereof |
| CN105646695A (en) * | 2014-06-06 | 2016-06-08 | 张勇 | Aptamer K16 of angiogenesis inhibiting factor 1 of skates as well as screening method and application of aptamer K16 |
| CN105669852B (en) * | 2014-06-06 | 2019-05-24 | 深圳市第三人民医院 | The aptamer K10 and its screening technique of ray Angiostatin 1 and application |
| CN105669851A (en) * | 2014-06-06 | 2016-06-15 | 张勇 | Aptamers K6 of ray angiogenesis inhibitor 1 and screening method and application of aptamers |
| CN105669851B (en) * | 2014-06-06 | 2019-05-21 | 广州中昱医学生物科技有限公司 | The aptamer K6 and its screening technique of ray Angiostatin 1 and application |
| CN105646695B (en) * | 2014-06-06 | 2019-04-12 | 浙江药苑生物科技有限公司 | The aptamer K16 and its screening technique of ray Angiostatin 1 and application |
| CN105669852A (en) * | 2014-06-06 | 2016-06-15 | 张勇 | Aptamer K10 of sea purse angiogenesis inhibitor 1 and screening method and application of aptamer K10 |
| CN105541989B (en) * | 2014-06-06 | 2020-06-02 | 李悦 | Aptamers K20 of skate angiogenesis inhibitor 1 and screening method and application thereof |
| CN105541988B (en) * | 2014-06-06 | 2020-05-19 | 浙江药苑生物科技有限公司 | Aptamers K14 of skate angiogenesis inhibitor 1 and screening method and application thereof |
| CN105541990B (en) * | 2014-06-06 | 2020-05-15 | 西安康普利医疗器械科技有限公司 | Aptamers K15 of skate angiogenesis inhibitor 1 and screening method and application thereof |
| CN104031137A (en) * | 2014-06-06 | 2014-09-10 | 杭州普英生物科技有限公司 | Aptamers of sea purse angiogenesis inhibiting factor 1 as well as screening method and application of aptamers |
| CN105567698B (en) * | 2014-06-06 | 2018-08-31 | 青岛英赛特生物科技有限公司 | The aptamer K19 and its screening technique of ray Angiostatin 1 and application |
| CN105541986B (en) * | 2014-06-06 | 2019-04-12 | 浙江药苑生物科技有限公司 | The aptamer K9 and its screening technique of ray Angiostatin 1 and application |
| CN105713081B (en) * | 2014-06-06 | 2019-04-12 | 浙江药苑生物科技有限公司 | The aptamer K17 and its screening technique of ray Angiostatin 1 and application |
| CN104388422A (en) * | 2014-10-24 | 2015-03-04 | 集美大学 | Oligonucleotide sequence as well as preparation method and application thereof |
| CN107619850A (en) * | 2017-09-08 | 2018-01-23 | 集美大学 | A kind of method of the quantitative detection vibrio alginolyticus based on aptamer |
| CN108034659A (en) * | 2017-12-01 | 2018-05-15 | 广西科学院 | A kind of ssDNA aptamers and its vibrio alginolyticus quickly detection in application |
| CN108004240A (en) * | 2017-12-01 | 2018-05-08 | 广西科学院 | SsDNA aptamer and its application of one species specificity for vibrio alginolyticus |
| CN107858359A (en) * | 2017-12-01 | 2018-03-30 | 广西科学院 | It is a kind of can specific recognition vibrio alginolyticus aptamer and its application |
| CN107858358A (en) * | 2017-12-01 | 2018-03-30 | 广西科学院 | A kind of ssDNA aptamers that can be identified and combine vibrio alginolyticus and its application |
| CN110564815A (en) * | 2019-09-03 | 2019-12-13 | 集美大学 | method for obtaining ultra-short sequence aptamer through screening |
| CN110578010A (en) * | 2019-09-03 | 2019-12-17 | 集美大学 | Four groups of oligonucleotide sequences for identifying and identifying vibrio anguillarum and screening method thereof |
| CN113234727A (en) * | 2021-06-09 | 2021-08-10 | 集美大学 | Pseudomonas proteorns antibacterial aptamer and screening method thereof |
| CN113278622A (en) * | 2021-06-09 | 2021-08-20 | 集美大学 | Pseudomonas proteorum aptamer and screening method thereof |
| CN113278622B (en) * | 2021-06-09 | 2023-09-19 | 集美大学 | Pseudomonas deformans aptamer and screening method thereof |
| CN113234727B (en) * | 2021-06-09 | 2023-11-24 | 集美大学 | Pseudomonas deformans antibacterial aptamer and screening method thereof |
| WO2023096575A3 (en) * | 2021-11-25 | 2023-08-10 | Agency For Science, Technology And Research | Method and sensor for detecting vibrio bacteria |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103060326A (en) | Six oligonucleotide sequences and application thereof | |
| CN102329862B (en) | Three oligonucleotide sequences for identification and detection of vibrio alginolyticus as well as preparation method and application thereof | |
| CN102605075B (en) | A group of oligonucleotide sequences capable of identifying Vibrio harveyi and Vibrio alginolyticus synchronously and preparation method of the oligonucleotide sequences | |
| Auinger et al. | Improved methodology for identification of protists and microalgae from plankton samples preserved in Lugol's iodine solution: combining microscopic analysis with single-cell PCR | |
| Wong Sak Hoi et al. | Ste12 and Ste12-like proteins, fungal transcription factors regulating development and pathogenicity | |
| CN102199667A (en) | Oligonucleotide sequence for detecting vibrio alginolyticus and application thereof | |
| Zhang et al. | Regulation of filamentation in the human fungal pathogen C andida tropicalis | |
| Asaoka et al. | MicroRNA signature of intestinal acute cellular rejection in formalin-fixed paraffin-embedded mucosal biopsies | |
| Dzhembekova et al. | Applicability of massively parallel sequencing on monitoring harmful algae at Varna Bay in the Black Sea | |
| Hu et al. | Transcriptomic analysis of Mandarin fish brain cells infected with infectious spleen and kidney necrosis virus with an emphasis on retinoic acid-inducible gene 1-like receptors and apoptosis pathways | |
| Meng et al. | The transcriptomic response to copper exposure by the gill tissue of Japanese scallops (Mizuhopecten yessoensis) using deep-sequencing technology | |
| Zhang et al. | A Myb transcription factor of Phytophthora sojae, regulated by MAP kinase PsSAK1, is required for zoospore development | |
| Sircaik et al. | The protein kinase Ire1 impacts pathogenicity of Candida albicans by regulating homeostatic adaptation to endoplasmic reticulum stress | |
| CN102816840A (en) | Multiplex fluorescent PCR kit for detection of vibrios in water body and detection method. | |
| CN103937892A (en) | Multiplex-PCR (Polymerase Chain Reaction) detection primer group and kit for various duck-derived pathogenic bacteria | |
| Soll | White-opaque switching in Candida albicans: cell biology, regulation, and function | |
| Kakade et al. | ZCF32, a fungus specific Zn (II) 2 Cys6 transcription factor, is a repressor of the biofilm development in the human pathogen Candida albicans | |
| Fan et al. | FgHtf1 regulates global gene expression towards aerial mycelium and conidiophore formation in the cereal fungal pathogen Fusarium graminearum | |
| CN104388422A (en) | Oligonucleotide sequence as well as preparation method and application thereof | |
| He et al. | Botrytis cinerea small RNAs are associated with tomato AGO1 and silence tomato defense-related target genes supporting cross-kingdom RNAi | |
| CN102911891B (en) | Pseudomonas aeruginosa capable of secreting fluorescent iron carrier and application thereof | |
| CN107653308B (en) | One group is combined and kit for distinguishing active tuberculosis patient with the primer pair of non-tuberculous pneumonia patient | |
| Hou et al. | Spiroplasma eriocheiris induces mouse 3T6-Swiss albino cell apoptosis that associated with the infection mechanism | |
| Liu | Handbook of nucleic acid purification | |
| CN103451305A (en) | Primers, probe, method and kit for detecting diffusely adherent Escherichia coli |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130424 |