CN101109013A - Micromolecule nucleotide DNA adaptorprotein against tubercle bacillus infection and method of preparing the same - Google Patents
Micromolecule nucleotide DNA adaptorprotein against tubercle bacillus infection and method of preparing the same Download PDFInfo
- Publication number
- CN101109013A CN101109013A CNA2006100196718A CN200610019671A CN101109013A CN 101109013 A CN101109013 A CN 101109013A CN A2006100196718 A CNA2006100196718 A CN A2006100196718A CN 200610019671 A CN200610019671 A CN 200610019671A CN 101109013 A CN101109013 A CN 101109013A
- Authority
- CN
- China
- Prior art keywords
- dna
- screening
- adaptive
- seqidno
- mycobacterium tuberculosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a DNA aptamer capable of inhibiting tubercle bacillus infection and the preparation method thereof. The DNA aptamer has the nucleotide sequence shown in the SEQIDNO.1-10. The preparation methods comprise steps as follows: firstly the construction of the random single strand DNA library; secondly synthesis of the double strand DNA library; thirdly selection and screening of SELEX; fourthly PCR enlargement; fifthly cloning and sequence of the DNA, and finally verification of the effects of the DNA aptamer through in vivo and in vitro experiments. The DNA aptamer can be directly used to inhibit the tubercle bacillus and prevent and cure tuberculosis. The invention overcomes the disadvantages of long treatment period and high side effects of the common medicines such as rifampin and streptomycin.
Description
Technical field
The invention belongs to infected by microbes immunity and check field, be specifically related to a kind of tubercule bacillus (Mycobacterium Tuberculosis, H37Rv) adaptive son of DNA (Aptamer) of [ATCC 93009 (4)] that can suppress infected person, has SEQIDNO.1, SEQIDNO.2, SEQIDNO.3, SEQIDNO.4, SEQIDNO.5, SEQIDNO.6, SEQIDNO.7, SEQIDNO.8, SEQIDNO.9, the nucleotide sequence shown in the SEQIDNO.10.Also relate to a kind of can the combination of preparation simultaneously, suppress the method for the adaptive son of high affine DNA of mycobacterium tuberculosis infection with the tubercle bacillus differential of infected person.
Background technology
The tuberculosis that mycobacterium tuberculosis (Mycobacterium Tuberculosis) infection human body causes is a kind of chronic infectious disease of serious harm people's health.Tuberculosis is one of disease that morbidity and mortality ratio are the highest in history.Since the fifties in last century, lungy popularly be under control to a certain extent.Since the mid-80, because factors such as the popular and spreading of AIDS of resistance tubercule bacillus spreads, the country that makes some control the tuberculosis epidemic situation epidemic situation occurred and has further increased the weight of or spread the popular situation, and the tuberculosis epidemic situation has the trend of further new line again.Show that according to The World Health Organization's statistical information the whole world has nearly 1/3rd people to infect tubercule bacillus at present, the active tuberculosis patient reaches 2,000 ten thousand, has every year 3000000 people to die from tuberculosis, newly-increased patient 8,800,000 people.1993, the World Health Organization announced " global tuberculosis is in a state of emergency ", tuberculosis was classified as one of transmissible disease of emphasis control.China is the high burden of tuberculosis country, and State Council has determined that tuberculosis is one of China's three big keypoint control transmissible diseases.Therefore, strengthen, suddenly wait to develop novel antituberculosis drug,, have very big researching value and social benefit so that this disease is effectively treated and prevented to R﹠D intensity lungy.
SELEX technology (Systematic Evolution of Ligands by Exponential Enrichment, phyletic evolution index concentration technology) is a kind of new combinatorial chemistry technique of early 1990s development, ultimate principle is the jumbo random oligonucleotide of utilization library, and the outer pcr amplification technology of combination, oligonucleotide with index concentration and target molecule specific combination, through multi-turns screen, obtain high-affinity, the oligonucleotide aptamer of high specificity (aptamers), it is big to have storage capacity, the target molecule scope is wide, avidity advantages of higher, range of application are very extensive.Successfully apply to the screening of many target molecules, comprise metal ion, organic dye, protein, medicine, amino acid and various cytokines etc.Easy, quick, economic dispatch characteristics that this method has, compare with other combinatorial chemical libraries such as random peptide library, antibody library and phage display library, the adaptive son that filters out from oligonucleotide library has higher affinity and specificity, has a good application prospect.Adaptive son is compared with antibody on the traditional sense, and it is little to have a molecular weight, can infiltrate cell quickly, removes in blood rapidlyer, can stablize syntheticly, is convenient to characteristics such as modification.Be potential conduct prevention, diagnosis and the novel agent for the treatment of disease.In this research, we adopt the SELEX technology that H37Rv is screened, and sieve with BCG is counter, to obtain the biological activity micromolecule nucleotide Aptamers molecule of energy antagonism mycobacterium tuberculosis surface virulence composition.Be the mycobacterium tuberculosis infection Study on Mechanism, the exploitation of tuberculotherapy newtype drug and novel diagnostic reagent and laying the foundation.
Summary of the invention
The objective of the invention is to be to provide a kind of adaptive son of DNA that can suppress mycobacterium tuberculosis infection, the adaptive son of this DNA provides novel antagonist for preventing and treating tuberculosis, can overcome clinical commonly used drug Rifampin (rifampin), Streptomycin sulphate treatment cycle such as (streptomycin) is long, the shortcoming that side effect is big.
Another object of the present invention provides a kind of method for preparing the adaptive son of DNA that can suppress mycobacterium tuberculosis infection, this method is by structure, double chain DNA library synthesis, pcr amplification, SELEX screening, the experiment of vitro inhibition bacteria attack of random single-stranded DNA banks and primer, obtain to suppress the adaptive son of DNA of mycobacterium tuberculosis infection mouse, and effective by the experimentation on animals detection, the accuracy rate height.
To achieve these goals, the present invention is by the following technical solutions:
A kind of adaptive son of DNA that can suppress mycobacterium tuberculosis infection, it has SEQIDNO.1, SEQIDNO.2, SEQIDNO.3, SEQIDNO.4, SEQIDNO.5, SEQIDNO.6, SEQIDNO.7, SEQIDNO.8, SEQIDNO.9, the nucleotide sequence shown in the SEQIDNO.10.
A kind of preparation method that can suppress the adaptive son of DNA of mycobacterium tuberculosis infection follows these steps to order and carries out:
1, makes up random single chain DNA (ssDNA) library and primer.Making up length is single stranded DNA (ssDNA) library: the 5 '-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N of 88 bases
30-GGGTCAATGCGTCATA-3 ', wherein N represents base A, G, T, any one among the C, the capacity in this library is about 10
14～10
15Make up upstream primer: 5 '-GCGGAATTC
TAATACGACTCACTATAGGGAACAGTCCGAGCC-3 ', wherein setting-out partly is the sequence of T7 promotor, this primer contains the restriction enzyme site of DNA restriction enzyme EcoRI; Make up downstream primer: 5 '-GCGGGATCCTATGACGCATTGACCC-3 ', contain the restriction enzyme site of DNA restriction enzyme BamHI in this primer.Random single-stranded DNA banks and primer can be synthetic by primer Synesis Company.
2, the pcr amplification in double-stranded DNA (dsDNA) and single stranded DNA (ssDNA) library is preserved: whenever earlier the ssDNA amplified library is become the dsDNA library before taking turns screening, preserve, and be the ssDNA library that template amplification goes out the next round screening with the dsDNA library.For stable condition, do not change response procedures: 94 ℃ of 4min, 94 ℃ of 30s, 56 ℃ of 45s, 72 ℃ of 1min30s, 18～25 circulations, 72 ℃ of 7min.Regulate cycle index to obtain best expanding effect (18～25 circulations).The PCR product detects with 1.5% agarose gel electrophoresis, and test kit reclaims purifying.
3, the purifying of pcr amplification product.With 2% sepharose that contains the 0.5ug/ml ethidium bromide, pcr amplification product in the step 2 is carried out electrophoresis, place it in then on the 260nm zyglo plate, the pcr amplification product that is the orange band is downcut, the DNA purifying recovery test kit purifying that provides with German Qiagen company;
4, SELEX screening.Every used ssDNA amount of screening of taking turns is 8ug, after use is prepended to 85 ℃ of water-bath 15min, rapid ice bath 5min, get equivalent in the screening damping fluid (in 1 * buffer) with bacteriological action, 37 ℃ of 15min that gently shake, 12000rpm 5min abandons supernatant, adds screening elutriant (1 * buffer) repetitive scrubbing 4～6 times again.The gained bacterium is with the 50ul ddH that sterilizes
2O blows even, boils 5min, and ice bath with phenol/chloroform (25: 24) extracting, is got supernatant, and pcr amplification dsDNA storehouse is the template that next round is screened.
Above-mentioned SELEX screening damping fluid (2 *) is: 25mmol/L Cui Shi alkali salt acid buffer (Tris-Cl), 50mmol/L Repone K (KCl), 200mmol/L sodium-chlor (NaCl), 0.2mmol/L ethylenediamine tetraacetic acid (EDTA) (EDTA), 5% glycerine (Glycerol), 0.5mmol/L dithiothreitol (DTT) (DTT).
Above-mentioned SELEX screening elutriant (2 *) is: 25mmol/L Cui Shi alkali salt acid buffer (Tris-Cl), 50mmol/L Repone K (KCl), 1mol/L sodium-chlor (NaCl), 0.2mmol/L ethylenediamine tetraacetic acid (EDTA) (EDTA), 5% glycerine (Glycerol), 0.5mmol/L dithiothreitol (DTT) (DTT).
5,, select for use the gradient screening to increase selective pressure in order to obtain specificity screening.Preceding three-wheel is with 10
8CFU (colony-forming unit) H37RV (available from Beijing pharmaceutical preparation institute) screening;
6, four-wheel begins to add that BCG is counter sieves, and collects the adaptive sub-8ug of gained ssDNA in the third round, use be prepended to 85 ℃ of water-bath 15min after, ice bath 5min gets screening damping fluid/1 * with 10
6CFU BCG (available from Beijing Biological Product Inst.) effect, 37 ℃ of 15min that shake, 12000rpm 5min abandons supernatant, adds screening elutriant/1 * washing again, and centrifugal 5 minutes of 12000rpm abandons precipitation, with supernatant liquor and 10
7The CFUH37Rv effect, method is the same, and centrifugal back gained bacterium is with the 50ul ddH that sterilizes
2O blows even, boils 5min, and ice bath with phenol/chloroform/extracting in 25: 24, is got supernatant, and pcr amplification dsDNA storehouse is the template of next round screening, goes out the adaptive son of ssDNA of next round screening with this template amplification.
7, repeat above-mentioned steps eight times.The the 4th to the 6th takes turns with 10
7CFU H37RV screening is with 10
6CFU BCG begins anti-sieve; The the 7th to the 9th takes turns with 10
6CFU H37RV screening, and with 10
7CFU BCG is counter to be sieved; The the tenth to 12 takes turns with 10
5CFU H37RV screening, and with 10
8CFU BCG is counter to be sieved, and finishes 12 and takes turns screening.
8, the avidity of adaptive word bank of gained and tubercule bacillus after relatively each wheel screens, method is got respectively and is respectively taken turns adaptive sub-8ug, with 10 with step 5
8The H37RV effect of CFU, remaining single stranded DNA amount after the ultraviolet spectrophotometer 260nm detection effect.By detecting, the tenth avidity maximum of taking turns adaptive word bank and tubercule bacillus as can be known.Take turns the single stranded DNA that obtains with the tenth and carry out pcr amplification, obtain the double-stranded DNA product,, be connected in plasmid pUC19 (Yanisch-Perron through DNA restriction enzyme EcoRI and BamHI digestion, C., et al., 1985) on, be transformed into bacillus coli DH 5 alpha (Hanahan, D., 1983; Tartof, K.D., et al., 1987), ammonia benzyl resistance screening, the single growth bacterium colony of picking checks order, obtain above-mentioned SEQIDNO.1, SEQIDNO.2, SEQIDNO.3, SEQIDNO.4, SEQIDNO.5, SEQIDNO.6, SEQIDNO.7, SEQIDNO.8, SEQIDNO.9, the nucleotide sequence shown in the SEQIDNO.10.
Advantage of the present invention and effect:
One: the specific virulence factor that plays a role in the tubercule bacillus pathogenic course that is combined in of energy, can reduce the ability that tubercule bacillus is invaded scavenger cell, suppress the mycobacterium tuberculosis infection mouse.The adaptive son of DNA can prevent and treat tuberculosis directly as the antagonist use of tubercule bacillus.Carry out the screening of the adaptive son of DNA of the full bacterium of tubercule bacillus because adopted new combinatorial chemistry technique-SELEX technology, guaranteed that but the adaptive son specificity of DNA that obtains is combined on the tubercule bacillus thalline virulence factor, thereby sealed the pathogenic sites of tubercule bacillus, make it can not enter scavenger cell, thereby can not in body, hold and stay and breed, help immunity system it is removed.
Two:, provide new solution route for overcoming serious day by day resistance problem and the big situation of side effect that tuberculosis treatment clinically occurs.The treatment typhoid fever infects the broad-spectrum antibiotics that adopt more at present, as isoniazid (isoniazid), Rifampin (rifampin), Streptomycin sulphate (streptomycin), pyrazinoic acid amide (pyrazinamide), Tibutol (etambutol) and Thioacetazone (bethiozone), these medicines not only kill and wound tubercule bacillus and also kill and wound and colonize in the intravital multiple beneficial flora of people, and side effect is big, and the cycle is long; The resistance problem that these medicines are produced of tubercule bacillus is also serious day by day simultaneously.The adaptive son of DNA of the present invention's preparation is a small molecules nucleic acid, the different and any Broad spectrum antibiotics of its molecular structure, thereby the sorrow that has no drug resistance; The adaptive son of DNA only plays a role at tubercule bacillus simultaneously, and the intravital multiple beneficial flora of people be there is no harm.Also not in traditional protein antibody, its molecular weight is little, can infiltrate cell fast for the adaptive son of DNA, and no antigen does not cause side effect.
Three: by following table as can be known, in the experimentation on animals, mouse attacks that poison was got lungs in back 19 days and spleen carries out bacterial count, and after can finding to handle tubercule bacillus H37Rv with the adaptive son of DNA, the number of tubercule bacillus obviously will be less than and not add the adaptive sub-treatment group of DNA.Illustrate that adaptive son of the present invention can suppress tubercule bacillus effectively and invade scavenger cell, promoted tubercule bacillus in the intravital removing of machine, can be directly as the antagonist use of tubercule bacillus.In addition, adaptive son of this DNA and adaptive word bank have been cloned on the puc19 plasmid, and this plasmid has been transformed in the bacillus coli DH 5 alpha, can directly carry out the scale operation preparation with this bacterial strain.
| Group | Lung(CFU) | Spleen(CFU) |
| H37Rv H37Rv+N K2 | 1.3×10 7 1.19×10 7 | 1.07×10 6 7.0×10 5 |
| H37Rv+aptamers pool | 2.9×10 6 | 1.5×10 5 |
Description of drawings
Fig. 1 .SELEX technology screening specificity suppresses the adaptive sub-synoptic diagram of tuberculosis infection.
With synthetic single stranded oligonucleotide library and tubercule bacillus toxic strain H37Rv effect at random, removing can not the bonded part, adds behind the screening three-wheel that BCG is counter to be sieved, and screens 12 altogether and takes turns.
Fig. 2. the amplification synoptic diagram of single stranded DNA and double-stranded DNA.
Whenever, earlier the ssDNA amplified library is become the dsDNA library before taking turns screening, preserve, and be the ssDNA library that template amplification goes out the next round screening with the dsDNA library.This figure selects the 3rd, 5 for use, and 7,9,11 ssDNA that take turns and dsDNA are as example.
Fig. 3. the ability of the adaptive son of each wheel (3～12) screening resulting ssDNA in back of toxic strain tubercule bacillus absorption is synoptic diagram relatively.
After all having screened, get the every ssDNA and 10 that obtains after the screening that takes turns of 8ug respectively
8CFU H37Rv effect finds that the tenth takes turns adaptive word bank and in tubercule bacillus the strongest binding ability arranged.
Fig. 4 A, 4B. isothermal titration calorimetry detect Nucleotide SEQIDNO.1 and H37Rv and BCG avidity synoptic diagram.
Origin 5.0 softwares that provide with Microcal company carry out the non-linear minimum variance of dibit point model to the heat of dilution of adaptive son of SEQIDNO.1 and bacterial reaction and fit, and the intrinsic that can obtain adaptive son of SEQIDNO.1 and bacteriological action is in conjunction with constant K
aWherein the binding constant of adaptive son of SEQIDNO.1 and BCG is respectively K
1a: 7.20 * 10
4(± 3.6 * 10
3) Lmol
-1, Δ G
1=3.124 * 10
5(± 3.674 * 10
4) J; K
2a: 1.52 * 10
5(± 9.8 * 10
3) Lmol
-1, Δ G
2=7.247 * 10
4(± 2.94 * 10
3) J (Fig. 4 A).And the binding constant of adaptive son of SEQIDNO.1 and H37Rv is respectively K
1a: 1.84 * 10
4(± 1.5 * 10
3) Lmol
-1, Δ G
1=6.248 * 10
5(± 4.517 * 10
4) J; K
2a: 7.65 * 10
5(± 6.0 * 10
4) Lmol
-1, Δ G
2=-3.739 * 10
5(± 8.968 * 10
4) J (Fig. 4 B).From data as can be known, adaptive son of SEQIDNO.1 and tubercule bacillus have two binding sites, when combining with BCG, be thermo-negative reaction all, and when combining with H37RV, one of them site is thermopositive reaction, and avidity is higher, illustrate that anti-sieve is effectively, thereby it is specific to screen resulting adaptive son.
Fig. 5. suppress the ability synoptic diagram of tubercule bacillus invasion and attack scavenger cell.
As seen from the figure, the quantity that scavenger cell is invaded in tubercule bacillus and adaptive son effect back obviously reduces, and it is more more obvious than the effect of the adaptive son of single SEQIDNO.1 that SEQIDNO.1-10 mixes the effect of adaptive son.
Fig. 6. adaptive son prolongs the mouse survival time and improves the survival rate synoptic diagram.
Adaptive son with combine bacillus effect after, can obviously prolong the survival time behind the mouse infection tubercule bacillus, and survival rate is improved also.Wherein A is a tubercule bacillus H37Rv infecting mouse group, and B is the adaptive son effect of a tubercule bacillus H37Rv and SEQIDNO.1 postoperative infection mouse group, and C is that tubercule bacillus H37Rv and SEQIDNO.1-10 mix adaptive son effect postoperative infection mouse group.As can be seen from the figure, after tubercule bacillus and the adaptive son effect, the half mortality ratio can be postponed 3 days, and survival rate can improve 1 times.
Fig. 7. adaptive son is to the pathological change synoptic diagram of tubercule bacillus infringement mouse lungs.
As seen from the figure, after acting on adaptive son, infringement obviously alleviates to mouse lung popular name for reason in conjunction with bacillus.Wherein A is the normal mouse lungs, and B is tubercule bacillus H37Rv infecting mouse lungs, and C is the adaptive son effect of tubercule bacillus H37Rv and SEQIDNO.1 postoperative infection mouse lungs, and D tubercule bacillus H37Rv and SEQIDNO.1-10 mix adaptive son effect postoperative infection mouse lungs.
Fig. 8. lungs content of molds synoptic diagram behind the adaptive son minimizing mycobacterium tuberculosis infection mouse.
Acid-fast stain confirms, tubercule bacillus H37Rv and adaptive son effect postoperative infection mouse do not compare with acting on adaptive son, and the content of molds of mouse lungs obviously reduces.Wherein A is for being tubercule bacillus H37Rv infecting mouse lungs, B is the adaptive son effect of tubercule bacillus H37Rv and SEQIDNO.1 postoperative infection mouse lungs, C tubercule bacillus H37Rv and SEQIDNO.1-10 mix adaptive son effect postoperative infection mouse lungs, D is Streptomycin sulphate treatment back mouse lungs, and the arrow indication is a tubercule bacillus.
Embodiment:
A kind of adaptive son of DNA that can suppress mycobacterium tuberculosis infection, it has the nucleotide sequence shown in the SEQIDNO. (1-10).
A kind of preparation method that can suppress the adaptive son of DNA of mycobacterium tuberculosis infection follows these steps to order and carries out:
1, makes up random single chain DNA (ssDNA) library and primer.Making up length is single stranded DNA (ssDNA) library: the 5 '-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N of 88 bases
30-GGGTCAATGCGTCATA-3 ', wherein N represents base A, G, T, any one among the C, the capacity in this library is about 10
14～10
15Make up upstream primer: 5 '-GCGGAATTC
TAATACGACTCACTATAGGGAACAGTCCGAGCC-3 ', wherein setting-out partly is the sequence of T7 promotor, this primer contains the restriction enzyme site of DNA restriction enzyme EcoRI; Make up downstream primer: 5 '-GCGGGATCCTATGACGCATTGACCC-3 ', contain the restriction enzyme site of DNA restriction enzyme BamHI in this primer.Random single-stranded DNA banks and primer can be synthetic by Shanghai bio-engineering corporation.
2, the pcr amplification in double-stranded DNA (dsDNA) and single stranded DNA (ssDNA) library is every earlier becomes the dsDNA library with the ssDNA amplified library before taking turns screening, preserves, and is the ssDNA library that template amplification goes out the next round screening with the dsDNA library.For stable condition, do not change response procedures: 94 ℃ of 4min, 94 ℃ of 30s, 56 ℃ of 45s, 72 ℃ of 1min30s, 18～25 circulations, 72 ℃ of 7min.Regulate cycle index to obtain best expanding effect (18～25 circulations).The PCR product detects with 1.5% agarose gel electrophoresis, and test kit reclaims purifying.
3, the purifying of pcr amplification product.With 2% sepharose that contains the 0.5ug/ml ethidium bromide, pcr amplification product in the step 2 is carried out electrophoresis, place it in then on the 260nm zyglo plate, the pcr amplification product that is the orange band is downcut, the DNA purifying recovery test kit purifying that provides with German Qiagen company;
4, SELEX screening.In order to obtain specificity screening, adopt the gradient screening to increase selective pressure.Preceding three-wheel is with 10
8CFU H37RV screening; Four-wheel to the six is taken turns with 10
6CFU H37RV screening, and with 10
6CFU BCG begins anti-sieve; The the 7th to the 9th takes turns with 10
6CFU H37RV screening, and with 10
7CFU BCG is counter to be sieved; The the tenth to 12 takes turns with 10
5CFU H37RV screening, and with 10
8CFU BCG is counter to be sieved.Every used ssDNA amount of screening of taking turns is 8ug, after use is prepended to 85 ℃ of water-bath 15min, rapid ice bath (0 ℃) 5min, get in right amount and (do with the bacterium sense in 1 * buffer) in the screening damping fluid, 37 ℃ of 15min that gently shake, 12000rpm 5min abandons supernatant, adds screening elutriant (1 * buffer) repetitive scrubbing 4～6 times again.The gained bacterium is with the 50ul ddH that sterilizes
2O blows even, boils (100 ℃) 5min, and ice bath (0 ℃) with phenol/chloroform (25: 24) extracting, is got supernatant, and pcr amplification dsDNA storehouse is the template that next round is screened.
Above-mentioned SELEX screening damping fluid (2 *) is: 25mmol/L Cui Shi alkali salt acid buffer (Tris-Cl), 50mmol/L Repone K (KCl), 200mmol/L sodium-chlor (NaCl), 0.2mmol/L ethylenediamine tetraacetic acid (EDTA) (EDTA), 5% glycerine (Glycerol), 0.5mmol/L dithiothreitol (DTT) (DTT).
Above-mentioned SELEX screening elutriant (2 *) is: 25mmol/L Cui Shi alkali salt acid buffer (Tris-Cl), 50mmol/L Repone K (KCl), 1mol/L sodium-chlor (NaCl), 0.2mmol/L ethylenediamine tetraacetic acid (EDTA) (EDTA), 5% glycerine (Glycerol), 0.5mmol/L dithiothreitol (DTT) (DTT).
5, finish 12 take turns screening after, the binding ability of each wheel screening back adaptive word bank of gained and tubercule bacillus relatively, method is got respectively and is respectively taken turns adaptive sub-8ug, with 10 with step 5
8The H37RV effect of CFU, remaining single stranded DNA amount after the ultraviolet spectrophotometer 260nm detection effect.By detecting, the tenth binding ability maximum of taking turns adaptive word bank and tubercule bacillus as can be known.
6, take turns the single stranded DNA that obtains with the tenth and carry out pcr amplification, obtain the double-stranded DNA product, through DNA restriction enzyme EcoRI and BamHI digestion, be connected on the plasmid pUC19, be transformed into bacillus coli DH 5 alpha, ammonia benzyl resistance screening, the single growth bacterium colony of picking checks order;
7, with the frequency of occurrences at most clone's the adaptive sons of the pairing DNA of single growth bacterium colony and the 10th take turns each 8ug of adaptive word bank and add respectively and contain 10
7Sense is done in the tubercule bacillus of CFU [ATCC93009 (4)] the bacterium liquid, and action method is with step 5, and the bacterium after sense is done is cooked mouse (C57BL/6) and attacks the poison experiment, does with the tubercule bacillus that does not have to handle simultaneously and attacks the poison contrast.Mouse is divided into four groups, 8 every group.First group for attacking poison group, injection 10
7CFU H37RV/ only; Second group with 10
7CFU H37RV and the 10th takes turns ssDNA storehouse 8ug, and 37 ℃ of senses are done to inject behind the 30min again; The 3rd group is the 10th to take turns the sub-N of frequency of occurrences maximum adaptation
K2With 10
7The injection of CFU H37RV effect back, method is with second group; The 4th group is Streptomycin sulphate treatment group, injection 10
724h behind the CFU H37RV is again with Streptomycin sulphate treatment (1mg/0.5ml./day), totally six days.Get physiological saline that 4 mouse only inject screening damping fluid (1 *) and 0.05%Tween-80 simultaneously as blank, all mouse are tail vein injection 400ul.H37RV is through the mouse interior generation, to strengthen virulence, so that the result is stable before the experiment.
Experiment showed, that adaptive word bank and single adaptive son all can prolong the survival time of mouse, and can obviously reduce the content of molds of live body lung tissue.Therefore, the tenth takes turns adaptive word bank is the adaptive word bank of the DNA that can suppress the mycobacterium tuberculosis infection mouse, and wherein the adaptive son of the list of frequency of occurrences maximum is the adaptive son of the DNA that can suppress the mycobacterium tuberculosis infection mouse.
Above-mentioned SELEX screening damping fluid (2 *) is: 25mmol/L Cui Shi alkali salt acid buffer (Tris-Cl), 50mmol/L KCl, 200mmol/LNaCl, 0.2mmol/L ethylenediamine tetraacetic acid (EDTA) (EDTA), 5% glycerine (Glycerol), 0.5mmol/L dithiothreitol (DTT) (DTT).
SEQUENCE LISTING
＜110〉small molecule nucleotide DNA aptamer of anti-mycobacterium tuberculosis infection and preparation method thereof
＜120〉Wuhan University
＜130〉Zhang Xiaolian, Chen Fan
<140>10
<141>Patentin version 3.1
Sequence
--------
＜213〉OrganismName: synthetic
<400>PreSequenceString：tttaatcacacaacaccgtgcttcaagctt 30
<212>Type：DNA
<211>Length：30
SequenceName：1
SequenceDescription: single-strand DNA aptamer
Sequence
--------
＜213〉OrganismName: synthetic
<400>PreSequenceString：tttaatcacacaacaccgtgtttcaagctt 30
<212>Type：DNA
<211>Length：30
SequenceName：2
SequenceDescription: single-strand DNA aptamer
Sequence
--------
＜213〉OrganismName: synthetic
<400>PreSequenceString：tttaatcacacaacaccgtgcttctagctt 30
<212>Type：DNA
<211>Length：30
SequenceName：3
SequenceDescription: single-strand DNA aptamer
Sequence
--------
＜213〉OrganismName: synthetic
<400>PreSequenceString：tttaatcacacaacaccgtgctactagctt 30
<212>Type：DNA
<211>Length：30
SequenceName：4
SequenceDescription: single-strand DNA aptamer
Sequence
--------
＜213〉OrganismName: synthetic
<400>PreSequenceString：tttaatcctcaacaccgtgcttcaagctca 30
<212>Type：DNA
<211>Length：30
SequenceName：5
SequenceDescription: single-strand DNA aptamer
Sequence
--------
＜213〉OrganismName: synthetic
<400>PreSequenceString：cgacaggggtctgaatcacgtacattcgta 30
<212>Type：DNA
<211>Length：30
SequenceName：6
SequenceDescript ion: single-strand DNA aptamer
Sequence
--------
＜213〉OrganismName: synthetic
<400>PreSequenceString：cgacaggggtctgaaccacgtacattcgta 30
<212>Type：DNA
<211>Length：30
SequenceName：7
SequenceDescription: single-strand DNA aptamer
Sequence
--------
＜213〉OrganismName: synthetic
<400>PreSequenceString：ataactggatccgtccacaccttcaaactg 30
<212>Type：DNA
<211>Length：30
SequenceName：8
SequenceDescription: single-strand DNA aptamer
Sequence
--------
＜213〉OrganismName: synthetic
<400>PreSequenceString：acccacttcgaatccagattcatgaaccaa 30
<212>Type：DNA
<211>Length：30
SequenceName：9
SequenceDescription: single-strand DNA aptamer
Sequence
--------
＜213〉OrganismName: synthetic
<400>PreSequenceString：cccatactacattcatcccggaacacgtgg 30
<212>Type：DNA
<211>Length：30
SequenceName：10
SequenceDescription: single-strand DNA aptamer
Claims (13)
1. adaptive son of DNA that can suppress mycobacterium tuberculosis infection, it has the nucleotide sequence shown in the SEQIDNO.1.
2. adaptive son of DNA that can suppress mycobacterium tuberculosis infection, it has the nucleotide sequence shown in the SEQIDNO.2.
3. adaptive son of DNA that can suppress mycobacterium tuberculosis infection, it has the nucleotide sequence shown in the SEQIDNO.3.
4. adaptive son of DNA that can suppress mycobacterium tuberculosis infection, it has the nucleotide sequence shown in the SEQIDNO.4.
5. adaptive son of DNA that can suppress mycobacterium tuberculosis infection, it has the nucleotide sequence shown in the SEQIDNO.5.
6. adaptive son of DNA that can suppress mycobacterium tuberculosis infection, it has the nucleotide sequence shown in the SEQIDNO.6.
7. adaptive son of DNA that can suppress mycobacterium tuberculosis infection, it has the nucleotide sequence shown in the SEQIDNO.7.
8. adaptive son of DNA that can suppress mycobacterium tuberculosis infection, it has the nucleotide sequence shown in the SEQIDNO.8.
9. adaptive son of DNA that can suppress mycobacterium tuberculosis infection, it has the nucleotide sequence shown in the SEQIDNO.9.
10. adaptive son of DNA that can suppress mycobacterium tuberculosis infection, it has the nucleotide sequence shown in the SEQIDNO.10.
11. the described a kind of preparation method that can suppress the adaptive son of DNA of mycobacterium tuberculosis infection of claim 1 is characterized in that this method comprises the following steps:
A, structure single-stranded DNA banks: 5 '-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-N
30-GGGTCAATGCGTCATA-3 ' makes up upstream primer: 5 '-GCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCC-3 ', makes up downstream primer: 5 '-GCGGGATCCTATGACGCATTGACCC-3 ';
B, single-stranded DNA banks among the step a is increased into double-stranded DNA, preserve; Before the screening ssDNA amplified library is become the dsDNA library, preserve, and be that template amplification goes out the ssDNA library that next round is screened with the dsDNA library; Single-stranded DNA banks 2ul, upstream primer 0.1nmol, downstream primer 0.1nmol, 25mmol/LMgCl
26ul, 2mmol/L dNTP 10ul, 10 times of dna polymerase reaction damping fluid 10ul and 2.5 activity units of archaeal dna polymerase add distilled water/ddH
2Among the O, making cumulative volume is 100ul; Put into the PCR instrument then, response procedures is set at: 94 ℃ of 4min, and 94 ℃ of 30s, 56 ℃ of 45s, 72 ℃ of 1min30s, 18～25 circulations, 72 ℃ of 7min regulate cycle index 18～25;
C, the pcr amplification product among the step b is carried out electrophoresis with 2% sepharose that contains the 0.5ug/ml ethidium bromide, place it in then on the 260nm zyglo plate, the pcr amplification product that is the orange band is downcut, reclaim the test kit purifying with the DNA purifying;
D, collect the adaptive sub-8ug of gained ssDNA among the step c, use be prepended to 85 ℃ of water-bath 15min after, ice bath 5min gets screening damping fluid/1 * with 10
8CFU H37RV effect, 37 ℃ of 15min that shake, 12000rpm5min abandons supernatant, adds screening elutriant/1 * repetitive scrubbing again 4～6 times, and the gained bacterium is with the 50ul ddH that sterilizes
2O blows even, boils 5min, and ice bath with phenol/chloroform/extracting in 25: 24, is got supernatant, and pcr amplification dsDNA storehouse is the template of next round screening, carries out the strand amplification with this template, and with step c purifying, obtains the adaptive son of ssDNA that next round is screened;
E, repeating step d secondary, the adaptive sub-8ug of gained ssDNA replaces with the adaptive filial generation of screening back gained among the step c with collecting in the steps d;
F, collect the adaptive sub-8ug of gained ssDNA among the step e, use be prepended to 85 ℃ of water-bath 15min after, ice bath 5min gets screening damping fluid/1 * with 10
6CFU BCG effect, 37 ℃ of 15min that shake, 12000rpm 5min abandons supernatant, adds screening elutriant/1 * washing again, and centrifugal 5 minutes of 12000rpm abandons precipitation, with supernatant liquor and 10
7CFU H37Rv effect, method is the same, and centrifugal back gained bacterium is with the 50ul ddH that sterilizes
2O blows even, boils 5min, and ice bath with phenol/chloroform/extracting in 25: 24, is got supernatant, and pcr amplification dsDNA storehouse is the template of next round screening, goes out the adaptive son of ssDNA of next round screening with this template amplification;
G, repeating step f eight times, the adaptive sub-8ug of gained ssDNA replaces with the adaptive filial generation of screening back gained among the step e with collecting among the step f, and repeating step f is during for the third time to the 5th time, BCG bacterium among the step f measured change 10 into
7CFU changes HR37v bacterium amount into 10
6When CFU, repeating step f the 6th time to the 8th time, change BCG bacterium amount among the step f into 10
8CFU changes HR37v bacterium amount into 10
5CFU; Finish 12 and take turns screening;
The avidity of screening resulting ssDNA and tubercule bacillus is taken turns in h, comparison 12, will take turns adaptive word bank with one of tubercule bacillus avidity and increase into dsDNA with the method for step b; Through DNA restriction enzyme EcoRI and BamHI digestion, be connected on the plasmid pUC19, be transformed into bacillus coli DH 5 alpha, ammonia benzyl resistance screening, the single growth bacterium colony of picking checks order.
12. a kind of preparation method that can suppress the adaptive son of DNA of mycobacterium tuberculosis infection according to claim 2, it is characterized in that: the described screening of step f is just to sieve with tubercule bacillus H37Rv, sieves with the BCG bacille Calmette-Guerin vaccine is counter.
13. a kind of method that can suppress the adaptive son of DNA of mycobacterium tuberculosis infection according to claim 2 is characterized in that: the described SELEX screening of steps d damping fluid/2 * be: 25mmol/L Cui Shi alkali salt acid buffer, 50mmol/LKCl, 200mmol/LNaCl, 0.2mmol/L ethylenediamine tetraacetic acid (EDTA), 5% glycerine, 0.5mmol/L dithiothreitol (DTT); Described SELEX screening elutriant/2 * be: 25mmol/L Cui Shi alkali salt acid buffer, 50mmol/LKCl, 1mol/L NaCl, 0.2mmol/L ethylenediamine tetraacetic acid (EDTA), 5% glycerine, 0.5mmol/L dithiothreitol (DTT); Described centrifugal its rotating speed is 12000 rev/mins, and the time is 5 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100196718A CN100503824C (en) | 2006-07-20 | 2006-07-20 | Micromolecule nucleotide DNA adaptor against tubercle bacillus infection and method of preparing the same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100196718A CN100503824C (en) | 2006-07-20 | 2006-07-20 | Micromolecule nucleotide DNA adaptor against tubercle bacillus infection and method of preparing the same |
Related Child Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100039941A Division CN101497882B (en) | 2006-07-20 | 2006-07-20 | Anti- mycobacterium tuberculosis infection small molecule nucleotide DNA aptamer and preparation thereof |
| CNA2009100024999A Division CN101481687A (en) | 2006-07-20 | 2006-07-20 | Anti- mycobacterium tuberculosis infection small molecule nucleotide DNA aptamer and preparation thereof |
| CNA2009100024984A Division CN101481686A (en) | 2006-07-20 | 2006-07-20 | Anti- mycobacterium tuberculosis infection small molecule nucleotide DNA aptamer and preparation thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101109013A true CN101109013A (en) | 2008-01-23 |
| CN100503824C CN100503824C (en) | 2009-06-24 |
Family
ID=39041271
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006100196718A Expired - Fee Related CN100503824C (en) | 2006-07-20 | 2006-07-20 | Micromolecule nucleotide DNA adaptor against tubercle bacillus infection and method of preparing the same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100503824C (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011014989A1 (en) * | 2009-08-05 | 2011-02-10 | 中国人民解放军第三O九医院 | Oligonucleotide aptamers targeting at mycobacterium tuberculosis ag85b, preparing method and uses thereof |
| CN102071204A (en) * | 2010-12-06 | 2011-05-25 | 武汉大学 | Deoxyribonucleic acid (DNA) aptamer for mycobacterium tuberculosis glycolipid antigen and application thereof |
| CN102128926A (en) * | 2010-12-06 | 2011-07-20 | 武汉大学 | Double-adaptor kit and use thereof of in detection of tubercule bacillus antigen |
| CN101665821B (en) * | 2008-09-01 | 2012-02-08 | 中国人民解放军军事医学科学院基础医学研究所 | Oligonucleotide aptamer group for specifically identifying staphylococcus aureus and use thereof |
| CN102884192A (en) * | 2009-11-23 | 2013-01-16 | 国家健康与医学研究院 | Aptamers directed against the matrix protein-1 of type a influenza viruses and uses thereof |
| CN104911187A (en) * | 2015-07-01 | 2015-09-16 | 上海市肺科医院 | DNA aptamer of standard strain H37Rv of mycobacterium tuberculosis and preparation method thereof |
| CN104946655A (en) * | 2015-07-01 | 2015-09-30 | 上海市肺科医院 | DNA aptamer of mycobacterium tuberculosis standard strain H37Rv and preparation method thereof |
| CN109825515A (en) * | 2019-02-26 | 2019-05-31 | 华中农业大学 | A kind of low invasiveness mutant strain B2801 of mycobacterium bovis bcg |
| EP4219516A2 (en) | 2012-07-13 | 2023-08-02 | Wave Life Sciences Ltd. | Chiral control |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102703453B (en) * | 2012-06-13 | 2013-10-30 | 江南大学 | DNA aptamer specifically recognizing streptomycin and application of DNA aptamer |
-
2006
- 2006-07-20 CN CNB2006100196718A patent/CN100503824C/en not_active Expired - Fee Related
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101665821B (en) * | 2008-09-01 | 2012-02-08 | 中国人民解放军军事医学科学院基础医学研究所 | Oligonucleotide aptamer group for specifically identifying staphylococcus aureus and use thereof |
| WO2011014989A1 (en) * | 2009-08-05 | 2011-02-10 | 中国人民解放军第三O九医院 | Oligonucleotide aptamers targeting at mycobacterium tuberculosis ag85b, preparing method and uses thereof |
| CN102884192A (en) * | 2009-11-23 | 2013-01-16 | 国家健康与医学研究院 | Aptamers directed against the matrix protein-1 of type a influenza viruses and uses thereof |
| CN102071204A (en) * | 2010-12-06 | 2011-05-25 | 武汉大学 | Deoxyribonucleic acid (DNA) aptamer for mycobacterium tuberculosis glycolipid antigen and application thereof |
| CN102128926A (en) * | 2010-12-06 | 2011-07-20 | 武汉大学 | Double-adaptor kit and use thereof of in detection of tubercule bacillus antigen |
| CN102071204B (en) * | 2010-12-06 | 2012-07-11 | 武汉大学 | Deoxyribonucleic acid (DNA) aptamer for mycobacterium tuberculosis glycolipid antigen and application thereof |
| EP4219516A2 (en) | 2012-07-13 | 2023-08-02 | Wave Life Sciences Ltd. | Chiral control |
| CN104911187A (en) * | 2015-07-01 | 2015-09-16 | 上海市肺科医院 | DNA aptamer of standard strain H37Rv of mycobacterium tuberculosis and preparation method thereof |
| CN104946655A (en) * | 2015-07-01 | 2015-09-30 | 上海市肺科医院 | DNA aptamer of mycobacterium tuberculosis standard strain H37Rv and preparation method thereof |
| CN104911187B (en) * | 2015-07-01 | 2019-04-12 | 上海市肺科医院 | Mycobacterium tuberculosis type strain H37DNA aptamer of Rv and preparation method thereof |
| CN109825515A (en) * | 2019-02-26 | 2019-05-31 | 华中农业大学 | A kind of low invasiveness mutant strain B2801 of mycobacterium bovis bcg |
Also Published As
| Publication number | Publication date |
|---|---|
| CN100503824C (en) | 2009-06-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100503824C (en) | Micromolecule nucleotide DNA adaptor against tubercle bacillus infection and method of preparing the same | |
| Mullins et al. | Genome mining identifies cepacin as a plant-protective metabolite of the biopesticidal bacterium Burkholderia ambifaria | |
| Hayden et al. | Comparative metatranscriptomics of wheat rhizosphere microbiomes in disease suppressive and non-suppressive soils for Rhizoctonia solani AG8 | |
| Kannika et al. | Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR | |
| Petrini | Mycobacterium abscessus: an emerging rapid‐growing potential pathogen | |
| Hwang et al. | Phylogenetic characterization of virulence and resistance phenotypes of Pseudomonas syringae | |
| Bessen et al. | Molecular epidemiology and genomics of group A Streptococcus | |
| Athey et al. | High incidence of invasive group A Streptococcus disease caused by strains of uncommon emm types in Thunder Bay, Ontario, Canada | |
| Ruiz et al. | Differences in virulence factors among clinical isolates of Escherichia coli causing cystitis and pyelonephritis in women and prostatitis in men | |
| Bougnoux et al. | Serum is more suitable than whole blood for diagnosis of systemic candidiasis by nested PCR | |
| Xu et al. | Status of streptomycin resistance development in Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv. oryzicola in China and their resistance characters | |
| Benítez et al. | Linking sequence to function in soil bacteria: sequence-directed isolation of novel bacteria contributing to soilborne plant disease suppression | |
| Lorenz et al. | Prevalence of hemolysin genes and comparison of ehxA subtype patterns in Shiga toxin-producing Escherichia coli (STEC) and non-STEC strains from clinical, food, and animal sources | |
| CN106190903A (en) | Riemerlla anatipestifer Cas9 gene deletion mutants and application thereof | |
| CN101497882B (en) | Anti- mycobacterium tuberculosis infection small molecule nucleotide DNA aptamer and preparation thereof | |
| CN105331714A (en) | Peronophythora litchii LAMP (loop-mediated isothermal amplification) primer and rapid detection method thereof | |
| Ferreira-Paim et al. | Antifungal susceptibility, enzymatic activity, PCR-fingerprinting and ITS sequencing of environmental Cryptococcus laurentii isolates from Uberaba, Minas Gerais, Brazil | |
| CN101481687A (en) | Anti- mycobacterium tuberculosis infection small molecule nucleotide DNA aptamer and preparation thereof | |
| Ishak et al. | There is a specific response to pH by isolates of Haemophilus influenzae and this has a direct influence on biofilm formation | |
| Mir et al. | Supershed Escherichia coli O157: H7 has potential for increased persistence on the rectoanal junction squamous epithelial cells and antibiotic resistance | |
| CN101481686A (en) | Anti- mycobacterium tuberculosis infection small molecule nucleotide DNA aptamer and preparation thereof | |
| CN102373213B (en) | Mycobacterium tuberculosis surface lipolysaccharide-antistatic nucleic acid aptamer and application thereof | |
| Tully et al. | Fatal Actinomucor elegans var. kuwaitiensis infection following combat trauma | |
| CN101481685A (en) | Small molecule nucleotide aptamer medicament for hepatitis C virus, preparation and use | |
| CN102071204B (en) | Deoxyribonucleic acid (DNA) aptamer for mycobacterium tuberculosis glycolipid antigen and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Assignee: Wuhan Zhong Yuan Rui De Biological Products Co., Ltd. Assignor: Wuhan University Contract record no.: 2012420000074 Denomination of invention: Micromolecule nucleotide DNA adaptorprotein against tubercle bacillus infection and method of preparing the same Granted publication date: 20090624 License type: Exclusive License Open date: 20080123 Record date: 20120612 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090624 Termination date: 20140720 |
|
| EXPY | Termination of patent right or utility model |