CN104894043B - Engineering bacterium for producing gamma-aminobutyric acid and construction and application thereof - Google Patents

Abstract

The invention discloses an engineering bacterium for producing gamma-aminobutyric acid, and a construction and an application thereof, belonging to the technical field of biological engineering, wherein the engineering bacterium is obtained by integrating a gene for encoding L-glutamic acid decarboxylase and a promoter thereof on a chromosome of a host bacterium, and the integrated site is a gamma-aminobutyric acid transaminase gene.

Description

Engineering bacterium for producing gamma-aminobutyric acid and construction and application thereof

Technical Field

The invention relates to an engineering bacterium for producing gamma-aminobutyric acid and construction and application thereof, belonging to the technical field of biological engineering.

Background

Gamma-aminobutyric acid (GABA), an important inhibitory neurotransmitter widely distributed in animals, is involved in various metabolic activities, plays an important role in the cerebral cortex, hippocampus, thalamus, basal ganglia and cerebellum, and has a regulatory role in various functions of the body, including functions of producing sedation, an analgesic effect, anxiolysis, prevention and treatment of convulsions, relieving blood vessels and lowering blood pressure, preventing arteriosclerosis, regulating arrhythmia, and regulating the secretion of reproductive physiological hormones. Owing to its multiple physiological functions, gamma-aminobutyric acid has wide application in the fields of medicine, health product, food, feed additive, etc. In 2009, the Ministry of health was more approving gamma-aminobutyric acid as a new resource food.

The currently commonly used bacteria for producing the gamma-aminobutyric acid are escherichia coli and lactic acid bacteria, wherein the escherichia coli is mature in genetic operation, high in fermentation density and high in expression level, so that the process yield for producing the gamma-aminobutyric acid is high, and the production cost is low.

The novel Bacillus subtilis expression system comprises a gene engineering strain BS-T710 and an expression vector pBT-23a, wherein the gene engineering strain BS-T710 is obtained by inserting a promoter gene of T7 into a KpnI/XbaI restriction enzyme cutting site of a Bacillus subtilis expression vector pHT43, the gene engineering strain BS-T710 is obtained by integrating a gene of a grac gene, the gene engineering strain T7 is integrated with a gene engineering strain Tegpol 1737, the gene engineering strain T1730-T1737 is obtained by integrating a gene of a promoter of the T7 into a gene engineering strain Pdgalpol-DNA, the gene engineering strain BS-T710 is obtained by integrating a gene of the Bacillus subtilis and the expression vector pBt 1730-T1737, the gene engineering strain T-T1730-T1737 is obtained by integrating a promoter gene of the Bacillus subtilis and the gene engineering strain Pdgalp-DNA polymerase gene of the Bacillus subtilis, the gene engineering strain BS-T710 is obtained by integrating a gene engineering strain Pdgalpol-T1730-DNA, the gene engineering strain T1737-DNA polymerase gene of the Bacillus subtilis is obtained by integrating a gene engineering strain pdgalpol-DNA, the gene engineering strain pdgalpol-DNA engineering strain DNA engineering, the DNA engineering strain DNA engineering.

The genetic engineering bacteria express the foreign gene by utilizing the plasmid expression vector, and have two defects, namely, the plasmid is replicated in the bacillus subtilis, and particularly, the passage is unstable during large-scale fermentation, so that the protein expression at the later stage of the fermentation is reduced; secondly, for the convenience of screening, the expression plasmids of the bacillus subtilis have genes for encoding antibiotic resistance enzymes, which causes that bacteria additionally express useless enzymes, especially antibiotic resistance enzymes, in the fermentation process, and the application of the expression plasmids is limited in the food industry with strict safety requirements.

Disclosure of Invention

Therefore, the invention provides the engineering bacterium for producing the gamma-aminobutyric acid and the construction method thereof, which do not use plasmids to express the exogenous gene, are stable in heredity, high in safety and high in expression efficiency of L-glutamate decarboxylase, and aims at overcoming the defects that in the prior art, the passage of a bacillus subtilis expression system using the plasmids to express the exogenous gene is unstable, so that the later-stage protein expression is reduced, and the genes containing antibiotics and resistant enzymes cause resource waste and low safety.

Further, aiming at the low expression level of L-glutamate decarboxylase of the wild type of the bacillus subtilis in the prior art, the invention provides an engineering bacterium for producing gamma-aminobutyric acid and a construction method thereof, wherein a gc promoter is introduced, an expression element of a L-glutamate decarboxylase encoding gene is integrated on the chromosome of the bacillus subtilis, and the gamma-aminobutyric acid transaminase gene is knocked out simultaneously through the integration to improve the expression level of L-glutamate decarboxylase and reduce the metabolism of the gamma-aminobutyric acid, so that the yield of the gamma-aminobutyric acid is improved.

In order to solve the technical problems, the technical scheme of the invention is as follows:

a construction method of gene engineering bacteria for producing gamma-aminobutyric acid is obtained by integrating a gene (gadB) for coding L-glutamic acid decarboxylase and a promoter thereof into a chromosome of a host bacterium.

The construction method of the gene engineering bacteria for producing the gamma-aminobutyric acid comprises the following steps that an integrated site is in a gamma-aminobutyric transaminase gene (gabT), and the gamma-aminobutyric transaminase gene is inactivated after integration.

The construction method of the gene engineering bacteria for producing the gamma-aminobutyric acid is characterized in that the gene for coding L-glutamic acid decarboxylase is integrated into the chromosome of the host bacteria through a pMAD integration vector.

The construction method of the gene engineering bacteria for producing the gamma-aminobutyric acid, wherein the promoter is a grac promoter and is derived from a pHT01 expression vector.

The method for constructing the gene engineering bacteria for producing the gamma-aminobutyric acid is characterized in that the host bacteria are bacillus subtilis, and preferably bacillus subtilis 168 strains.

The construction method of the gene engineering bacteria for producing the gamma-aminobutyric acid, wherein the gene for coding L-glutamic acid decarboxylase is derived from microorganisms, and can be escherichia coli or other microorganisms capable of expressing enzymes with the same function.

L-glutamic acid decarboxylase gene can be obtained by whole gene synthesis based on the sequence of the galdB gene in GenBank No: M84025.1, or by PCR amplification using the genomic DNA of Escherichia coli (e.g., strain DH5 α) as a template.

The invention also provides the genetically engineered bacterium constructed by the construction method of the genetically engineered bacterium for producing the gamma-aminobutyric acid and application of the genetically engineered bacterium in producing the gamma-aminobutyric acid.

In one embodiment, the construction method of the genetically engineered bacteria can be that L-glutamate decarboxylase gene is firstly cloned to a shuttle expression vector pHT01 (MoBiTec company in Germany) of escherichia coli and bacillus subtilis, then a DNA fragment containing a promoter and a L-glutamate decarboxylase encoding gene and homologous arm fragments about 1000bp respectively at the upper and lower reaches of a site to be integrated of the bacillus subtilis are fused into a long fragment through overlap-PCR, the fragment is cloned to a plasmid pMAD to obtain a vector for integration, finally the vector is transformed into the bacillus subtilis, and through experimental operation and verification, the L-glutamate decarboxylase encoding gene expression element is integrated to a chromosome of the bacillus subtilis, so that efficient and stable expression in the bacillus subtilis is realized.

The shuttle expression vector pHT01 is a product of MoBiTec company, Germany, has the size of 8kb, contains a colibacillus and bacillus subtilis double-replication initiation site shuttle expression vector, contains an ampicillin resistance gene (in the colibacillus) and a chloramphenicol resistance gene (in the bacillus), a lactose inhibitor lacI gene, and a promoter is gram, requires IPTG to induce the expression of an exogenous gene, and has a plurality of restriction endonuclease sites.

The gene engineering bacteria are applied to the production of gamma-aminobutyric acid, wherein the gene engineering bacteria are used as an enzyme source for producing the gamma-aminobutyric acid.

The application of the genetic engineering bacteria in the production of the gamma-aminobutyric acid, wherein the method for producing the gamma-aminobutyric acid comprises the following steps:

1) activating and culturing engineering bacteria seeds, gradually amplifying the cultured seeds, and performing aerobic culture in a fermentation tank at the culture temperature of 30 ℃, controlling the pH value to be 6.8-7.0, dissolving more than 20% of oxygen, and fermenting for 24-30 hours;

2) centrifuging or membrane concentrating to obtain thallus, adding water to dilute to appropriate concentration, adding pyridoxal phosphate, gradually adding L-glutamic acid, and controlling pH of the reaction solution to 4.0-5.0 until pH of the reaction system does not rise.

Compared with the prior art, the technical scheme of the invention has the following characteristics:

the expression element of the L-glutamate decarboxylase coding gene is integrated on the chromosome of the host bacterium to construct the engineering bacterium, so that the L-glutamate decarboxylase can be efficiently and stably expressed, the constructed engineering bacterium has good genetic stability, the activity of the expressed L-glutamate decarboxylase is high, no redundant protein, especially antibiotic resistance protein is expressed, and the safety is high.

In order to overcome the side effect of the enzyme, a gabT gene coding the gamma-aminobutyric acid transaminase in engineering bacteria needs to be knocked out to inactivate the enzyme and avoid the degradation of the product, and when the L-glutamic acid decarboxylase expression element is integrated into a bacillus subtilis genome, a proper site needs to be selected.

Drawings

FIG. 1 shows the arrangement of the integrated expression cassette of glutamate decarboxylase on chromosome according to the present invention.

FIG. 2 shows the HP L C assay results of L-sodium glutamate and gamma-aminobutyric acid.

Detailed Description

The present invention will be further described with reference to the following specific examples.

It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention. The plasmid extraction, genome extraction, PCR reagent and the like used were commercial products, and the specific operations were performed according to the instructions. Other non-indicated experimental manipulations were performed according to the protocol of molecular cloning, A third edition of the Experimental Manual (America J. SammBruk Huangpetang).

The experimental operation of Bacillus subtilis and the principle and method of pMAD gene knockout are disclosed in Maryvonne array et al, New vector for effective annular replacement in naturralynontransformable, low-GC-content, gram-positive bacteria, APP L IED ANDENVIRONMENTA L MICROBIO L OGY, Nov.2004, p.6887-6891.

Bacillus subtilis electrotransformation reference: meddeb Mouelhi F et al, Hightransformation efficiency of Bacillus subtilis with integrated DNA using glycine betaine as osmoprotectants, Anal biochem.2012 May 15; 424(2): 127-9.

The invention discloses a construction method of a gene engineering bacterium for producing gamma-aminobutyric acid, which takes bacillus subtilis as an example, selects a bacillus subtilis 168 strain, and comprises the following steps:

(1) the galdB gene from colibacillus is first cloned onto Bacillus subtilis expression vector pHT 01.

(2) Three pairs of primers are designed, the upstream 1000bp segment of the gabT, the galdB gene and promoter segment and the downstream 1000bp segment of the gabT are amplified respectively, and then the three segments are fused together through overlap-PCR.

(3) Cloning the fused large fragment to a knockout vector pMAD, and then transforming the large fragment into bacillus subtilis;

(4) through a series of different culture operations, the traceless integration of an expression element to a gabT site of the bacillus subtilis is completed, and the integration expression and the inactivation of the gabT are simultaneously realized, so that the bacillus subtilis with high expression of L-glutamic acid decarboxylase can be obtained.

See the examples below for specific experimental procedures.

Example 1 construction of 1L-glutamic acid decarboxylase Bacillus subtilis expression vector pHT01-gadB

1. According to the GenBank No of the gene sequence of the escherichia coli galdB: m84025.1 primers were designed, F-gadB-BglII: CAT (catalytic activity assay)AGATCTATGGATAAGAAGCAAGTAAC (shown in SEQ ID NO. 1) and R-gadB-XbaI: CGATCTAGATCAGGTAGCTTTAAAGCTGTTC (shown in SEQ ID NO. 2), the primer has BglII and XbaI sites added at both ends;

2. using total DNA of Escherichia coli DH5 α strain as template, and performing PCR amplification with the above primer (shown in SEQ ID NO. 1-2) to obtain galdB gene fragment, wherein the reaction system comprises template 1 μ L DNA, 1 μ L dNTP (10 mmol/L), and 2 μmol/L MgCl₂0.5. mu. mol/L primers, 5. mu. L10 × PCR buffer, 2.5U KOD DNA polymerase (TOYOBO Co.) the PCR reaction conditions include pre-denaturation at 94 ℃ for 4min, denaturation at 94 ℃ for 30s, annealing at 53 ℃ for 30s,extension for 2min at 68 ℃ for 30 cycles; 72 ℃ for 10 min. The amplified fragment was subjected to 1.0% agarose gel electrophoresis, and a 1.4kb DNA band was recovered.

3. The amplified galdB DNA fragment is subjected to double digestion by Bgl II and XbaI, the digestion system comprises DNA 43 mu L, buffer R5 mu L, Bgl II and XbaI each 1 mu L, the temperature is kept at 37 ℃ for 3 hours, and the fragment is subjected to electrophoresis detection and recovery for later use.

4. Coli containing pHT01 plasmid was cultured and plasmid was extracted, the extraction method was performed according to the kit instructions. The plasmid is cut by BamHI and XbaI, detected by electrophoresis and recovered for later use.

5. The ligation of the galB and vector DNA fragments was carried out by using T4 ligase, which was carried out by ligating galB 7.5. mu. L01 vector 1.5. mu. L, buffer 1. mu. L, and T4 ligase 1. mu. L, incubating overnight at 16 ℃ and transforming the ligation product into E.coli host strain DH5 α by heat shock method, and plating it on L B solid medium containing 1% peptone, 0.5% yeast extract, 1% sodium chloride and 1.5% agaropectin.

6, L B plate is cultured at 37 ℃ until a transformant grows out, a single colony is selected and is subjected to colony PCR verification, PCR primers are designed according to pHT01 plasmid sequences and are respectively F-pHT 01-SEQ: TTATAAGAATTGTGGAATTG (shown in SEQ ID NO. 3) and R-pHT 01-SEQ: ATCTCCATGGACGCGTGACG (shown in SEQ ID NO. 4), and the colony which can amplify a band of about 1.5kb is a positive clone.

7. The single colony of positive clone is picked up, the plasmid is extracted after the culture, and the primer (shown in SEQ ID NO.3 and 4) is used for sequencing verification, the sequence is the correct L-glutamate decarboxylase expression vector which is expected to be, and the vector is named as pHT01-gadB in the invention.

Example 2 construction of integration knockout vectors

1. Based on the genome (Genbank No. NC-000964) sequence of Bacillus subtilis strain 168, primers were designed: the upstream primer F-gabTup-BamHI: GCGGGATCCATGACATTTTGAAAACGGTCGAGG (shown in SEQ ID NO. 5) and a downstream primer R-01 gabTup: GATTATGTTACAATAGCTGGTACCGTGAATATCCCCCTGTCGGTA (shown in SEQ ID NO. 6). The genomic DNA of Bacillus subtilis 168 strain is used as a template, and the upstream 1000bp fragment of the gabT gene cluster is obtained by PCR amplification, wherein the PCR conditions are the same as those of the amplification of the gadB gene fragment in example 1.

2. Primers were designed based on the pHT01-gadB sequence of the vector constructed in example 1, and the upstream primer F-gabTup 01: TACCGACAGGGGGATATTCACGGTACCAGCTATTGTAACATAATC (shown in SEQ ID NO. 7) and a downstream primer F-01gabTdn: GTCACGCGTCCATGGAGATCTTTCATTGGAAAGAAAATGGCCG (shown in SEQ ID NO. 8). Using pHT01-gadB as a template, a DNA fragment containing a gadB expression cassette (including a promoter and a coding region) was obtained by PCR under the same conditions as those for the gadB gene fragment in example 1.

3. Based on the genome (Genbank No. NC-000964) sequence of Bacillus subtilis strain 168, primers were designed: an upstream primer R-gabTdn01: CGGCCATTTTCTTTCCAATGAAAGATCTCCATGGACGCGTGAC (shown as SEQ ID NO. 9) and a downstream primer R-gabTdn-XhoI: TATCTCGAGAAGCCTCGTTTGTTGATAATC (shown in SEQ ID NO. 10). The downstream 1000bp fragment of the gabT gene is obtained by PCR amplification by using the genome DNA of the bacillus subtilis 168 strain as a template, and the PCR conditions are the same as those of the amplification of the gadB gene fragment in the example 1.

4. Mu.l of each of the three PCR products was purified and used as a template for overlap PCR amplification with primers F-gabTup-BamHI (shown in SEQ ID NO. 5) and R-gabTdn-XhoI (shown in SEQ ID NO. 10) for 5min, and the other conditions were the same as those for amplification of the gadB gene fragment in example 1. Obtaining DNA fragments of 1000bp respectively upstream and downstream of the gabT gene and containing a galdB expression frame, wherein the coding region of the gabT is deleted in the middle of the whole fragment.

5. Purifying the fragments, inserting the fragments into a vector pMAD by using a conventional molecular cloning technology to obtain an integrated vector, wherein the integrated vector is named as pMAD-delta gabT:: gadB.

EXAMPLE 3L integration of glutamate decarboxylase into the Bacillus subtilis genome

1. The plasmid pMAD- Δ gabT was transformed into Bacillus subtilis 168 strain, spread on X-gal (5-bromo-4-chloro-3-indole- β -D-galactoside) containing 50 μ g/m L and erythromycin plates, and incubated overnight at 30 degrees;

2. selecting blue-appearing transformants, culturing overnight at 30 ℃, coating a plate containing X-gal and erythromycin, and culturing overnight at 42 ℃;

3. selecting blue single colony, incubating in L B culture medium at 42 deg.C for 3 hr, spreading X-gal-containing non-resistant L B plate, and culturing at 42 deg.C overnight;

4. single colonies showing white spots are selected to be cultured in erythromycin and a nonreactive L B culture medium overnight respectively, single colonies without erythromycin resistance are selected to be subjected to colony PCR verification, F-gabTup-BamHI (shown in SEQ ID NO. 5) and R-gabTdn-XhoI (shown in SEQ ID NO. 10) are selected as primers, colonies with the size of 3.7kb can be amplified, namely, colonies with the size of 3.7kb are positive colonies Bs 168/delta gabT in which a gadB expression box is integrated into a genome and a gabT gene is inactivated at the same time, and a diagram 1 shows an arrangement structure of a glutamic acid decarboxylase integration expression box on a chromosome, wherein the bacterium is named as Bs 168-delta gabT in the invention.

Example 4 Bs168- Δ gabT fermentation of gadB engineering bacteria

1. Seed and fermentation medium:

the seed culture medium is L B culture medium (composed of peptone 10 g/L, yeast powder 5 g/L, and sodium chloride 10 g/L).

The fermentation medium is TB medium comprising peptone 12 g/L, yeast powder 24 g/L, glycerol 4 g/L, and phosphate buffer KH₂PO₄At a concentration of 17mM, K₂HPO₄The concentration was 72 mM. Mixing the three materials in proportion, sterilizing with high pressure steam, mixing with phosphate buffer solution sterilized with high pressure steam, mixing at a ratio of 10: 1, mixing the components.

2. And (3) fermentation process:

firstly culturing a seed culture medium overnight, transferring the seed culture medium to a fermentation culture medium according to the inoculation amount of 2-5%, aerobically culturing at 33-37 ℃, centrifugally collecting thalli until fermentation is finished, and measuring enzyme activity or carrying out biological catalysis.

Activity determination of 3, L-glutamic acid decarboxylase

The reaction system was added with each of 50mM disodium hydrogen phosphate-citric acid buffer solution of pH 4.2, 10 g/L wet cells, 0.2mM pyridoxal phosphate (P L P), 0.5M sodium glutamate, 10M L transformation system, 30 ℃, 200r/min shaking, 30 minutes later boiling water bath 10min, reaction was terminated, supernatant was collected by centrifugation, filtered, and then subjected to high performance liquid chromatography (HP L C) for detection (wherein, the detection process is shown in FIG. 2).

The enzyme activity unit is defined as that the enzyme quantity required for catalyzing a substrate to generate 1 mu mo L gamma-aminobutyric acid per minute in a reaction solution is 1 activity unit (U).

HP L C assay conditions:

1) the mobile phase is prepared by adding water to 1000m L and adjusting pH to 7.3 in a sodium acetate buffer (2.72 g of sodium acetate and 0.2m L of triethylamine) as a mobile phase A and acetonitrile as a mobile phase B, wherein the ratio of the two is 80% to 20%.

2) The preparation of derivatization reagent comprises weighing 20mg of ortho-phthalaldehyde (OPA), adding 20 mu L of mercaptoethanol and 5m L of acetonitrile, and mixing uniformly to obtain the OPA derivatization reagent.

3) Boric acid buffer 24.7g of boric acid was weighed, 1000m L of water was added, and the pH was adjusted to 10.4.

4) And (3) performing derivatization reaction, namely sucking 80 mu L boric acid buffer solution to 40 mu L derivatization reagent and 20 mu L sample, and reacting at room temperature for 5min after uniformly mixing.

5) And (2) GABA determination, namely, after the derivatization is finished, feeding a sample to determine the GABA content, and determining the GABA content of the sample by adopting an Agilent ZORBAX eclipseXDB-C18 column (4.6 × 250mm) with the flow rate of 1m L/min, the detection wavelength of 338nm and the column temperature of 40 ℃ by taking the GABA concentration as a horizontal coordinate and the peak area as a vertical coordinate.

Through detection, after the TB culture medium is fermented for 24 hours, the L-glutamic acid decarboxylase activity in each gram of wet thalli can reach 136U.

EXAMPLE 5 biocatalytic production of gamma-aminobutyric acid

Respectively selecting original bacillus subtilis 168 and modified genetically engineered bacteria for fermentation, and utilizing the thalli obtained by the fermentation to catalytically produce gamma-aminobutyric acid, adding various substances into a conversion reactor until the final concentration is as follows, namely 30 g/L of wet thalli, 0.2mM pyridoxal phosphate (P L P), adding sterile water to 1L, controlling the temperature to be 30 ℃, stirring the wet thalli for 150r/min, gradually adding L-glutamic acid powder, gradually reducing the pH to 4.2, gradually increasing the pH along with the reaction until the pH reaches 5.0, and then adding L-glutamic acid powder again, controlling the pH of the reaction system to be in a range of 4.2-5.0 by the method for adding L-glutamic acid until the reaction system does not rise any more, and finishing the reaction.

Centrifuging to obtain supernatant, filtering, detecting by HP L C, generating 3.5 g/L g of gamma-aminobutyric acid by the original bacteria, and generating 121 g/L g of gamma-aminobutyric acid by the modified engineering bacteria.

The results show that the bacillus subtilis constructed by the genetic technology has the capacity of expressing high-activity L-glutamic acid decarboxylase, and the thalli obtained by fermentation can be converted to generate gamma-aminobutyric acid.

Claims (8)

1. A method for constructing engineering bacteria for producing gamma-aminobutyric acid is characterized in that the engineering bacteria are obtained by integrating a gene for coding L-glutamate decarboxylase and a promoter thereof into a chromosome of host bacteria bacillus subtilis, wherein the integrated site is a gamma-aminobutyric acid transaminase gene, and the gamma-aminobutyric acid transaminase gene is inactivated after integration.

2. The method according to claim 1, wherein the integration of the gene encoding L-glutamate decarboxylase into the chromosome of the host bacterium is carried out using a pMAD integration vector.

3. The method according to claim 1 or 2, wherein the promoter is a grac promoter derived from pHT01 expression vector.

4. The method according to claim 3, wherein the gene encoding L-glutamic acid decarboxylase is derived from a microorganism.

5. An engineered bacterium producing gamma-aminobutyric acid constructed by the construction method according to any one of claims 1 to 4.

6. The use of the engineered bacterium of claim 5 in the production of gamma-aminobutyric acid.

7. The use according to claim 6, wherein the engineered bacteria are used as a source of enzymes for the production of gamma-aminobutyric acid.

8. Use according to claim 6 or 7, wherein the process for the production of γ -aminobutyric acid is:

1) activating and culturing engineering bacteria seeds, gradually amplifying the cultured seeds, and performing aerobic culture in a fermentation tank at the culture temperature of 30 ℃, controlling the pH value to be 6.8-7.0, dissolving more than 20% of oxygen, and fermenting for 24-30 hours;

2) centrifuging or membrane concentrating to obtain thallus, diluting with water, adding pyridoxal phosphate, gradually adding L-glutamic acid, and controlling pH of the reaction solution to 4.0-5.0 until pH of the reaction system does not rise.

Images