CN102367432B - Construction method and application of high-yield gamma-aminobutyric acid recombinant escherichia coli/pET-28a-1pgad - Google Patents
Construction method and application of high-yield gamma-aminobutyric acid recombinant escherichia coli/pET-28a-1pgad Download PDFInfo
- Publication number
- CN102367432B CN102367432B CN201110289796.3A CN201110289796A CN102367432B CN 102367432 B CN102367432 B CN 102367432B CN 201110289796 A CN201110289796 A CN 201110289796A CN 102367432 B CN102367432 B CN 102367432B
- Authority
- CN
- China
- Prior art keywords
- lpgad
- pet
- enzyme
- gad
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to a construction method and an application of high-yield gamma-aminobutyric acid recombinant escherichia coli/pET-28a-1pgad, in particular to a genetic engineering bacterium construction method, recombinant enzyme enzymology property study and an application to the conversion of L-glutamic acid for producing gamma amino butyric acid (GABA), which belongs to the technical field of biology in the fermentation engineering. Firstly, lactobacillus plantarum GB 01-21 glutamic acid decarboxylase (GAD) genes are obtained through polymerase chain reaction (PCR) amplification, recombinant plasmids pET-28a-1pgad are constructed, in addition, the successful expression is realized in E.coli BL21(ED3), secondly, Ni column affiliation chromatography purification is adopted on crude enzyme liquid for obtaining recombinant GAD, in addition, the enzymology property of the recombinant GAD is primarily studied for guiding the optimization of conversion conditions, finally, conversion experiments are carried out on a 5L fermentation tank, the GABA accumulation concentration can reach 204.5g/L, the mol conversion rate is 97.92 percent, and good foundation is made on the further industrial application.
Description
Technical field
The construction process of highly producing gamma-aminobutyric acid recombination bacillus coli/pET-28a-lpgad and an application thereof, belong to biological technical field in fermentation engineering.Be specifically related to a kind of method, recombinase zymologic property research and application on conversion Pidolidone product γ-aminobutyric acid thereof that builds genetically engineered bacteria.
Background technology
γ-aminobutyric acid (be called for short GABA) be a kind of in central nervous system effective inhibitory neurotransmitter, there are many important physiological functions, as hypotensive, keep psychosis, hypermnesis, adjusting hormone secretion, promote reproduction, protect the liver sharp kidney etc.In recent years, the research of GABA and application have been subject to paying close attention to widely.At present, main chemical synthesis and the microbial method of adopting prepared GABA both at home and abroad, and chemical synthesis reaction conditions is violent, seriously polluted; Microbe fermentation method mild condition, safety, cost are lower, but last handling process complexity and production cycle are long; The synthetic GABA of resting cell method can improve substrate conversion efficiency and product purity, and has the postprocessing working procedures of saving, shortening production cycle and reduce the advantages such as environmental pollution, is more and more subject to domestic and international investigator's extensive attention.
Open day of seminar of the present invention patent " a strain Efficient Conversion Pidolidone is the seed selection of γ-aminobutyric acid milk-acid bacteria " publication number: 101928679A: 2010.12.29, this patent discloses take plant lactobacillus (LP-GB 01-21) as producing bacterial strain, 5L fermentor tank level, in pH5.0 acetic acid-sodium acetate buffer, carry out resting cell, final GABA concentration reaches 132g/L, molar yield is 94.3%, output is apparently higher than other similar bacterial strains, but because plant lactobacillus is amphimicrobe, the more difficult control of culture condition, it is comparatively remarkable that the production efficiency of GABA is affected by culture condition, meanwhile, in plant lactobacillus, the expression amount of GAD is subject to the control of bacterial metabolism state, and expression amount is limited, and resting cell efficiency still awaits improving.Given this, this research is intended by building GAD high expression level type recombination bacillus coli, by Escherichia coli Growth rapidly, be easy to high-density culture and GAD express can artificial regulatory advantage carry out the extensive and high efficiency production of GABA.In addition, GAD is the rate-limiting enzyme that biocatalysis Pidolidone decarboxylic reaction generates γ-aminobutyric acid, by the zymologic property to this enzyme, study, it is the relation of thermostability, pH stability and temperature, pH and the enzymic activity of enzyme, the impact of several metal ion species on enzyme, the conditions suitable of determining this enzyme effect instructs resting cell method to synthesize GABA, and provides reference frame for preparation of industrialization GABA.
Summary of the invention
The object of the present invention is to provide: the construction process of a kind of high yield GABA recombination bacillus coli/pET-28a-lpgad, and restructuring L-Glutamic decarboxylase (GAD) zymologic property is studied, according to the result of study of zymologic property, determined optimum conversion condition, the industrialization that is γ-aminobutyric acid for microbial transformation Pidolidone provides useful guidance.
Technical scheme of the present invention: extracting total Lactobacillus plantarum karyomit(e) is template, the plant lactobacillus glutamic acid decarboxylase gene group primers of announcing according to GeneBank is as follows:
P1:5 '-GAC
gGATCCaTGGACCAGAAGCTGTTAAC-3 '; (underscore is BamH I restriction enzyme site)
P2:5 ' GGC
gCGGCCGCtCAGGTGTGTT TAAAGCTGTT-3 ' (underscore is Not I restriction enzyme site) carries out pcr amplification, and pcr amplification condition is: 94 ℃, and 5min denaturation; 94 ℃ of 50s, 57 ℃ of 1min 30s, 72 ℃ of 2min, 35 circulations; 72 ℃ are extended 10min.Gained fragment is connected with cloning vector pMDl8-T after glue reclaims, and Transformed E .coli JMl09, through amicillin resistance plate screening, picking positive transformant.Extraction plasmid enzyme restriction is identified, by recombinant plasmid called after T-Lpgad, adopt same restrictions restriction endonuclease respectively T-lpgad and pET-28a (+) to be carried out to double digestion, glue reclaims lpgad fragment, it is mixed with linearized vector pET-28a (+), the connection of spending the night under the effect of T4 ligase enzyme, transform again intestinal bacteria E.coli BL21 (DE3) competent cell, kalamycin resistance screens positive bacterium colony, extract plasmid, carry out double digestion checking, will meet positive transformant preservation in-80 ℃ of refrigerators of expected results.
The bacterial classification of getting frozen pipe preservation is seeded in the LB substratum containing kantlex (final concentration is 50 μ g/mL), 37 ℃ of shaking culture are spent the night, transfer next day in LB substratum, IPTG abduction delivering, crude enzyme liquid adopts colorimetry to carry out enzyme activity determination, an enzyme activity unit (U) is defined as per minute under condition determination and produces the required enzyme amount of 1 μ mol GABA, and crude enzyme liquid protein content adopts Bradford method to measure, and take BSA as standard protein.Crude enzyme liquid obtains through Ni-NTA purifying the GAD that recombinates, and its zymologic property is carried out to preliminary study.
By the preliminary study to restructuring L-Glutamic decarboxylase GAD zymologic property, its optimum temperature, optimal pH and species of metal ion and the concentration with stronger promoter action have been determined, according to the result of study of zymologic property, resting cell condition is optimized, 5L fermentor tank level, transforms and produces GABA experiment recombinant bacterium.
Recombinant bacterium shake-flask seed substratum (g/L): glucose 1.0, peptone 3.0, corn steep liquor 1.5, NaCl 0.3, K
2hPO
40.1, MgSO
47H
2o 0.05.Sterilizing 10min at 6.5～7.0,121 ℃ of pH.
Recombinant bacterium fermention medium (g/L): glucose 5.0, peptone 10, corn steep liquor 7.5, NaCl 0.5, K
2hPO
40.1, MgSO
47H
2o 0.05, Pidolidone 1.0, vitamin H 2 * 10
-5.Sterilizing 10min at 6.5～7.0,121 ℃ of pH.
Beneficial effect of the present invention: seminar of the present invention is in earlier stage by screening, a mutagenic obtained lactobacillus plantarum, this bacterium has higher L-Glutamic decarboxylase enzyme and lives, but because plant lactobacillus is amphimicrobe, the more difficult control of culture condition, meanwhile, in plant lactobacillus, the expression amount of GAD is subject to the control of bacterial metabolism state, expression amount is limited, the GAD enzyme gene that this bacterium has been cloned in this experiment, realized its heterogenous expression in colibacillus, and expression amount is high.Utilize the poly on pET28a histidine-tagged, crude enzyme liquid is crossed ni-sepharose purification, obtain purer recombinase GAD, and the zymologic property of this enzyme has been carried out to preliminary study, determined the impact of optimal pH, optimum temperuture and its effect of different metal ion pair of this enzyme effect.For improvement resting cell technique provides reliable theoretical foundation.
According to the result of study of zymologic property, resting cell condition is optimized, the conversion condition after optimization is: pH4.8 acetic acid-sodium acetate buffer, 2.5mmol/L Ca
2+, 3.5mmol/L Mg
2+, 37 ℃ of invert points.Under conversion condition after optimization, charging capacity with 50g/L is carried out fed batch, transform 24h, conversion fluid centrifuging and taking supernatant, add 15% trichoroacetic acid(TCA) termination reaction, after getting 1ml and suitably diluting, it is 204.5g/L that automatic analyzer for amino acids records product GABA concentration in conversion fluid, and transformation efficiency is 97.92%.
Product purity is high, and transformation efficiency is high, and the transformation period is short, and technology is portable strong, as long as general fermentation plant (as microbiotic, VITAMIN, amino acids production workshop) can be produced, does not need to purchase specific installation and instrument, is easy to apply.
Accompanying drawing explanation
The structure of Fig. 1 recombinant plasmid pET-28a-lpgad;
The enzyme of Fig. 2 recombinant plasmid pET-28a-lpgad is cut checking Lane1 λ HindIII DNA marker; Lane2pET-28a-lpgad/BamHI single endonuclease digestion; Lane3 pET-28a-lpgad/BamHI+NotI double digestion; Lane4 DS2000 DNA marker;
The recombinate expression Lane1 Supematant of E.coli Bi21 of GAD of Fig. 3; Lane2 Supematant of E.coli B121with recombinant plasmid pET-28a (+)-lpgad; Lane3 Protein markers (kDa);
The recombinate Ni-NTA purifying Lane1 Protein markers (kDa) of GAD of Fig. 4; Lane2 Supematant of E.coliB121 with recombinant plasmid pET-28a (+)-lpgad; Lane3 Purified GAD;
Fig. 5 recombinate GAD optimal pH (A) and pH stability (B) thereof;
Fig. 6 recombinate GAD optimum temperuture (A) and thermostability (B) thereof;
Fig. 7 different metal ion and the EDTA impact (B) on restructuring GAD;
The different different concns Ca of Fig. 8
2+(A), Mg
2+(B) impact of GAD enzyme being lived;
The recombinate Lineweaver-Burk mapping of GAD of Fig. 9;
The content collection of illustrative plates of substrate and product in Figure 10 amino acid determining instrument mensuration BL21/pET-28a-lpgad 5L fermentor tank conversion fluid;
Embodiment
Embodiment 1: the structure of recombination bacillus coli BL21/pET-28a-lpgad
According to the lpgad gene order in the full genomic nucleic acid sequence 3254376bp of plant lactobacillus Lactobacillus plantarum subsp.plantarum ST-III (GI:308044682) in NCBI, the primer of design L-Glutamic decarboxylase encoding gene:
P1：GAC(GGATCC)ATGGACCAGAAGCTGTTAAC(BamH?I)
P2：GGC(GCGGCCGC)TCAGGTGTGTTTAAAGCTGTT(Not?I)
Extracting total Lactobacillus plantarum karyomit(e) is template, and pcr amplification obtains goal gene fragment, and pcr amplification condition is 94 ℃, 5min denaturation; 94 ℃ of 50s, 57 ℃ of 1min 30s, 72 ℃ of 2min, 35 circulations; 72 ℃ are extended 10min.Gained fragment is connected with cloning vector pMDl8-T after glue reclaims, and Transformed E .coli JMl09, through amicillin resistance plate screening, picking positive transformant.Extraction plasmid enzyme restriction is identified, by recombinant plasmid called after T-Lpgad.T-lpgad is carried out to double digestion with BamHI and Not I, glue reclaims lpgad fragment, it is mixed with the linearized vector pET-28a (+) that processes acquisition through identical double digestion, add T4 ligase enzyme, 16 ℃ of connections of spending the night, transform again intestinal bacteria E.coli BL21 (DE3) competent cell, kalamycin resistance screens positive bacterium colony, extract plasmid, carry out double digestion checking, as shown in Figure 2, the positive transformant that meets expected results is kept in the LB that contains 20% glycerine to freezing being stored in-80 ℃.
Embodiment 2: expression and the Ni-NTA purifying of restructuring L-Glutamic decarboxylase
The recon of getting frozen pipe preservation is seeded in the LB substratum containing kantlex (final concentration is 50 μ g/mL), 37 ℃ of shaking culture are spent the night, and next day, 37 ℃ were cultured to the about 0.6-0.8 of OD by 1% inoculum size switching, adding people IPTG is 0.5mmol/L to final concentration, 16 ℃ of abduction deliverings that spend the night.Bacterium liquid after IPTG induction is through ultrasonic disruption cell, and supernatant liquor SDS-PAGE analyzes, and the specific band that a molecular weight is about 53kDa detected, as shown in Figure 3.Supernatant liquor records than enzyme and lives as 8.53U/mg.
By the bacterium liquid of the abduction delivering that spends the night in 10000r/min, 4 ℃ of centrifugal 15min, collect thalline, with pH7.4PBS damping fluid suspension thalline, ultrasonic disruption cell, then through 0.45 μ m membrane filtration, select in expression vector pET-28a (+) and contain 6His-Tag encoding sequence, cross Ni-NTA purifying GAD.GAD after purifying is shown in Fig. 3 through SDS-PAGE analytical results, can find out and after purifying, obtain relatively single band, as shown in Figure 4, substantially can think and obtain relatively pure GAD zymoprotein.After purifying enzyme liquid than enzyme work, reach 32.45U/mg, be 3.8 times that crude enzyme liquid enzyme is lived before purifying, the rate of recovery reaches 53.32%.
Embodiment 3: restructuring L-Glutamic decarboxylase zymologic property preliminary study
1) optimal pH and pH stability: acetic acid-sodium-acetate reaction buffer of preparation pH3.6～6.0, enzyme liquid is mixed from the reaction solution of different pH respectively at 30 ℃, measure the enzyme of GAD in different pH reaction systems and live, investigate the impact of pH on enzymatic reaction.Again a certain amount of enzyme liquid is joined in the reaction buffer of above different pH, be incubated respectively 2h at 30 ℃, measure residual enzyme and live, investigate the stability of GAD under condition of different pH.
2) optimum temperuture and thermostability: adopt the reaction buffer of pH4.8, respectively at 20 ℃, 25 ℃, 30 ℃, 35 ℃, 37 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, measure enzyme at 70 ℃ and live, the impact of research temperature on enzyme reaction.Enzyme liquid is placed under above differing temps and is incubated 2h, 4h, 6h, 8h, 10h, measure residual enzyme and live, investigate the stability of GAD under differing temps.
3) impact that different metal ion and EDTA live on enzyme: adding respectively final concentration in reaction solution is the Ca of 1mmol/L
2+, Mg
2+, K
+, Fe
2+, Fe
3+, Cu
2+, Mn
2+, Zn2
+, Na
+, Ag
+, Al
3+, Li
2+and EDTA, measure GAD enzyme at 30 ℃ and live, with the reaction solution that do not add metal ion in contrast, the impact of its enzymatic reaction of research different metal ion pair.In addition, to thering is the metal ion of obvious activation, prepare different concentration and carry out gradient measuring.
4) mensuration of Km value and Vmax: the Pidolidone sodium substrate solution of preparation different concns, react at 30 ℃ with enzyme liquid respectively, adopt double-reciprocal plot method to determine Km and the Vmax value of GAD.
Zymologic property preliminary study shows, optimal pH is 4.8, better at pH3.6-5.2 scope internal stability, as shown in Figure 5; Optimum temperuture is 37 ℃, within the scope of 20 ℃-40 ℃, and insulation 10h, enzyme is lived still more than 85%, as shown in Figure 6 relatively; Mn
2+, Fe
2+, Fe
3+, Ag
+, Cu
2+all the vigor of plant lactobacillus GAD is had to larger restraining effect, Li
+, K
+, Na
+deng not obvious to activity influence, Ca
2+, Mg
2+this enzyme is had to stronger activation, as shown in Figure 7; As shown in Figure 8,2.5mmol/LCa
2+time activation the most obvious, relatively enzyme work reaches 154%, 3.5mmol/L Mg
2+activation to recombinase GAD is the strongest, and enzyme work reaches 131%; According to the relation of different concentration of substrate and enzymatic reaction, according to Michaelis-Menton equation, adopt double-reciprocal plot method, as shown in Figure 9, can obtain Km is 9.21mmol/L, Vmax is 7.58mmol/Lmin.
Embodiment 4: recombination bacillus coli transforms Pidolidone and produces GABA research
By the preliminary study to restructuring L-Glutamic decarboxylase GAD zymologic property, its optimum temperature, optimal pH and species of metal ion and the concentration with stronger promoter action have been determined, according to the result of study of zymologic property, resting cell condition is optimized, and the conversion condition after optimization is: pH4.8 acetic acid-sodium acetate buffer, 2.5mmol/L Ca
2+, 3.5mmol/LMg
2+, 37 ℃ of invert points.
The bacterial classification of slant preservation is seeded in 50ml (liquid amount is 10ml) LB substratum, in rotary shaking table, 37 ℃, 160r/min are cultivated 12h and are activated, take again in 5% inoculum size access 500ml shaking flask (liquid amount is 100ml) seed culture medium and cultivate thalline, by above-mentioned condition, cultivate 24h and obtain seed liquor, inoculum size by 10% is cultured seed liquor access 5L automatic fermenter (liquid amount is 3L), prior to 37 ℃, 250r/min, is cultured to OD
600be 0.6, then to add wherein lactose to final concentration be 1g/L, on-line Control pH6.8 stream adds glucose simultaneously, and 30 ℃, induction fermentation 14h to OD
600be 13.6.Cultured thalline is carried out to centrifugal collection, distilled water washing three times, with acetic acid-sodium acetate buffer suspension thalline, under conversion condition after optimization, charging capacity with 50g/L is carried out fed batch, early stage is because enzyme running water is flat higher, speed of reaction is very fast, feed intake and be spaced apart every 3h and feed intake once, carrying out along with reaction, enzyme is lived and is declined to some extent, speed of response is slack-off, after 12h, charging time interval extends to 6h, at rotating speed 250r/min, under the condition of air flow 1vvm, transform 24h, reaction finishes rear conversion fluid centrifuging and taking supernatant, add 15% trichoroacetic acid(TCA) termination reaction, getting 1ml carries out after suitably dilution automatic analyzer for amino acids to record product GABA concentration in conversion fluid is 204.5g/L, transformation efficiency is 97.92%, as shown in figure 10.
Claims (1)
1. the method that Efficient Conversion Pidolidone is γ-aminobutyric acid, described method is γ-aminobutyric acid for induction type recombination bacillus coli is transformed to Pidolidone by the method for fermenting;
Described induction type recombination bacillus coli contains pET-28a-lpgad plasmid, lpgad gene be by
P1:5 '-GAC
gGATCCaTGGACCAGAAGCTGTTAAC-3 ' and
P2:5 '-GGC
gCGGCCGCthe primer PCR amplification preserving number of TCAGGTGTGTTTAAAGCTGTT-3 ' is that the plant lactobacillus GB01-21 of CCTCC M209102 obtains;
PET-28a-lpgad plasmid construction method is as follows:
Lpgad gene obtained above is connected with cloning vector pMD18-T, obtains recombinant plasmid pMD18-T-lpgad; Adopt restriction enzyme BamH I and Not I respectively pMD18-T-lpgad and pET-28a (+) to be carried out to double digestion, obtain respectively lpgad fragment and linearized vector pET-28a (+); Lpgad fragment is connected with linearized vector pET-28a (+), obtains pET-28a-lpgad plasmid;
Described fermentation process is specific as follows:
(1) recombinant bacterium shake-flask seed substratum: glucose 1.0g/L, peptone 3.0g/L, corn steep liquor 1.5g/L, NaCl 0.3g/L, K
2hPO
40.1g/L, MgSO
47H
2o 0.05g/L, sterilizing 10min at pH6.5～7.0,121 ℃;
Recombinant bacterium fermention medium: glucose 5.0g/L, peptone 10g/L, corn steep liquor 7.5g/L, NaCl 0.5g/L, K
2hPO
40.1g/L, MgSO
47H
2o 0.05g/L, Pidolidone 1.0g/L, vitamin H 2 * 10
-5g/L, pH6.5～7.0, sterilizing 10min under 121 ℃ of conditions;
(2) culture condition: the bacterial classification of slant preservation is seeded in the LB substratum that 50mL, liquid amount are 10mL, in rotary shaking table, 37 ℃, 160r/min are cultivated 12h and are activated, take again in the seed culture medium that 5% inoculum size access 500mL shaking flask, liquid amount be 100mL and cultivate thalline, by above-mentioned condition, cultivate 24h and obtain seed liquor, inoculum size by 10% is 3L by cultured seed liquor access 5L automatic fermenter, liquid amount, prior to 37 ℃, 250r/min, is cultured to OD
600be 0.6, then to add wherein lactose to final concentration be 1g/L, on-line Control pH6.8 stream adds glucose simultaneously, 30 ℃ of induction fermentation 14h to OD
600be 13.6;
(3) 5L fermentor tank recombinant bacterium resting cell condition is: pH4.8 acetic acid-sodium acetate buffer, 2.5mmol/L Ca
2+, 3.5mmol/L Mg
2+, 37 ℃ of invert points, mixing speed 250r/min;
(4) under the conversion condition after optimization, charging capacity with 50g/L is carried out fed batch, early stage is because enzyme running water is flat higher, speed of reaction is very fast, feed intake and be spaced apart every 3h and feed intake once, carrying out along with reaction, enzyme is lived and is declined to some extent, speed of response is slack-off, after 12h, charging time interval extends to 6h, at mixing speed 250r/min, under the condition of air flow 1vvm, transform 24h, reaction finishes rear conversion fluid centrifuging and taking supernatant, add 15% trichoroacetic acid(TCA) termination reaction, after getting 1mL and suitably diluting, it is 204.5g/L that amino acid records product GABA concentration in conversion fluid in automatic minute, transformation efficiency is 97.92%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110289796.3A CN102367432B (en) | 2011-09-28 | 2011-09-28 | Construction method and application of high-yield gamma-aminobutyric acid recombinant escherichia coli/pET-28a-1pgad |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110289796.3A CN102367432B (en) | 2011-09-28 | 2011-09-28 | Construction method and application of high-yield gamma-aminobutyric acid recombinant escherichia coli/pET-28a-1pgad |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102367432A CN102367432A (en) | 2012-03-07 |
| CN102367432B true CN102367432B (en) | 2014-10-15 |
Family
ID=45760025
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110289796.3A Active CN102367432B (en) | 2011-09-28 | 2011-09-28 | Construction method and application of high-yield gamma-aminobutyric acid recombinant escherichia coli/pET-28a-1pgad |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102367432B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106566823A (en) * | 2015-10-10 | 2017-04-19 | 中国科学院天津工业生物技术研究所 | Cloning of novel glutamate decarboxylase gene and application thereof |
| CN108467860A (en) * | 2018-03-28 | 2018-08-31 | 江南大学 | A kind of method of highly producing gamma-aminobutyric acid |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102839135B (en) * | 2012-05-04 | 2014-12-03 | 江南大学 | Lactobacillus fermentum capable of producing gamma-aminobutyric acid with high yield and application thereof |
| CN103215198B (en) * | 2013-02-04 | 2016-04-20 | 江南大学 | Recombinant corynebacterium crematum is utilized to take glucose as the method for substrate one-step synthesis method γ-aminobutyric acid |
| CN104531652B (en) * | 2014-12-04 | 2017-09-15 | 江南大学 | One kind addition vitamin B6Improve method and the application of glutamic acid decarboxylase production of enzyme |
| CN104894043B (en) * | 2015-04-23 | 2020-08-07 | 苏州人本药业有限公司 | Engineering bacterium for producing gamma-aminobutyric acid and construction and application thereof |
| CN105238807A (en) * | 2015-11-23 | 2016-01-13 | 江南大学 | Construction of coenzyme efficient regeneration system and application thereof |
| CN105296456B (en) * | 2015-11-23 | 2018-08-07 | 江南大学 | A kind of stability-enhanced glutamic acid decarboxylase enzyme mutant of pH and its application |
| CN105255934B (en) * | 2015-11-23 | 2019-02-22 | 安徽华恒生物科技股份有限公司 | A kind of strategy of efficient coproduction butyrine and gluconic acid |
| CN106636238A (en) * | 2016-11-17 | 2017-05-10 | 江南大学 | Method for producing gamma-amino butyric acid through distillers' grains fermentation by microorganisms |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101928679A (en) * | 2009-09-22 | 2010-12-29 | 江南大学 | Breeding for efficiently converting L-glutamate into gamma-amino butyric acid lactobacillus |
-
2011
- 2011-09-28 CN CN201110289796.3A patent/CN102367432B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101928679A (en) * | 2009-09-22 | 2010-12-29 | 江南大学 | Breeding for efficiently converting L-glutamate into gamma-amino butyric acid lactobacillus |
Non-Patent Citations (1)
| Title |
|---|
| 范恩宇等.短乳杆菌Lactobacillus brevis CGMCC NO.1306 谷氨酸脱羧酶基因的克隆与表达.《第五届全国化工年会论文集》.2008,摘要、引言、1.1、1.4-1.5. * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106566823A (en) * | 2015-10-10 | 2017-04-19 | 中国科学院天津工业生物技术研究所 | Cloning of novel glutamate decarboxylase gene and application thereof |
| CN108467860A (en) * | 2018-03-28 | 2018-08-31 | 江南大学 | A kind of method of highly producing gamma-aminobutyric acid |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102367432A (en) | 2012-03-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102367432B (en) | Construction method and application of high-yield gamma-aminobutyric acid recombinant escherichia coli/pET-28a-1pgad | |
| CN102199581B (en) | Zearalenone toxin degradation enzyme and coding gene and application thereof | |
| CN103555608B (en) | Quininone reductase and application thereof in asymmetric synthesis of (R)-3-quinuclidinol | |
| CN103497911B (en) | Application of Chryseobacterium sp. and carbonyl reductase thereof in production of aprepitant chiral intermediate | |
| CN101663389A (en) | An amidase gene knock-out engineered strain for nitrile hydratase production, its construction and application | |
| CN103215244B (en) | Alkaline pectinase PelN, as well as encoded gene and application thereof | |
| CN104152505A (en) | Method for transforming and preparing 4-hydroxyl-L-isoleucine by using recombinant bacterial strains | |
| CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
| CN102994425A (en) | Genetic recombination escherichia coli and method for efficiently producing pullulanase | |
| CN101463358B (en) | Nitrile hydratase gene cluster and use thereof | |
| CN101691560B (en) | Colibacillus and method for performing soluble expression of transglutaminase proenzyme thereof | |
| CN101768581A (en) | Mutant enzyme L20A of L-arabinose isomerase with D-tagatose high-yield capability and mutation method thereof | |
| CN103484419A (en) | Glutamic acid decarboxylase recombinant bacterium and construction method and application thereof | |
| CN102816728A (en) | Construction of beta-1,4-endoxylanase engineering bacterium, and application of enzyme of beta-1,4-endoxylanase engineering bacterium | |
| CN113754726B (en) | Recombinant enzyme containing polypeptide tag and application thereof in synthesis of medicinal chemicals | |
| CN101407780B (en) | Method for preparing (R)-styrene glycol by changing coenzyme specificity and stereoselectivity via site-directed mutagenesis | |
| CN105462998B (en) | A kind of difunctional acid urease structural gene and its expression and application | |
| CN110923223B (en) | Novel nitrilase and application thereof | |
| CN114045241B (en) | Bacillus subtilis HKS018 and application thereof in production of beta-mannase | |
| CN101967494A (en) | Method for constructing high-yield polyglutamic acid engineering strain | |
| CN113897301B (en) | Production method and application of genetically engineered high-yield strain streptomyces diastatochromogenes and epsilon-polylysine | |
| CN104560800A (en) | Phenylpyruvate reductase and application thereof to asymmetric synthesis of (R)-phenyllactic acid | |
| CN110029081B (en) | Engineering bacterium for over-expressing carbon catabolite repression effect transcription inhibitor gene and construction method thereof | |
| CN109868253B (en) | Bacillus licheniformis engineering bacteria for inhibiting bacterial autolysis and construction method and application thereof | |
| CN101892228B (en) | Engineering bacteria with high tolerance to acrylamide and acrylonitrile for producing nitrile hydratase and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |