CN102367432A - Construction method and application of high-yield gamma-aminobutyric acid recombinant escherichia coli/pET-28a-1pgad - Google Patents
Construction method and application of high-yield gamma-aminobutyric acid recombinant escherichia coli/pET-28a-1pgad Download PDFInfo
- Publication number
- CN102367432A CN102367432A CN2011102897963A CN201110289796A CN102367432A CN 102367432 A CN102367432 A CN 102367432A CN 2011102897963 A CN2011102897963 A CN 2011102897963A CN 201110289796 A CN201110289796 A CN 201110289796A CN 102367432 A CN102367432 A CN 102367432A
- Authority
- CN
- China
- Prior art keywords
- enzyme
- lpgad
- pet
- condition
- gad
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to a construction method and an application of high-yield gamma-aminobutyric acid recombinant escherichia coli/pET-28a-1pgad, in particular to a genetic engineering bacterium construction method, recombinant enzyme enzymology property study and an application to the conversion of L-glutamic acid for producing gamma amino butyric acid (GABA), which belongs to the technical field of biology in the fermentation engineering. Firstly, lactobacillus plantarum GB 01-21 glutamic acid decarboxylase (GAD) genes are obtained through polymerase chain reaction (PCR) amplification, recombinant plasmids pET-28a-1pgad are constructed, in addition, the successful expression is realized in E.coli BL21(ED3), secondly, Ni column affiliation chromatography purification is adopted on crude enzyme liquid for obtaining recombinant GAD, in addition, the enzymology property of the recombinant GAD is primarily studied for guiding the optimization of conversion conditions, finally, conversion experiments are carried out on a 5L fermentation tank, the GABA accumulation concentration can reach 204.5g/L, the mol conversion rate is 97.92 percent, and good foundation is made on the further industrial application.
Description
Technical field
The construction process of a kind of highly producing gamma-aminobutyric acid recombination bacillus coli/pET-28a-lpgad and application thereof belong to biological technical field in the fermentation engineering.Be specifically related to a kind of method, recombinase zymologic property research and application on conversion L-L-glutamic acid product γ-An Jidingsuan thereof that makes up genetically engineered bacteria.
Background technology
γ-An Jidingsuan (be called for short GABA) be a kind of in cns effective inhibitory nerve mediator, have many important physical functions, as hypotensive, keep psychosis, hypermnesis, adjusting hormone secretion, promote reproduction, protect the liver sharp kidney etc.In recent years, the research of GABA and application have received widely and having paid close attention to.At present, main both at home and abroad employing chemical synthesis and microbial method prepare GABA, and the chemical synthesis reaction conditions is violent, and is seriously polluted; Microbe fermentation method mild condition, safety, cost are lower, but last handling process complicacy and production cycle are long; The synthetic GABA of full cell transformation method then can improve substrate conversion efficiency and product purity, and has advantages such as the postprocessing working procedures of saving, shortening production cycle and reduction environmental pollution, more and more receives domestic and international investigator's extensive attention.
Open day of seminar of the present invention patent " plant height is imitated and transformed L-L-glutamic acid is the seed selection of γ-An Jidingsuan milk-acid bacteria " publication number: 101928679A: 2010.12.29; It serves as to produce bacterial strain that this patent discloses with plant lactobacillus (LP-GB 01-21), and 5L fermentor tank level is carried out full cell transformation in pH5.0 acetate-sodium acetate buffer; Final GABA concentration reaches 132g/L; Molar yield is 94.3%, and output is apparently higher than other similar bacterial strains, but because plant lactobacillus is an amphimicrobe; The difficult control of culture condition, it is comparatively remarkable that the production efficiency of GABA is influenced by culture condition; Simultaneously, the expression amount of GAD receives the control of bacterial metabolism state in the plant lactobacillus, and expression amount is limited, and full cell transformation efficient still awaits improving.Given this, this research is intended through making up GAD high expression level type recombination bacillus coli, by the intestinal bacteria growth rapidly, be easy to high-density culture and GAD express can artificial regulatory advantage carry out the extensive and high efficiency production of GABA.In addition; GAD is the rate-limiting enzyme that biocatalysis L-L-glutamic acid decarboxylic reaction generates γ-An Jidingsuan; Zymologic property through to this enzyme is studied, i.e. the thermostability of enzyme, pH stability and temperature, pH and activity relationship, and several metal ion species are to the influence of enzyme; The conditions suitable of confirming this enzyme effect instructs full cell transformation method to synthesize GABA, and reference frame is provided for preparation of industrialization GABA.
Summary of the invention
The object of the present invention is to provide: the construction process of a kind of high yield GABA recombination bacillus coli/pET-28a-lpgad; And reorganization L-Glutamic decarboxylase (GAD) zymologic property studied; Confirmed optimum conversion condition according to the result of study of zymologic property, for microbial transformation L-L-glutamic acid is that the industriallization of γ-An Jidingsuan provides useful guide.
Technical scheme of the present invention: extracting total Lactobacillus plantarum karyomit(e) is template, following according to the plant lactobacillus glutamic acid decarboxylase gene group sequences Design primer that GeneBank announces:
P1:5 '-GAC
GGATCCATGGACCAGAAGCTGTTAAC-3 '; (underscore is a BamH I restriction enzyme site)
P2:5 ' GGC
GCGGCCGCTCAGGTGTGTT TAAAGCTGTT-3 ' (underscore is a Not I restriction enzyme site) carries out pcr amplification, and the pcr amplification condition is: 94 ℃, and the preparatory sex change of 5min; 94 ℃ of 50s, 57 ℃ of 1min 30s, 72 ℃ of 2min, 35 circulations; 72 ℃ are extended 10min.The gained fragment is connected with cloning vector pMDl8-T after glue reclaims, and Transformed E .coli JMl09 is through amicillin resistance plate screening, picking positive transformant.The extraction plasmid enzyme restriction is identified, with recombinant plasmid called after T-Lpgad, adopts same restrictions property restriction endonuclease respectively T-lpgad and pET-28a (+) to be carried out double digestion; Glue reclaims the lpgad fragment; It is mixed the connection of under the effect of T4 ligase enzyme, spending the night, transformed into escherichia coli E.coli BL21 (DE3) competent cell again with linearized vector pET-28a (+); Kalamycin resistance screens positive bacterium colony; Extract plasmid, carry out the double digestion checking, positive transformant preservation in-80 ℃ of refrigerators of accord with expectation result.
The bacterial classification inoculation of getting the frozen pipe preservation is to the LB substratum that contains kantlex (final concentration is 50 μ g/mL); 37 ℃ of shaking culture are spent the night, in the LB substratum of transferring next day, and the IPTG abduction delivering; Crude enzyme liquid adopts colourimetry to carry out enzyme activity determination; An enzyme activity unit (U) is defined as that PM produces the required enzyme amount of 1 μ mol GABA under condition determination, and the crude enzyme liquid protein contnt adopts the Bradford method to measure, and is standard protein with BSA.Crude enzyme liquid obtains the GAD that recombinates through the Ni-NTA purifying, and its zymologic property is carried out preliminary study.
Through preliminary study to reorganization L-Glutamic decarboxylase GAD zymologic property; Species of metal ion and the concentration having confirmed its optimum temperature, ph optimum and had strong promoter action; Result of study according to zymologic property; Full cell transformation condition is optimized, and 5L fermentor tank level transforms product GABA experiment to the reorganization bacterium.
Reorganization bacterium shake-flask seed substratum (g/L): glucose 1.0, peptone 3.0, steeping water 1.5, NaCl 0.3, K
2HPO
40.1, MgSO
47H
2O 0.05.At 6.5～7.0,121 ℃ of following sterilization 10min of pH.
Reorganization bacteria fermentation culture medium (g/L): glucose 5.0, peptone 10, steeping water 7.5, NaCl 0.5, K
2HPO
40.1, MgSO
47H
2O 0.05, L-L-glutamic acid 1.0, vitamin H 2 * 10
-56.5～7.0,121 ℃ of 10min that sterilize down of pH.
Beneficial effect of the present invention: seminar of the present invention is in earlier stage through screening, a mutagenic obtained lactobacillus plantarum, and this bacterium has higher L-Glutamic decarboxylase enzyme and lives, but because plant lactobacillus is an amphimicrobe; The difficult control of culture condition, simultaneously, the expression amount of GAD receives the control of bacterial metabolism state in the plant lactobacillus; Expression amount is limited; The GAD enzyme gene of this bacterium has been cloned in this experiment, has realized its heterogenous expression in colibacillus, and expression amount is high.Utilize the poly on the pET28a histidine-tagged; Crude enzyme liquid is crossed ni-sepharose purification; Obtain purer recombinase GAD, and the zymologic property of this enzyme has been carried out preliminary study, confirmed ph optimum, optimum temperuture, and the influence of its effect of different metal pair ion of this enzyme effect.For improveing full cell transformation technology reliable theoretical foundation is provided.
According to the result of study of zymologic property, full cell transformation condition is optimized, the conversion condition after the optimization is: pH4.8 acetate-sodium acetate buffer, 2.5mmol/L Ca
2+, 3.5mmol/L Mg
2+, 37 ℃ of invert points.Under the conversion condition after the optimization; Charging capacity with 50g/L is carried out fed batch, transforms 24h, conversion fluid centrifuging and taking supernatant; The trichoroacetic acid(TCA) termination reaction of adding 15%; After getting 1ml and suitably diluting, automatic analyzer for amino acids records that product GABA concentration is 204.5g/L in the conversion fluid, and transformation efficiency is 97.92%.
Product purity is high, and transformation efficiency is high, and the transformation period is short, and technology is portable strong, as long as general fermentation plant (like microbiotic, VITAMINs, amino acid production plant) can be produced, need not purchase specific installation and instrument, is easy to apply.
Description of drawings
The structure of Fig. 1 recombinant plasmid pET-28a-lpgad;
The enzyme of Fig. 2 recombinant plasmid pET-28a-lpgad is cut checking Lane1 λ HindIII DNA marker; The Lane2pET-28a-lpgad/BamHI single endonuclease digestion; Lane3 pET-28a-lpgad/BamHI+NotI double digestion; Lane4 DS2000 DNA marker;
The recombinate expression Lane1 Supematant of E.coli Bi21 of GAD of Fig. 3; Lane2 Supematant of E.coli B121with recombinant plasmid pET-28a (+)-lpgad; Lane3 Protein markers (kDa);
The recombinate Ni-NTA purifying Lane1 Protein markers (kDa) of GAD of Fig. 4; Lane2 Supematant of E.coliB121 with recombinant plasmid pET-28a (+)-lpgad; Lane3 Purified GAD;
Fig. 5 GAD ph optimum (A) and pH thereof stability (B) of recombinating;
Fig. 6 recombinate GAD optimum temperuture (A) and thermostability (B) thereof;
Fig. 7 different metal ion and EDTA are to the influence (B) of reorganization GAD;
The different different concns Ca of Fig. 8
2+(A), Mg
2+The influence of (B) the GAD enzyme being lived;
The recombinate Lineweaver-Burk mapping of GAD of Fig. 9;
The content collection of illustrative plates of substrate and product in Figure 10 amino acid determining instrument mensuration BL21/pET-28a-lpgad 5L fermentor tank conversion fluid;
Embodiment
Embodiment 1: the structure of recombination bacillus coli BL21/pET-28a-lpgad
According to the lpgad gene order among the full genomic nucleic acid sequence 3254376bp of plant lactobacillus Lactobacillus plantarum subsp.plantarum ST-III (GI:308044682) among the NCBI, the primer of design L-Glutamic decarboxylase encoding sox:
P1：GAC(GGATCC)ATGGACCAGAAGCTGTTAAC(BamH?I)
P2：GGC(GCGGCCGC)TCAGGTGTGTTTAAAGCTGTT(Not?I)
Extracting total Lactobacillus plantarum karyomit(e) is template, and pcr amplification obtains target gene fragment, and the pcr amplification condition is 94 ℃, the preparatory sex change of 5min; 94 ℃ of 50s, 57 ℃ of 1min 30s, 72 ℃ of 2min, 35 circulations; 72 ℃ are extended 10min.The gained fragment is connected with cloning vector pMDl8-T after glue reclaims, and Transformed E .coli JMl09 is through amicillin resistance plate screening, picking positive transformant.The extraction plasmid enzyme restriction is identified, with recombinant plasmid called after T-Lpgad.T-lpgad is carried out double digestion with BamHI and Not I, and glue reclaims the lpgad fragment, and it is mixed with the linearized vector pET-28a (+) that handles acquisition through identical double digestion; Add the T4 ligase enzyme, 16 ℃ of connections of spending the night, transformed into escherichia coli E.coli BL21 (DE3) competent cell again; Kalamycin resistance screens positive bacterium colony, extracts plasmid, carries out the double digestion checking; As shown in Figure 2, accord with expectation result's positive transformant is kept among the LB that contains 20% glycerine freezing being stored in-80 ℃.
Embodiment 2: the expression and the Ni-NTA purifying of reorganization L-Glutamic decarboxylase
The recon of getting the frozen pipe preservation is seeded in the LB substratum that contains kantlex (final concentration is 50 μ g/mL); 37 ℃ of shaking culture are spent the night, and next day, 37 ℃ were cultured to the about 0.6-0.8 of OD by the switching of 1% inoculum size; Adding people IPTG is 0.5mmol/L to final concentration, 16 ℃ of abduction deliverings that spend the night.Bacterium liquid after IPTG induces is through the ultrasonic disruption cell, and supernatant SDS-PAGE analyzes, and detects the specific band that a molecular weight is about 53kDa, and is as shown in Figure 3.Supernatant records and lives than enzyme is 8.53U/mg.
To spend the night the bacterium liquid of abduction delivering in 10000r/min, and 4 ℃ of centrifugal 15min collect thalline; With pH7.4PBS damping fluid suspension thalline, the ultrasonic disruption cell is then through 0.45 μ m membrane filtration; Select for use and contain the 6His-Tag encoding sequence among the expression vector pET-28a (+), cross Ni-NTA purifying GAD.GAD behind the purifying sees Fig. 3 through the SDS-PAGE analytical results, can find out through behind the purifying to obtain single relatively band, and is as shown in Figure 4, can think basically to have obtained purer GAD zymoprotein relatively.Behind the purifying enzyme liquid reach 32.45U/mg than enzyme work, be 3.8 times that the crude enzyme liquid enzyme is lived before the purifying, the recovery reaches 53.32%.
Embodiment 3: reorganization L-Glutamic decarboxylase zymologic property preliminary study
1) ph optimum and pH stability: the acetic acid-sodium-acetate reaction buffer of preparation pH3.6～6.0, enzyme liquid is mixed with the reaction solution of different pH respectively under 30 ℃, measure the enzyme of GAD in different pH reaction systems and live, investigate the influence of pH to enzymatic reaction.Again a certain amount of enzyme liquid is joined in the reaction buffer of above different pH, be incubated 2h respectively under 30 ℃, measure residual enzyme and live, investigate the stability of GAD under condition of different pH.
2) optimum temperuture and thermostability: adopt the reaction buffer of pH4.8, respectively at 20 ℃, 25 ℃, 30 ℃, 35 ℃, 37 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, to measure enzyme down for 70 ℃ and live, the research temperature is to the influence of enzyme reaction.Enzyme liquid placed be incubated 2h, 4h, 6h, 8h, 10h under the above differing temps, measure residual enzyme and live, investigate the stability of GAD under differing temps.
3) different metal ion and EDTA influence that enzyme is lived: in reaction solution, add the Ca that final concentration is 1mmol/L respectively
2+, Mg
2+, K
+, Fe
2+, Fe
3+, Cu
2+, Mn
2+, Zn2
+, Na
+, Ag
+, Al
3+, Li
2+And EDTA, measure down the GAD enzymes for 30 ℃ and live, with the reaction solution that do not add metals ion as contrast, the influence of its enzymatic reaction of research different metal pair ion.In addition, to having the metals ion of obvious activation, the preparation different concentration is carried out the gradient measuring.
4) mensuration of Km value and Vmax: the L-Sodium Glutamate substrate solution of preparation different concns, react down at 30 ℃ with enzyme liquid respectively, adopt the double-reciprocal plot method to confirm Km and the Vmax value of GAD.
The zymologic property preliminary study shows that ph optimum is 4.8, and is better, as shown in Figure 5 at pH3.6-5.2 scope internal stability; Optimum temperuture is 37 ℃, in 20 ℃ of-40 ℃ of scopes, and insulation 10h, enzyme is lived still more than 85% relatively, and is as shown in Figure 6; Mn
2+, Fe
2+, Fe
3+, Ag
+, Cu
2+All the vigor to plant lactobacillus GAD has bigger restraining effect, Li
+, K
+, Na
+Deng not obvious to activity influence, Ca
2+, Mg
2+This enzyme there is stronger activation, as shown in Figure 7; As shown in Figure 8,2.5mmol/LCa
2+The time activation the most obvious, relatively enzyme work reaches 154%, 3.5mmol/L Mg
2+Activation to recombinase GAD is the strongest, and enzyme work reaches 131%; According to the relation of different concentration of substrate and enzymatic reaction, according to Michaelis-Menton equation, adopt the double-reciprocal plot method, as shown in Figure 9, can obtain Km is 9.21mmol/L, Vmax is 7.58mmol/Lmin.
Embodiment 4: recombination bacillus coli transforms L-L-glutamic acid and produces GABA research
Through preliminary study to reorganization L-Glutamic decarboxylase GAD zymologic property; Species of metal ion and the concentration having confirmed its optimum temperature, ph optimum and had strong promoter action; Result of study according to zymologic property; Full cell transformation condition is optimized, and the conversion condition after the optimization is: pH4.8 acetate-sodium acetate buffer, 2.5mmol/L Ca
2+, 3.5mmol/LMg
2+, 37 ℃ of invert points.
With the bacterial classification inoculation of slant preservation to 50ml (liquid amount is 10ml) LB substratum; 37 ℃, 160r/min are cultivated 12h and are carried out activation in rotary shaking table; Inserting 500ml with 5% inoculum size again shakes in bottle (liquid amount is 100ml) seed culture medium and cultivates thalline; Cultivate 24h by above-mentioned condition and obtain seed liquor, the inoculum size by 10% is cultured seed liquid access 5L automatic fermenter (liquid amount is 3L), is cultured to OD prior to 37 ℃, 250r/min
600Being 0.6, is 1g/L to wherein adding lactose to final concentration again, and controlled on-line pH6.8 stream adds glucose simultaneously, 30 ℃, induces fermentation 14h to OD
600Be 13.6.Cultured thalline is carried out centrifugal collection, and distilled water washing three times is with acetate-sodium acetate buffer suspension thalline, under the conversion condition after the optimization; Charging capacity with 50g/L is carried out fed batch, and early stage, speed of reaction was very fast because enzyme running water is flat higher; Feeding intake is spaced apart every 3h and feeds intake once, and along with the carrying out of reaction, enzyme is lived and descended to some extent; Speed of response is slack-off, and behind the 12h, charging time extends to 6h at interval; Under the condition of rotating speed 250r/min, air flow 1vvm, transform 24h, reaction finishes back conversion fluid centrifuging and taking supernatant, adds 15% trichoroacetic acid(TCA) termination reaction; Get 1ml and suitably dilute the back automatic analyzer for amino acids and record that product GABA concentration is 204.5g/L in the conversion fluid, transformation efficiency is 97.92%, and is shown in figure 10.
Claims (5)
1. this patent makes up a plant height imitate to transform L-L-glutamic acid is inducement of gamma-aminobutyric acid type recombination bacillus coli; And high expression level L-Glutamic decarboxylase zymologic property studied and the bacterium that is applied to recombinate transforms the optimization of γ-An Jidingsuan condition; The L-Glutamic decarboxylase encoding sox lpgad with the active plant lactobacillus GB of higher L-Glutamic decarboxylase 01-21 (preserving number CCTCC M 209102) that it is characterized in that increasing first and obtained through mutagenesis screening repeatedly makes up highly producing gamma-aminobutyric acid recombination bacillus coli/pET-28a-lpgad.Product GABA concentration is 204.5g/L in the final reorganization bacterium conversion fluid, and transformation efficiency is 97.92%.
2. according to the construction process of the said highly producing gamma-aminobutyric acid recombination bacillus coli/pET-28a-lpgad of claim 1; It is characterized in that: with the full genome of plant lactobacillus GB 01-21 is template; Design a pair of primer PCR amplification glutamic acid decarboxylase gene lpgad, construction recombination plasmid pET-28a-lpgad.
Plant lactobacillus glutamic acid decarboxylase gene group sequences Design primer according to GeneBank announces is following:
P1:5 '-GAC
GGATCCATGGACCAGAAGCTGTTAAC-3 '; (underscore is a BamH I restriction enzyme site)
P2:5 '-GGC
GCGGCCGCIt is template that TCAGGTGTGTT TAAAGCTGTT-3 ' (underscore is a Not I restriction enzyme site) extracts plant lactobacillus GB 01-21 karyomit(e), carries out pcr amplification, and the pcr amplification condition is: 94 ℃, and the preparatory sex change of 5min; 94 ℃ of 50s, 57 ℃ of 1min 30s, 72 ℃ of 2min, 35 circulations; 72 ℃ are extended 10min.The gained fragment is connected with cloning vector pMDl8-T after glue reclaims, and Transformed E .coli JMl09 is through amicillin resistance plate screening, picking positive transformant.The extraction plasmid enzyme restriction is identified; With recombinant plasmid called after T-Lpgad; Adopt same restrictions property restriction endonuclease respectively T-lpgad and pET-28a (+) to be carried out double digestion, glue reclaims the lpgad fragment, and it is mixed with linearized vector pET-28a (+); The connection of under the effect of T4 ligase enzyme, spending the night, construction recombination plasmid pET-28a-lpgad.
3. according to claim 1, the gene expression product of this recombination bacillus coli obtains the reorganization L-Glutamic decarboxylase behind ni-sepharose purification, and size is 53kDa.
4. said with 3 according to claim 1, reorganization L-Glutamic decarboxylase zymologic property is characterised in that: ph optimum is 4.8, and is better at pH3.6-5.2 scope internal stability; Optimum temperuture is 37 ℃, in 20 ℃ of-40 ℃ of scopes, and insulation 10h, enzyme is lived still more than 85% relatively; 2.5mmol/L Ca
2+The time activation the most obvious, relatively enzyme work reaches 154%, 3.5mmol/L Mg
2+Activation to recombinase GAD is the strongest, and enzyme work reaches 131%; Km is 9.21mmol/L, and Vmax is 7.58mmol/L.
5. instructing the application of conversion condition on optimizing according to the said zymologic property of claim 1; It is characterized in that: according to the result of study of zymologic property; With temperature, the pH of transformation system be adjusted to respectively just when; And, confirm optimum conversion condition to wherein adding the metals ion that recombinase GAD is had promoter action.
(1) reorganization bacterium shake-flask seed substratum (g/L): glucose 1.0, peptone 3.0, steeping water 1.5, NaCl 0.3, K
2HPO
40.1, MgSO
47H
2O 0.05.At 6.5～7.0,121 ℃ of following sterilization 10min of pH.
Reorganization bacteria fermentation culture medium (g/L): glucose 5.0, peptone 10, steeping water 7.5, NaCl 0.5, K
2HPO
40.1, MgSO
47H
2O 0.05, L-L-glutamic acid 1.0, vitamin H 2 * 10
-56.5～7.0,121 ℃ of 10min that sterilize down of pH.
(2) culture condition: with the bacterial classification inoculation of slant preservation to 50ml (liquid amount is 10ml) LB substratum; 37 ℃, 160r/min are cultivated 12h and are carried out activation in rotary shaking table; Inserting 500ml with 5% inoculum size again shakes in bottle (liquid amount is 100ml) seed culture medium and cultivates thalline; Cultivate 24h by above-mentioned condition and obtain seed liquor, the inoculum size by 10% is cultured seed liquid access 5L automatic fermenter (liquid amount is 3L), is cultured to OD prior to 37 ℃, 250r/min
600Being 0.6, is 1g/L to wherein adding lactose to final concentration again, and controlled on-line pH6.8 stream adds glucose simultaneously, 30 ℃, induces fermentation 14h to OD
600Be 13.6.
(3) the full cell transformation condition of 5L fermentor tank reorganization bacterium is: pH4.8 acetate-sodium acetate buffer, 2.5mmol/L Ca
2+, 3.5mmol/L Mg
2+, 37 ℃ of invert points, 250r/min.
(4) under the conversion condition after the optimization, carry out fed batch with the charging capacity of 50g/L, early stage, speed of reaction was very fast because enzyme running water is flat higher; Feeding intake is spaced apart every 3h and feeds intake once, and along with the carrying out of reaction, enzyme is lived and descended to some extent; Speed of response is slack-off, and behind the 12h, charging time extends to 6h at interval; Under the condition of rotating speed 250r/min, air flow 1vvm, transform 24h, reaction finishes back conversion fluid centrifuging and taking supernatant, adds 15% trichoroacetic acid(TCA) termination reaction; After getting 1ml and suitably diluting, amino acid divides automatically and records that product GABA concentration is 204.5g/L in the conversion fluid, and transformation efficiency is 97.92%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110289796.3A CN102367432B (en) | 2011-09-28 | 2011-09-28 | Construction method and application of high-yield gamma-aminobutyric acid recombinant escherichia coli/pET-28a-1pgad |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110289796.3A CN102367432B (en) | 2011-09-28 | 2011-09-28 | Construction method and application of high-yield gamma-aminobutyric acid recombinant escherichia coli/pET-28a-1pgad |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102367432A true CN102367432A (en) | 2012-03-07 |
| CN102367432B CN102367432B (en) | 2014-10-15 |
Family
ID=45760025
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110289796.3A Active CN102367432B (en) | 2011-09-28 | 2011-09-28 | Construction method and application of high-yield gamma-aminobutyric acid recombinant escherichia coli/pET-28a-1pgad |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102367432B (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102839135A (en) * | 2012-05-04 | 2012-12-26 | 江南大学 | Lactobacillus fermentum capable of producing gamma-aminobutyric acid with high yield and application thereof |
| CN103215198A (en) * | 2013-02-04 | 2013-07-24 | 江南大学 | One-step method for synthesizing gamma-aminobutyric acid by using recombinant corynebacterium crenatum and with glucose as substrate |
| CN104531652A (en) * | 2014-12-04 | 2015-04-22 | 江南大学 | Method for adding vitamin B6 to improve yield of glutamate decarboxylase, and application thereof |
| CN104894043A (en) * | 2015-04-23 | 2015-09-09 | 南京本贝德生物科技有限公司 | Engineering bacteria for producing gamma-aminobutyric acid and construction method and application thereof |
| CN105238807A (en) * | 2015-11-23 | 2016-01-13 | 江南大学 | Construction of coenzyme efficient regeneration system and application thereof |
| CN105255934A (en) * | 2015-11-23 | 2016-01-20 | 江南大学 | Strategy for efficiently coproducing alpha-aminobutyric acid and gluconic acid |
| CN105296456A (en) * | 2015-11-23 | 2016-02-03 | 江南大学 | Glutamic acid decarboxylase mutant with enhanced pH stability and application thereof |
| CN106636238A (en) * | 2016-11-17 | 2017-05-10 | 江南大学 | Method for producing gamma-amino butyric acid through distillers' grains fermentation by microorganisms |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106566823B (en) * | 2015-10-10 | 2021-04-30 | 中国科学院天津工业生物技术研究所 | Cloning and application of glutamate decarboxylase gene |
| CN108467860B (en) * | 2018-03-28 | 2020-12-29 | 江南大学 | Method for high yield of gamma-aminobutyric acid |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101928679A (en) * | 2009-09-22 | 2010-12-29 | 江南大学 | Breeding for efficiently converting L-glutamate into gamma-amino butyric acid lactobacillus |
-
2011
- 2011-09-28 CN CN201110289796.3A patent/CN102367432B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101928679A (en) * | 2009-09-22 | 2010-12-29 | 江南大学 | Breeding for efficiently converting L-glutamate into gamma-amino butyric acid lactobacillus |
Non-Patent Citations (1)
| Title |
|---|
| 范恩宇等: "《第五届全国化工年会论文集》", 1 October 2008, article "短乳杆菌Lactobacillus brevis CGMCC NO.1306 谷氨酸脱羧酶基因的克隆与表达", pages: 1.1 - 1.4-1.5 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102839135A (en) * | 2012-05-04 | 2012-12-26 | 江南大学 | Lactobacillus fermentum capable of producing gamma-aminobutyric acid with high yield and application thereof |
| CN103215198A (en) * | 2013-02-04 | 2013-07-24 | 江南大学 | One-step method for synthesizing gamma-aminobutyric acid by using recombinant corynebacterium crenatum and with glucose as substrate |
| CN103215198B (en) * | 2013-02-04 | 2016-04-20 | 江南大学 | Recombinant corynebacterium crematum is utilized to take glucose as the method for substrate one-step synthesis method γ-aminobutyric acid |
| CN104531652A (en) * | 2014-12-04 | 2015-04-22 | 江南大学 | Method for adding vitamin B6 to improve yield of glutamate decarboxylase, and application thereof |
| CN104894043A (en) * | 2015-04-23 | 2015-09-09 | 南京本贝德生物科技有限公司 | Engineering bacteria for producing gamma-aminobutyric acid and construction method and application thereof |
| CN105238807A (en) * | 2015-11-23 | 2016-01-13 | 江南大学 | Construction of coenzyme efficient regeneration system and application thereof |
| CN105255934A (en) * | 2015-11-23 | 2016-01-20 | 江南大学 | Strategy for efficiently coproducing alpha-aminobutyric acid and gluconic acid |
| CN105296456A (en) * | 2015-11-23 | 2016-02-03 | 江南大学 | Glutamic acid decarboxylase mutant with enhanced pH stability and application thereof |
| CN105296456B (en) * | 2015-11-23 | 2018-08-07 | 江南大学 | A kind of stability-enhanced glutamic acid decarboxylase enzyme mutant of pH and its application |
| CN106636238A (en) * | 2016-11-17 | 2017-05-10 | 江南大学 | Method for producing gamma-amino butyric acid through distillers' grains fermentation by microorganisms |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102367432B (en) | 2014-10-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102367432B (en) | Construction method and application of high-yield gamma-aminobutyric acid recombinant escherichia coli/pET-28a-1pgad | |
| CN101663389A (en) | An amidase gene knock-out engineered strain for nitrile hydratase production, its construction and application | |
| CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
| CN107603937A (en) | A kind of recombination bacillus coli and its construction method for expressing lysine aminopeptidase | |
| CN102994439A (en) | Escherichia coli recombinant strain producing shikimic acid, and construction method and application thereof | |
| CN110055204A (en) | A kind of method and application for knocking out II Q and pcf gene of spo and improving the lichen bacillus ferments producing enzyme | |
| CN101463358B (en) | Nitrile hydratase gene cluster and use thereof | |
| CN103484419B (en) | A kind of L-Glutamic decarboxylase recombinant bacterium and construction process thereof and application | |
| CN101691560B (en) | Colibacillus and method for performing soluble expression of transglutaminase proenzyme thereof | |
| CN102994425A (en) | Genetic recombination escherichia coli and method for efficiently producing pullulanase | |
| CN100392075C (en) | Glutamine synthetase and its dedicated expression engineered bacteria and uses | |
| CN101967494A (en) | Method for constructing high-yield polyglutamic acid engineering strain | |
| CN105462998B (en) | A kind of difunctional acid urease structural gene and its expression and application | |
| CN104293817B (en) | Construction methods and uses of recombinant plasmid for producing succinic acid, and genetic engineering bacterium | |
| CN103382464B (en) | Derive from the Ntn hydrolase of the ancient bacterium of hyperthermophilic and encoding gene thereof and application | |
| CN113897301B (en) | Production method and application of genetically engineered high-yield strain streptomyces diastatochromogenes and epsilon-polylysine | |
| CN110923223B (en) | Novel nitrilase and application thereof | |
| CN105062906B (en) | A kind of production method optimizing organophosphor hydrolytic enzyme Yeast engineering bacteria and its enzyme | |
| CN110029081B (en) | Engineering bacterium for over-expressing carbon catabolite repression effect transcription inhibitor gene and construction method thereof | |
| CN109868253B (en) | Bacillus licheniformis engineering bacteria for inhibiting bacterial autolysis and construction method and application thereof | |
| CN113930376A (en) | Engineering bacterium for catalytic production of D-p-hydroxyphenylglycine, high-density culture method and catalytic production method | |
| CN101892228B (en) | Engineering bacteria with high tolerance to acrylamide and acrylonitrile for producing nitrile hydratase and application thereof | |
| CN117417874B (en) | Engineering strain HC6-MT and application thereof in low-temperature production of trehalose | |
| CN103243054B (en) | Strain capable of producing carboxyethylhydantoinase and application thereof | |
| CN108707574A (en) | One plant of yielding lipase engineering bacteria, its construction method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |