CN104855410B - The purposes of insecticidal proteins - Google Patents

Abstract

The present invention relates to a kind of purposes of insecticidal proteins, the method for the control striped stem borer pest includes：Striped stem borer pest is at least contacted with Cry1A.105 albumen.The present invention can kill the Cry1A.105 albumen of striped stem borer to control striped stem borer pest by generation in plant；Compared with cultural control method, chemical prevention and control method and physical control method that the prior art uses; the present invention carries out plant the protection in the time of infertility, whole plant to prevent the infringement of striped stem borer pest; and pollution-free, noresidue, effect stability, thoroughly, it is simple, conveniently, it is economical.

Description

The purposes of insecticidal proteins

Technical field

The present invention relates to a kind of purposes of insecticidal proteins, pass through more particularly to a kind of Cry1A.105 protein in plant Middle expression is caused harm the purposes of plant to control striped stem borer.

Background technology

Striped stem borer Chilo sacchariphagus belong to Lepidoptera, Pyralidae.Also known as article sugarcane borer or sorghum are infiltrated Worm.It is mainly distributed on East Asia, South Asia, Southeast Asia and the Indian Ocean Area.Domestic distributed pole is wide, and northeast, North China, East China and south China are big There is generation in Electric Field At Ground In Partial Region.Can cause harm the crops such as corn, sorghum, grain, fiber crops, sugarcane.In North Dry Grain area, jade of mainly causing harm The crops such as rice, sorghum and grain, and often occur with corn borer mixing, cause withered heart seedling；It is also the Main Harmful on southern sugarcane simultaneously Worm.

Corn is the important cereal crops of China, and with the reinforcement of Global Greenhouse Effect, nearly 2 years temperature constantly rise, worm Evil species survey and quantity all increase.Striped stem borer is caused harm lobus cardiacus in the early stage with larva, and stage can eat into food stalk, leaf Sheath hinders nutrient conveying, stalk is made easily by the wind to fracture.Yield is seriously affected, ordinary loss is up to 10%-40%.In order to Striped stem borer is prevented, the main control method of people's generally use has：Cultural control, chemical prevention and physical control.

Cultural control be the multifactor comprehensive coordination management of entire agro-ecosystem, regulation and control crop, pest, environment because Element creates a farmland ecological environment for being conducive to plant growth and being unfavorable for striped stem borer generation.Overwintering Larvae pupate with Before emergence, sorghum or maize straw are disposed, to reduce overwintering worm sources.Stalk processing can be used crushing, burn, macerate Fertilizer cuts up with a hay cutter the distinct methods such as broken, mudding.Because cultural control must obey the requirement of crop allocation and volume increase, using there is certain office It is sex-limited, it is impossible to as emergency measure, just to seem helpless when striped stem borer is broken out.

Chemical prevention, that is, pesticide control is to kill pest using chemical insecticide, is the weight of striped stem borer comprehensive treatment Want component part, it have the characteristics that it is quick, conveniently, easy and high economic benefit, the particularly situation of the big generation of striped stem borer Under, it is essential emergency measure.Striped stem borer holds extremely important, medication as moth stem pest to its Control stage Best period is before ovum incubates peak period to larva moth stem, and otherwise high instar larvae is eaten into after stalk, it will be difficult to reach the mesh of prevention 's.Chemical prevention and control method is mainly medicine liquid spray and applies pesticide-clay mixture at present.But chemical prevention also has its limitation, such as improper use It frequently can lead to crops poisoning, pest occur to develop immunity to drugs and kill natural enemy, pollute environment, make farmland ecosystem By destroying and pesticide residue such as constitutes a threat to the safety of people, animal at the adverse consequences.

Physical control is mainly according to reaction of the pest to physical factors various in environmental condition, using various physical factors such as The methods of light, electricity, color, humiture etc. and mechanical equipment are trapped and killed, steriliation by irradiation carrys out pest control.It is most widely used at present Be frequency ventilating type insecticidal lamp trapping, it utilize adult pest phototaxis, closely use up, at a distance with wave, pest lured to lean on Closely, there is certain control effect to striped stem borer adult；But frequency ventilating type insecticidal lamp needs daily cleaning high-voltage electricity in time Otherwise online dirt can influence insecticidal effect；And it cannot turn on light in thundery sky, operationally also shock by electricity the danger hurted sb.'s feelings Danger；In addition the disposably input of installation lamp is larger.

In order to solve the limitation of cultural control, chemical prevention and physical control in practical applications, scientists are passed through Research finds the anti insect gene for coming from the encoding insecticidal proteins of bacillus thuringiensis being transferred in plant, and it is anti-can to obtain some Worm genetically modified plants are to prevent insect pest of the plant.

Above-mentioned insecticidal proteins have toxicity after susceptible insect host feeding.In the past few decades, to Su Yun gold buds The research of the structure and function of spore bacillus insecticidal proteins becomes research hotspot, although these albumen are in terms of specific structure and function There are difference, but it there is certain generalized pattern in general, including：It is searched for food by insect, is dissolved in specific insect place Main mid-gut, the partial digested enzyme of insect host carry out digestion activation to albumen, thin in insect with mid-gut cell combination A hole is formed on born of the same parents and destroys cellular homeostasis.Cry1Ab, Cry1Ac, Cry1Fa and Cry2Ab are to belong to such egg In vain, and these albumen are proved after importing in plant, may be such that plant generates pest-resistant function.Cry1A.105 insecticidal proteins are many One kind in more insecticidal proteins, Cry1A.105 albumen are a chimeric proteins, it is respectively from Cry1Ab albumen, Cry1Ac Albumen and Cry1Fa albumen.

Cry1A.105 albumen uptakes into middle intestines by susceptible insect, and toxalbumin parent toxin is dissolved in the alkali of insect midgut Under property pH environment.Parent toxin is transformed into active fragment by basic protein enzymic digestion by albumen N- and C- ends；Active fragment and easily Feel receptor on insect midgut epithelial cell membrane upper surface to combine, be inserted into goldbeater's skin, cell membrane is caused perforation lesion occur, destroys cell Osmotic pressure variation and pH balances inside and outside film etc. upset the digestion process of insect, eventually lead to its death.

Invading for the Lepidopteras Lepidoptera pests such as corn borer can be resisted by being proved to turn the plant of Cry1A.105 genes Evil controls striped stem borer to plant however, there is no so far about the transfer-gen plant of Cry1A.105 albumen is expressed by generation The report of harm.

Invention content

The object of the present invention is to provide a kind of purposes of insecticidal proteins, provide express Cry1A.105 by generation for the first time The transfer-gen plant of albumen controls method of the striped stem borer to plant hazard, and effectively overcome prior art cultural control, change Learn the technological deficiencies such as prevention and physical control.

To achieve the above object, the present invention provides a kind of method for controlling striped stem borer pest, including by striped stem borer Pest at least contacts with Cry1A.105 albumen.

Further, the Cry1A.105 albumen is present in the host cell at least generating the Cry1A.105 albumen In, the striped stem borer pest is at least contacted by the host cell of ingesting with the Cry1A.105 albumen.

Further, the Cry1A.105 albumen is present in the bacterium at least generating the Cry1A.105 albumen or turns In gene plant, the striped stem borer pest by the tissue of the ingest bacterium or the genetically modified plants at least with it is described Cry1A.105 albumen contacts, and the striped stem borer pest grows and is suppressed and/or leads to death after contact, to realize to height Fine strain of millet snout moth's larva endangers the control of plant.

In the above-mentioned technical solutions, the genetically modified plants may be at arbitrary breeding time；The group of the genetically modified plants It is woven to root, blade, stalk, fruit, tassel, female fringe, bud, anther or filigree；The control for endangering striped stem borer plant Do not change due to the change of planting site and/or implantation time.

The plant comes from corn, sorghum, sugarcane, grain, fiber crops or Semen Coicis.

The step of before the contact procedure, is plants the plant containing the polynucleotides for encoding the Cry1A.105 albumen Object.

Preferably, the amino acid sequence of the Cry1A.105 albumen has SEQ ID NO:Amino acid sequence shown in 1. The nucleotide sequence of the Cry1A.105 albumen has SEQ ID NO:Nucleotide sequence shown in 2.

Based on the above technical solution, the plant can also include at least one be different from described in coding Second of nucleotide of the nucleotide of Cry1A.105 albumen.

Further, second of nucleotide coding Cry classes insect-killing protein, Vip classes insect-killing protein, protease suppression Preparation, agglutinin, alpha-amylase or peroxidase.

Preferably, second of nucleotide coding Cry2Ab albumen.

Further, the amino acid sequence of the Cry2Ab albumen has SEQ ID NO:Amino acid sequence shown in 3, Second of the nucleotide has SEQ ID NO:Nucleotide sequence shown in 4.

Selectively, second of the nucleotide is the dsRNA for inhibiting important gene in target insect pests.

To achieve the above object, the present invention also provides a kind of use of Cry1A.105 protein control striped stem borer pest On the way.

To achieve the above object, the present invention also provides a kind of method for the plant for generating control striped stem borer pest, packets Include the polynucleotide sequence that coding Cry1A.105 albumen is introduced into the genome of the plant.

To achieve the above object, the present invention also provides a kind of sides for the propagulum for generating control striped stem borer pest Method, including will be hybridized by the first plant that the method obtains with the second plant and/or remove the plant obtained by the method The upper tissue with fertility is cultivated, so as to generate the plant of the polynucleotide sequence containing coding Cry1A.105 albumen Object brood body.

To achieve the above object, the present invention also provides a kind of method for the plant for cultivating control striped stem borer pest, packets It includes：

At least one propagulum is planted, the genome of the propagulum includes encoding Cry1A.105 albumen Polynucleotide sequence；

The propagulum is made to grow up to plant；

Make the plant under conditions of artificial infection striped stem borer pest and/or striped stem borer pest naturally-occurring harm Growth, harvest has the plant weakened compared with the plant of other polynucleotide sequences for not having coding Cry1A.105 albumen Damage and/or the plant with increased plant products.

Heretofore described " propagulum " includes but not limited to plant tannins and plant vegetative propagule. The plant tannins include but not limited to vegetable seeds；The plant vegetative propagule refers to the nutrition organs of plant Or certain particular tissues, new plant can be generated in vitro；The nutrition organs or certain particular tissues include but Root, stem and leaf are not limited to, such as：Plant using root as vegetative propagule includes strawberry and sweet potato etc.；Using stem as vegetative propagule Plant include sugarcane and potato (stem tuber) etc.；Plant using leaf as vegetative propagule includes aloe and begonia etc..

Heretofore described " contact " refers to insect and/or pest touching, stop and/or feeding plant, plant device Official, plant tissue or plant cell, the plant, plant organ, plant tissue or plant cell are either it is expressed in vivo Insecticidal proteins, can also be the plant, plant organ, plant tissue or plant cell surface have insecticidal proteins and/or With the microorganism for generating insecticidal proteins.

Term " control " of the present invention and/or " prevention " refer to that striped stem borer pest at least contacts with Cry1A.105 albumen, connect Striped stem borer pest growth after touch is suppressed and/or leads to death.Further, striped stem borer pest passes through feeding plant group It knits and is at least contacted with Cry1A.105 albumen, all or part of striped stem borer pest, which grows, after contact is suppressed and/or causes dead It dies.Inhibition refer to it is sub- lethal, i.e., it is not yet lethal but can cause growth and development, behavior, physiology, biochemistry and tissue etc. certain Effect, as growth and development is slow and/or stops.Meanwhile plant should be morphologically normal, and can cultivate under conventional approaches For the consumption and/or generation of product.In addition, the control sorghum of the polynucleotide sequence containing coding Cry1A.105 albumen The plant of borer pest worm and/or propagulum, in artificial infection striped stem borer pest and/or striped stem borer pest naturally-occurring Under conditions of harm, there is the plant injury weakened compared with non-transgenic WT lines, specific manifestation includes but unlimited In kernel weight, and/or volume increase of improved stalk resistance, and/or raising etc.." control of the Cry1A.105 albumen to striped stem borer System " and/or " prevention " act on be can be self-existent, " can not be controlled " and/or " prevention " striped stem borer pest because other The presence of substance and weaken and/or disappear.Specifically, genetically modified plants (the polynucleotides sequence containing coding Cry1A.105 albumen Row) any tissue simultaneously and/or asynchronously, exist and/or generate, Cry1A.105 albumen and/or controllable striped stem borer Another substance of pest, the then presence of another substance neither influence " control of the Cry1A.105 albumen to striped stem borer System " and/or " prevention " effect can not cause " control " and/or " prevention " effect completely and/or part are by described another Kind substance realization, and it is unrelated with Cry1A.105 albumen.Under normal conditions, in crop field, striped stem borer pest feeding plant tissue Process is of short duration and is difficult to observe with the naked eye, and therefore, is sent out naturally in artificial infection striped stem borer pest and/or striped stem borer pest Under conditions of raw harm, as any tissue of genetically modified plants (polynucleotide sequence containing coding Cry1A.105 albumen) is deposited It stops in dead striped stem borer pest, and/or on it and grows the striped stem borer pest being suppressed, and/or turn base with non- The WT lines of cause compare the method and/or purposes for the plant injury weakened, as realizing the present invention, that is, pass through height Fine strain of millet borer pest worm at least contacts the method and/or purposes to realize control striped stem borer pest with Cry1A.105 albumen.

In the present invention, expression of the Cry1A.105 albumen in a kind of genetically modified plants can be along with one or more The expression of Cry classes insect-killing protein and/or Vip class insect-killing proteins.It is this to turn base in same strain more than a kind of Pesticidal toxins It can include plant by genetic engineering and gene needed for expressing is realized because being co-expressed in plant.An in addition, plant Object (the 1st parent) can express Cry1A.105 protein by genetic engineering procedure, and second of plant (the 2nd parent) can lead to Cross genetic engineering procedure expression Cry classes insect-killing protein and/or Vip class insect-killing proteins.It is miscellaneous by the 1st parent and the 2nd parent Hand over the progeny plants for obtaining all genes that expression introduces the 1st parent and the 2nd parent.

RNA interference (RNA interference, RNAi) refer to it is being highly conserved during evolution, by double-stranded RNA (double-stranded RNA, dsRNA) induce, homologous mRNA efficient selective degradation the phenomenon that.Therefore in the present invention RNAi technology specific depletion can be used or close the expression of specific gene in target insect pests.

In categorizing system, generally mainly according to morphological features such as the types of the nervuration of adult wing, linkage mode and feeler, Lepidoptera is divided into suborder, Superfamily, section etc., and Pyralidae is one of section of most species in Lepidoptera, the whole world has found 10,000 Kind or more, only China's record just has thousands of.Most of Pyralidae insect is the pest of crops, most to be in the form of stem to eat into Evil, such as striped rice borer and corn borer.Although striped stem borer and striped rice borer, corn borer etc. belong to lepidoptera pyralidae, in addition to dividing There are similitudes on class standard, and then there are huge differences on other morphosis；Like the strawberry in plant and apple one Sample (belongs to the Rosales rose family), they have a features such as colored both sexes, radiation symmetric, 5, petal, but its fruit and plant Plant shape state is multifarious.Striped stem borer is all unique with its either from Larva Morpho. Logy or adult form Feature.Such as back ordinate, just have in peasant and spread " sorghum corn paddy, lineback 345 ", expression belongs to Pyralidae Striped stem borer, corn borer and chilotraea infuscatellus there is apparent difference in lineback quantity.And be exactly dorsal blood vessel under the ordinate of back, the back of the body Blood vessel is the important component of insect causing circulatory, is filled with the hemolymph of the title of insect " blood " inside.Therefore body surface Seem the difference of subtle lineback quantity in form, embodiment be dorsal blood vessel difference, be the difference in the insect circulatory system.

The insect of Pyralidae is belonged to not only in morphological feature there are larger difference, while on feeding habit, there is also Difference.Such as be all that the yellow rice borer of Pyralidae is mainly caused harm rice, other gramineous crops of seldom causing harm.And striped stem borer has no It has been reported that and rice is caused to cause harm, be more to southern sugarcane, northern corn, sorghum and millet cause to cause harm.Feeding The difference of habit also implies enzyme caused by internal digestive system and receptor protein difference.And the enzyme generated in alimentary canal is The key point that Bt genes work, only can with the enzyme or receptor protein that specific b t genes are combined, be possible to so that Some Bt gene pairs pest is with insect resistant effect.It is more and more research shows that, it is not equal, even equal not of the same race with mesh Insect is different to the sensitive sex expression of Bt albumen of the same race.Such as the striped rice borer Chilo of Vip3Aa gene pairs Pyralidaes Suppressalis, Ostrinia furnacalis Ostrinia furnacalis show anti-insect activity, but for belonging to snout moth Indian meal moth Plodia interpunctella and European corn borer the Ostrinia nubilalis of section are but without pest-resistant effect Fruit.Above-mentioned four kinds of pests belong to lepidoptera pyralidae, but Bt albumen of the same race shows four kinds of Pyralidae pests different resist Property effect.Especially it is (equal with mesh even to belong to Pyralidae Genus Ostinia in classification for European corn borer and Ostrinia furnacalis Belong to), but its reaction to Bt albumen of the same race is completely different, has more absolutely proved Bt albumen and enzyme in insect bodies Interaction mode with receptor is complicated and is difficult to expect.

The genome of heretofore described plant, plant tissue or plant cell, refers to plant, plant tissue or plant Intracellular any inhereditary material, and including nucleus and plastid and mitochondrial genomes.

Heretofore described polynucleotides and/or nucleotide form complete " gene ", are encoded in required host cell Protein or polypeptide.The polynucleotides of the present invention and/or nucleotide it is readily appreciated that can be placed in by those skilled in the art Under regulating and controlling sequence control in purpose host.

Well-known to those skilled in the art, DNA typically exists with double-stranded form.In this arrangement, chain with Another chain complementation, vice versa.Other complementary strands of DNA are produced since DNA is replicated in plant.In this way, present invention packet Include the use to polynucleotides exemplary in sequence table and its complementary strand." coding strand " that this field often uses refers to be chained with antisense The chain of conjunction.In order to express protein in vivo, a chain of DNA is transcribed into the complementary strand of a mRNA by typical case, it is as mould Plate translates protein.MRNA is actually to be transcribed from " antisense " chain of DNA." ariyoshi " or " coding " chain has a series of passwords Son (codon is three nucleotide, and primary reading three can generate specific amino acids), can read as open reading frame (ORF) It reads to form target protein or peptide.The invention also includes the RNA for having suitable function with exemplary DNA.

Nucleic acid molecule of the present invention or its segment under strict conditions with Cry1A.105 gene recombinations of the present invention.It is any normal The nucleic acid hybridization of rule or amplification method may be used to identify the presence of Cry1A.105 genes of the present invention.Nucleic acid molecules or its piece Section can carry out specific hybrid with other nucleic acid molecules in any case.In the present invention, if two nucleic acid molecules energy shapes Into antiparallel double-strandednucleic acid structure, it is possible to say that the two nucleic acid molecules can carry out specific hybrid to each other.If two A nucleic acid molecules show complete complementarity, then it is another nucleic acid molecules " complement " to claim one of nucleic acid molecules. In the present invention, when each nucleotide and the corresponding nucleotide mutual added time of another nucleic acid molecules of a nucleic acid molecules, then The two nucleic acid molecules is claimed to show " complete complementarity ".If two nucleic acid molecules can be with enough stability phase mutual crosses So as to which them be made to anneal and be bonded to each other under the conditions of at least conventional " low stringent ", then the two nucleic acid molecules are referred to as " most Low degree is complementary ".Similarly, if two nucleic acid molecules can be with enough stability phase mutual crosses so as to make them in routine " height stringent " under the conditions of anneal and be bonded to each other, then claim the two nucleic acid molecules that there is " complementarity ".From complete complementarity Middle deviation can allow, as long as this deviation not exclusively prevents two molecules from forming duplex structure.In order to make a nucleic acid Molecule can be used as primer or probe, it is only necessary to it is adequately complementary ensure that it has in sequence, so that in used spy Determine that stable duplex structure can be formed under solvent and salinity.

In the present invention, substantially homologous sequence is one section of nucleic acid molecules, which can under high stringency Specific hybrid occurs with the complementary strand of another section of nucleic acid molecules to match.Promote the suitable stringent condition of DNA hybridization, example Such as, it is handled about under the conditions of 45 DEG C with 6.0 × sodium chloride/sodium citrate (SSC), then with 2.0 × SSC under the conditions of 50 DEG C Washing, these conditions are well known to those skilled in the art.For example, the salinity in washing step can be selected from minuent sternly About 2.0 × SSC of glazing bar part, 50 DEG C to high stringency about 0.2 × SSC, 50 DEG C.In addition, the temperature in washing step Condition from about 22 DEG C of the room temperature of Low stringency conditions, can be increased to about 65 DEG C of high stringency.Temperature condition and salt are dense Degree can all change, can also one of them remain unchanged and another variable changes.Preferably, it is of the present invention Stringent condition can be in 6 × SSC, 0.5%SDS solution, at 65 DEG C with SEQ ID NO:2 occur specific hybrid, then Film is respectively washed with 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS 1 time.

Therefore, have anti-insect activity and under strict conditions with SEQ ID NO of the present invention:The sequence of 2 hybridization is included in this In invention.These sequences and sequence of the present invention at least about 40%-50% are homologous, and about 60%, 65% or 70% are homologous, even At least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more Big sequence homology.

Heretofore described gene and protein not only include specific exemplary sequence, further include save it is described specific (including compared with full length protein and/or end lacks for the part of the insecticidal activity feature of exemplary protein and/segment Lose), variant, mutant, the substituent protein of amino acid (have substitute), chimera and fusion protein." variant " or " become It is different " refer to the nucleotide sequence for encoding same albumen or encoding the equivalent protein for having insecticidal activity." equivalent protein " refers to There is the albumen of the bioactivity of identical or essentially identical anti-striped stem borer pest with the albumen of claim.

The original DNA or egg that heretofore described DNA molecular or " segment " of protein sequence or " truncation " refer to A part of Bai Xulie (nucleotide or amino acid) or its artificial reconstructed form (such as being suitble to the sequence of plant expression), aforementioned sequence Variation may be present in the length of row, but length is enough to ensure that (coding) protein is insect toxins.

Gene variant can be built with modifier and readily using standard technique.For example, it is well known that manufacture point The technology of mutation.In another example U.S. Patent number 5605793, which describes to reassembly using DNA after random fracture, generates other molecules Multifarious method.The segment of commercialization endonuclease manufacture full-length gene can be used, and can be according to standardization program Use exonuclease.It is, for example, possible to use enzyme such as Bal31 or direct mutagenesis cut off core from the end systems of these genes Thuja acid.A variety of restriction enzymes can also be used to obtain the gene of encoding active segment.It can be directly obtained using protease The active fragment of these toxin.

The present invention can derive equivalent protein from B.t. isolates and/or DNA library and/or encode these equivalent proteins Gene.There are many insecticidal proteins that method obtains the present invention.It is, for example, possible to use the desinsection that the present invention discloses and claims The antibody of albumen is identified and isolated from other albumen from protein mixture.Particularly, antibody may be by albumen it is most constant and with Caused by the most different protein part of other B.t. albumen.It may then pass through immune precipitation, enzyme linked immunosorbent assay (ELISA) (ELISA) or western immunoblot methods exclusively identify the equivalent protein of activity characteristic using these antibody.Ability can be used Domain standardization program readily prepares the antibody of the albumen or the segment of equivalent protein or this albuminoid disclosed in the present invention.Then may be used To obtain the gene for encoding these albumen from microorganism.

Due to the Feng Yuxing of genetic codon, a variety of different DNA sequence dnas can encode identical amino acid sequence.It generates These encode the alternative DNA sequence dna of identical or essentially identical albumen just in the technical merit of those skilled in the art.This A little different DNA sequence dnas are included within the scope of the invention." substantially the same " sequence refers to have amino acid substitution, lack The sequence of insecticidal activity is lost, added or be inserted into but do not influence substantially, also includes the segment for retaining insecticidal activity.

The substitution of amino acid sequence, missing or addition are the ordinary skill in the art in the present invention, preferably this amino acid Change and be：Small characteristic changing does not significantly affect the folding of albumen and/or the conserved amino acid substitution of activity；Small missing, The missing of normally about 1-30 amino acid；Small amino or c-terminus extension, such as aminoterminal extend a methionine residues； Small connection peptide, for example, about 20-25 residue are long.

The example of conservative substitution is the substitution occurred in following amino acid group：Basic amino acid (such as arginine, lysine And histidine), it is acidic amino acid (such as glutamic acid and aspartic acid), polar amino acid (such as glutamine, asparagine), hydrophobic Acidic amino acid (such as leucine, isoleucine and valine), ArAA (such as phenylalanine, tryptophan and tyrosine), with And small molecule amino acid (such as glycine, alanine, serine, threonine and methionine).Usually do not change given activity Those amino acid substitutions are well-known in the art, and by for example, N.Neurath and R.L.Hill are 1979 Published by year new york academic publishing house (Academic Press)《Protein》In be described.Most common exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/ Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly and their opposite exchanges.

For a person skilled in the art it should be evident that this substitution can play an important role to molecular function Region except occur, and still generate active peptides.For the polypeptide by the present invention, activity is required and therefore selects not Substituted amino acid residue can reflect according to methods known in the art, such as direct mutagenesis or alanine scanning mutagenesis It is fixed (such as referring to, Cunningham and Wells, 1989, Science244：1081-1085).Latter technique is each in the molecule At a positively charged residue introduce mutation, detection gained mutating molecule anti-insect activity, so that it is determined that the molecular activity and It overstates the amino acid residue wanted.Substrate-enzyme interacting site can also be measured by the analysis of its three-dimensional structure, and this three Tie up structure can be measured by technologies such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, such as de Vos, 1992, Science 255：306-312；Smith etc., 1992, J.Mol.Biol 224:899-904；Wlodaver etc., 1992, FEBS Letters 309：59-64).

In the present invention, Cry1A.105 albumen includes but not limited to sequence 1, has with the amino acid sequence shown in sequence 1 The amino acid sequence of certain homology is also included in the present invention.These sequences are typical with sequence similarities of the present invention/phase same sex Be more than 78%, preferably greater than 85%, more preferably greater than 90% even more preferably more than 95%, and can be more than 99%.The preferred polynucleotides and albumen of the present invention can also be defined according to the phase same sex particularly and/or similarity range Matter.Such as have 78% with the exemplary sequence of the present invention, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%th, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, the 98% or 99% phase same sex and/or similar Property.

In the present invention, the genetically modified plants for generating the Cry1A.105 albumen include but not limited to MON89034 and turn base Vegetable material because of corn event and/or comprising MON89034 transgenic corn events (such as described in CN101495635A) Or MON87751 transgenic soybean events and/or vegetable material comprising MON87751 transgenic soybean events are (such as in USDA APHIS is non-, and control state application 13-337-01p is described), it can realize the method and/or purposes of the present invention, i.e., it is logical Jowar borer pest worm is crossed at least to contact to realize the method and/or purposes that control chilotraea infuscatellus pest with Cry1A.105 albumen.Ability Field technique personnel are understood that the Cry1A.105 albumen in above-mentioned transgenic event is made, which to be expressed in different plants, can also realize The method and/or purposes of the present invention.More specifically, the Cry1A.105 albumen, which is present in, at least generates the Cry1A.105 eggs In white genetically modified plants, the jowar borer pest worm by the tissues of the genetically modified plants that ingest at least with it is described Cry1A.105 albumen contacts, and the jowar borer pest worm grows and is suppressed and/or leads to death after contact, to realize to height Beam snout moth's larva endangers the control of plant.

Heretofore described regulating and controlling sequence include but not limited to promoter, transit peptides, terminator, enhancer, targeting sequencing, Introne and other regulatory sequences for being operably connected to the Cry1A.105 albumen.

The promoter is effable promoter in plant, and " the effable promoter in plant " refers to ensure The promoter that coded sequence connected to it is expressed in plant cell.Effable promoter can be composing type in plant Promoter.The example of the promoter of constitutive expression in plant is instructed to include but not limited to, from cauliflower mosaic virus 35S promoter, corn Ubi promoters, promoter of rice GOS2 genes etc..Alternatively, effable promoter can in plant For the promoter of organizing specific, i.e. the promoter such as instructs the table of coded sequence in some tissues of plant in chlorenchyma Up to horizontal its hetero-organization (can be tested and be measured by conventional RNA) higher than plant, such as PEP carboxylase promoters.Alternatively, Effable promoter can be wound-induced promoter in plant.Wound-induced promoter or the expression pattern for instructing wound-induced Promoter refer to when wound caused by plant is subjected to machinery or is gnawed by insect, the table of the coded sequence under promoter regulation It is significantly increased up under the conditions of compared with normal growth.The example of wound-induced promoter includes but not limited to, potato and tomato Protease suppressor (pin I and pin II) and zein enzyme suppressor (MPI) promoter.

The transit peptides (also known as secretory signal sequence or targeting sequencing) are to instruct transgene product to specific organelle Or cellular compartment, for receptor protein, the transit peptides can be heterologous, for example, utilizing encoding chloroplast transit peptide Sequence targeting chloroplaset either utilizes ' KDEL ' to retain sequence targeting endoplasmic reticulum or utilizes barley plants agglutinin gene CTPP targets vacuole.

The targeting sequencing is including but not limited to picornavirus targeting sequencing, such as EMCV targeting sequencings (encephalomyo-carditis disease Malicious 5 ' noncoding regions)；Potyvirus leaders, such as MDMV (Maize Dwarf Mosaic Virus) targeting sequencing；Human immunity Globular protein heavy-chain binding protein matter (BiP)；The coat protein mRNA's of alfalfa mosaic virus does not translate targeting sequencing (AMV RNA4)；Tobacco mosaic virus (TMV) (TMV) targeting sequencing.

The enhancer is including but not limited to cauliflower mosaic virus (CaMV) enhancer, figwort mosaic virus (FMV) increase Hadron, carnation weathering circovirus virus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis jalapa mosaic virus (MMV) enhancer, dama de noche tomato yellow leaf curl China virus (CmYLCV) enhancer, Cotton leaf curl Multan virus (CLCuMV), duck plantar Straw colour mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhancer.

For monocotyledon is applied, the introne is including but not limited to corn hsp70 intrones, corn are general Plain introne, Adh introne 1s, crose synthase intron or rice Act1 intrones.For dicotyledon is applied, institute Introne is stated including but not limited to CAT-1 intrones, pKANNIBAL intrones, PIV2 intrones and " super ubiquitin " include Son.

The terminator can be the suitable polyadenylation signal sequence that works in plant, including but it is unlimited In from the Polyadenylation of Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene Signal sequence, from the polyadenylation signal sequence of protease-inhibitor Ⅱ (pin II) gene, from pea The polyadenylation signal sequence of ssRUBISCO E9 genes and the poly from alpha-tubulin (α-tubulin) gene Polyadenylation signal sequence.

Heretofore described " effectively connection " represents the connection of nucleic acid sequence, described to be coupled so that a sequence provide pair The function of being needed for linked sequence.Described in the present invention " effectively connection " can be by promoter and interested sequence phase Even so that the transcription of the interested sequence is controlled and regulated and controled by the promoter.When interested sequential coding albumen and " effectively connection " represents when going for the expression of the albumen：Promoter is connected with the sequence, and connected mode to obtain Transcript efficient translation.If promoter and the albumen that the connection of coded sequence is that transcript merges and want that realization encodes Expression when, manufacture such connect so that the first translation initiation codon is the starting of coded sequence in obtained transcript Codon.Alternatively, if promoter and the table that the connection of coded sequence is the albumen that realization coding was merged and wanted in translation Up to when, manufacture such connect so that the first translation initiation codon and the promoter contained in 5 ' non-translated sequences is connected, And the relationship of the translation opening code-reading frame of the translation product that connection mode the causes albumen desired with coding is to meet reading Code frame.The nucleic acid sequence that " can effectively connect " includes but not limited to：Sequence (the i.e. gene expression of gene expression function is provided Element, for example, promoter, 5 ' untranslated regions, introne, protein encoding regions, 3 ' untranslated regions, poly- putative adenylylation site and/ Or transcription terminator), provide DNA transfer and/or integration function sequence (i.e. T-DNA border sequences, locus specificity recombinase Recognition site, integrate enzyme recognition site), provide selectivity function sequence (i.e. antibiotic resistance markers, biosynthesis base Cause), provide can score marker function sequence, in vitro or in vivo assist series of operations sequence (i.e. polylinker sequence, site Specific recombination sites) and provide copy function sequence (the i.e. replication orgin of bacterium, autonomously replicating sequence, centromere sequence Row).

Heretofore described " desinsection " or " pest-resistant " refers to it is toxic to crop pests, so as to fulfill " control " And/or " prevention " crop pests.Preferably, described " desinsection " or " pest-resistant " refer to kill crop pests.More specifically, mesh It is striped stem borer pest to mark insect.

Cry1A.105 albumen has toxicity to striped stem borer pest in the present invention.Plant in the present invention, it is particularly beautiful Rice, sugarcane and sorghum, contain exogenous DNA in its genome, and the exogenous DNA includes the nucleosides of coding Cry1A.105 albumen Acid sequence, striped stem borer pest are contacted by feeding plant tissue with the albumen, and striped stem borer pest grows and pressed down after contact It makes and/or leads to death.Inhibition refers to lethal or sub- lethal.Meanwhile plant should be morphologically normal, and can be in conventional side The consumption and/or generation for product are cultivated under method.In addition, the plant can substantially eliminate the need to chemistry or biological insecticides It will (chemistry or biological insecticides be the insecticide of striped stem borer pest that is targeted for Cry1A.105 albumen).

In vegetable material the expression of insecticidal crystal protein (ICP) can by described a variety of methods in the art into Row detection, such as quantify by the mRNA of coded insect-killing protein of the application special primer to being generated in tissue or directly The amount for the insect-killing protein that specific detection generates.

Different experiments can be applied to measure the insecticidal effect of ICP in plant.Targeted insect is mainly sorghum in the present invention Snout moth's larva.

In the present invention, the Cry1A.105 albumen can have SEQ ID NO in sequence table:Amino acid sequence shown in 1 Row.Other than the code area comprising Cry1A.105 albumen, it also may include other elements, such as the albumen of encoding selection markers Matter.

In addition, the expression cassette comprising the nucleotide sequence for encoding Cry1A.105 albumen of the present invention can also be in plant The protein of at least one encoding herbicide resistance gene is expressed together, and the herbicide resistance gene includes but not limited to, grass Amine phosphine resistant gene (such as bar genes, pat genes), phenmedipham resistant gene (such as pmph genes), Glyphosate resistance gene are (such as EPSPS genes), Brominal (bromoxynil) resistant gene, sulfonylurea resistance gene, the resistance base to herbicide Dalapon Because, to the resistant gene of the resistant gene or glutamine synthetase inhibitor (such as PPT) of cyanamide, both killed so as to obtain with height Worm activity and the genetically modified plants with Herbicid resistant.

In the present invention, by Exogenous DNA transfered plant, as described in will encode the gene of Cry1A.105 albumen or expression cassette or Recombinant vector imports plant cell, and conventional method for transformation includes but not limited to, and Agrobacterium-medialed transformation, micro transmitting are banged It hits, directly import DNA intakes protoplast, electroporation or the DNA of silicon whisker mediation.

The present invention provides a kind of purposes of insecticidal proteins, have the following advantages：

1st, internal cause prevents.The prior art is mainly that the harm of striped stem borer pest is controlled by external action, that is, external cause, Such as cultural control, chemical prevention and physical control；And the present invention is can to kill striped stem borer by being generated in plant Cry1A.105 albumen controls striped stem borer pest, i.e., is prevented by internal cause.

2nd, pollution-free, noresidue.Although the chemical prevention and control method that the prior art uses is to the danger of control striped stem borer pest Evil plays certain effect, but also bring pollution, destruction and residual to people, animal and farmland ecosystem simultaneously；Use this hair The method of bright control striped stem borer pest, can eliminate above-mentioned adverse consequences.

3rd, the time of infertility prevents.The method of control striped stem borer pest that the prior art uses all is interim, and this Invention is that the protection in the time of infertility is carried out to plant, and genetically modified plants (Cry1A.105 albumen) are from germination, growth, until opening It spends, as a result, can avoid being encroached on by striped stem borer.

4th, whole plant is prevented.The method of control striped stem borer pest that the prior art uses is locality mostly, such as leaf Face sprays；And the present invention is that entire plant is protected, such as the root, blade, stem of genetically modified plants (Cry1A.105 albumen) Stalk, fruit, tassel, female fringe, bud, anther or filigree etc. can all resist striped stem borer infringement.

5th, effect stability.The either cultural control method or physical control method that the prior art uses are required for utilizing Environmental condition prevents pest, and variable factor is more；The present invention is that the Cry1A.105 albumen is made to be carried out in plant Expression, efficiently avoids the defects of environmental condition is unstable, and the prevention of genetically modified plants of the present invention (Cry1A.105 albumen) Effect is also all stable and consistent in different location, different time, different genetic backgrounds.

6th, it is simple, conveniently, it is economical.The disposably input for the frequency ventilating type insecticidal lamp that the prior art uses is larger, and operates not When the danger hurted sb.'s feelings of also shocking by electricity；The present invention only need to plant the genetically modified plants that can express Cry1A.105 albumen, without It needs using other measures, so as to save a large amount of human and material resources and financial resources.

7th, effect is thorough.The method of control striped stem borer pest that the prior art uses, effect are halfway, are only risen It is acted on to mitigation；And genetically modified plants (Cry1A.105 albumen) of the present invention can cause just to incubate a large amount of dead of striped stem borer larva It dies, and fraction survival larvae development progress is caused greatly to inhibit, larva is all substantially still in just state is incubated after 3 days Apparent depauperation, and stopped developing, can not survive in the natural environment of field, and genetically modified plants generally only by Slight damage.

Below by drawings and examples, technical scheme of the present invention is described in further detail.

Description of the drawings

Fig. 1 is the recombinant cloning vector containing Cry1A.105 nucleotide sequences of the purposes of insecticidal proteins of the present invention DBN01-T builds flow chart；

Fig. 2 is the recombinant expression carrier containing Cry1A.105 nucleotide sequences of the purposes of insecticidal proteins of the present invention DBN100745 builds flow chart；

Fig. 3 is that the transgenic corn plant of the purposes of insecticidal proteins of the present invention is inoculated with the blade injury figure of striped stem borer.

Specific embodiment

The technical solution of the purposes of insecticidal proteins is further illustrated the present invention below by specific embodiment.

The acquisition and synthesis of first embodiment, gene

1st, nucleotide sequence is obtained

The amino acid sequence (1177 amino acid) of Cry1A.105 insect-killing proteins, such as SEQ ID NO in sequence table:1 institute Show；Coding is corresponding to the Cry1A.105 nucleotide sequences (3534 of the amino acid sequence of the Cry1A.105 insect-killing proteins Nucleotide), such as SEQ ID NO in sequence table:Shown in 2.

The amino acid sequence (634 amino acid) of Cry2Ab insect-killing proteins is encoded, such as SEQ ID No in sequence table:3 institutes Show；Coding is corresponding to Cry2Ab nucleotide sequences (1905 nucleosides of the amino acid sequence of the Cry2Ab insect-killing proteins Acid), such as SEQ ID NO in sequence table:Shown in 4.

2nd, above-mentioned nucleotide sequence is synthesized

The Cry1A.105 nucleotide sequences (SEQ ID NO in such as sequence table:Shown in 2) and the Cry2Ab nucleotide Sequence (SEQ ID NO in such as sequence table:Shown in 4) it is synthesized by Nanjing Genscript Biotechnology Co., Ltd.；What is synthesized is described Cry1A.105 nucleotide sequences (SEQ ID NO:2) 5 ' ends are also associated with NcoI restriction enzyme sites, the Cry1A.105 nucleosides Acid sequence (SEQ ID NO:2) 3 ' ends are also associated with HindIII restriction enzyme sites；The Cry2Ab nucleotide sequences of synthesis (SEQ ID NO:4) 5 ' ends are also associated with NcoI restriction enzyme sites, Cry2Ab nucleotide sequences (the SEQ ID NO:4) 3 ' End is also associated with SpeI restriction enzyme sites.

Second embodiment, the structure of recombinant expression carrier and recombinant expression carrier conversion Agrobacterium

1st, the recombinant cloning vector containing Cry1A.105 genes is built

By the Cry1A.105 nucleotide sequences of synthesis be connected into cloning vector pGEM-T (Promega, Madison, USA, CAT：A3600 on), operating procedure is carried out by Promega Products pGEM-T carriers specification, obtains recombinant cloning vector DBN01-T, (wherein, Amp represents ampicillin resistance gene to structure flow as shown in Figure 1；F1 represents answering for bacteriophage f1 Starting point processed；LacZ is LacZ initiation codons；SP6 is SP6RNA polymerase promoters；T7 is t7 rna polymerase promoter； Cry1A.105 is Cry1A.105 nucleotide sequences (SEQ ID NO:2)；MCS is multiple cloning sites).

Then by recombinant cloning vector DBN01-T heat shock methods convert Escherichia coli T1 competent cells (Transgen, Beijing, China, CAT：CD501), hot shock condition is：50 μ l Escherichia coli T1 competent cells, 10 μ l Plasmid DNA (weight Group cloning vector DBN01-T), 42 DEG C of water-baths 30 seconds；37 DEG C of shaken cultivations 1 hour (shaking table shakes under 100rpm rotating speeds), in table Face is coated with the ammonia of IPTG (isopropylthio-β-D-galactoside) and X-gal (the chloro- 3- indoles-β-D- galactosides of the bromo- 4- of 5-) LB tablets (tryptone 10g/L, yeast extract 5g/L, the NaCl 10g/L, agar 15g/ of parasiticin (100 mg/litre) L, with NaOH tune pH to growth on 7.5) overnight.Picking white colony, in LB fluid nutrient mediums, (tryptone 10g/L, yeast carry Object 5g/L, NaCl 10g/L, ampicillin 100mg/L are taken, with NaOH tune pH to being cultivated under the conditions of 37 DEG C of temperature in 7.5) Overnight.Its plasmid of alkalinity extraction：Bacterium solution is centrifuged into 1min under 12000rpm rotating speeds, removes supernatant, precipitates 100 μ l ice of thalline The solution I (25mM Tris-HCl, 10mM EDTA (ethylenediamine tetra-acetic acid), 50mM glucose, pH8.0) of precooling suspends；It adds in The solution II (0.2M NaOH, 1%SDS (lauryl sodium sulfate)) that 200 μ l are newly prepared, pipe is overturned 4 times, and ice is put in mixing Upper 3-5min；The ice-cold solution IIIs of 150 μ l (3M potassium acetates, 5M acetic acid) are added in, abundant mixing, places 5- on ice immediately 10min；5min is centrifuged under the conditions of 4 DEG C of temperature, rotating speed 12000rpm, 2 times of volume absolute ethyl alcohols, mixing are added in supernatant After be placed at room temperature for 5min；5min is centrifuged under the conditions of 4 DEG C of temperature, rotating speed 12000rpm, abandons supernatant, precipitation concentration (V/V) To be dried after 70% ethyl alcohol washing；Add in 30 μ l containing RNase (20 μ g/ml) TE (10mM Tris-HCl, 1mM EDTA, PH8.0) dissolving precipitation；The water-bath 30min at 37 DEG C of temperature digests RNA；It is saved backup for -20 DEG C in temperature.

The plasmid of extraction carries out sequence verification after AhdI and XhoI digestions identification, to positive colony, the results showed that recombination The Cry1A.105 nucleotides sequences being inserted into cloning vector DBN01-T are classified as SEQ ID NO in sequence table:Nucleosides shown in 2 Acid sequence, i.e. Cry1A.105 nucleotide sequences are correctly inserted into.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, the Cry2Ab nucleotide sequences of synthesis are connected Enter on cloning vector pGEM-T, obtain recombinant cloning vector DBN02-T, wherein, Cry2Ab is Cry2Ab nucleotide sequences (SEQ ID NO:4).Cry2Ab nucleotide sequences are correctly inserted into described in digestion and sequence verification recombinant cloning vector DBN02-T.

2nd, the recombinant expression carrier containing Cry1A.105 genes is built

Distinguish digestion recombinant cloning vector DBN01-T and expression vector with restriction enzyme NcoI and HindIII DBNBC-01 (carrier frameworks：PCAMBIA2301 (CAMBIA mechanisms can provide)), the Cry1A.105 nucleotides sequences that will be cut Column-slice section is inserted between NcoI the and HindIII sites of expression vector DBNBC-01, utilizes conventional enzymatic cleavage methods carrier construction It is well-known to those skilled in the art, is built into recombinant expression carrier DBN100745, structure flow (Kan as shown in Figure 2： Kanamycin gene；RB：Right margin；Ubi：Corn Ubiquitin (ubiquitin) gene promoter (SEQ ID NO:5)； Cry1A.105：Cry1A.105 nucleotide sequences (SEQ ID NO:2)；Nos：Terminator (the SEQ of rouge alkali synthetase gene ID NO:6)；Hpt：Hygromycin gene (SEQ ID NO:7)；LB：Left margin).

Recombinant expression carrier DBN100745 heat shock methods are converted into Escherichia coli T1 competent cells, hot shock condition For：50 μ l Escherichia coli T1 competent cells, 10 μ l Plasmid DNA (recombinant expression carrier DBN100745), 42 DEG C of water-baths 30 seconds； 37 DEG C of shaken cultivations 1 hour (shaking table shakes under 100rpm rotating speeds)；Then in the LB of kanamycins containing 50mg/L (Kanamycin) Solid plate (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, with NaOH tune pH on 7.5) It is cultivated 12 hours under the conditions of 37 DEG C of temperature, picking white colony, in LB fluid nutrient mediums (tryptone 10g/L, yeast extraction Object 5g/L, NaCl 10g/L, kanamycins 50mg/L, with NaOH tune pH in 7.5) under the conditions of 37 DEG C of temperature overnight incubation. Its plasmid of alkalinity extraction.It will be identified after restriction enzyme NcoI and the HindIII digestion of the plasmid of extraction, and by positive colony Carry out sequencing identification, the results showed that nucleotides sequences of the recombinant expression carrier DBN100745 between NcoI and HindIII sites is classified as SEQ ID NO in sequence table:Nucleotide sequence shown in 2, i.e. Cry1A.105 nucleotide sequences.

According to the method for above-mentioned structure recombinant expression carrier DBN100745, by NcoI and SpeI digestion recombinant cloning vectors The Cry2Ab nucleotide sequences that DBN02-T is cut are inserted into expression vector DBNBC-01, obtain recombinant expression carrier DBN100744.Nucleotide sequence in digestion and sequence verification recombinant expression carrier DBN100744 contains for SEQ in sequence table ID NO:Nucleotide sequence shown in 4, i.e. Cry2Ab nucleotide sequences, the Cry2Ab nucleotide sequences can connect the Ubi Promoter and Nos terminators.

According to the method for above-mentioned structure recombinant expression carrier DBN100745, by NcoI and HindIII, NcoI and SpeI points The Cry1A.105 nucleotide sequences and Cry2Ab nucleotide that other digestion recombinant cloning vector DBN01-T and DBN02-T are cut Sequence is inserted into expression vector DBNBC-01, obtains recombinant expression carrier DBN100029.Digestion and sequence verification recombinant expression carrier Nucleotide sequence in DBN100029 contains for SEQ ID NO in sequence table:2 and SEQ ID NO:Nucleotide sequence shown in 4, That is Cry1A.105 nucleotide sequences and Cry2Ab nucleotide sequences, the Cry1A.105 nucleotide sequences and the Cry2Ab cores Nucleotide sequence can connect the Ubi promoters and Nos terminators.

3rd, recombinant expression carrier conversion Agrobacterium

To oneself, constructed correct recombinant expression carrier DBN100745, DBN100744 and DBN100029 are turned with liquid nitrogen method Change to Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT：In 18313-015), conversion condition is：100 μ L agricultures Bacillus LBA4404,3 μ L Plasmid DNA (recombinant expression carrier)；10 minutes are placed in liquid nitrogen, 37 DEG C of tepidarium 10 minutes；It will conversion Agrobacterium LBA4404 afterwards is inoculated in LB test tubes in 28 DEG C of temperature, rotating speed to be cultivated 2 hours under the conditions of 200rpm, is applied to and is contained Until growing sun on the LB tablets of the rifampin (Rifampicin) of 50mg/L and the kanamycins (Kanamycin) of 100mg/L Property monoclonal, picking Colony Culture simultaneously extracts its plasmid, with restriction enzyme A hdI and XhoI to recombinant expression carrier Digestion verification is carried out after DBN100745, DBN100744 and DBN100029 digestion, the results showed that recombinant expression carrier DBN100745, DBN100744 and DBN100029 structure are completely correct.

The acquisition of 3rd embodiment, transfer-gen plant

1st, transgenic corn plant is obtained

According to the Agrobacterium infestation method routinely used, by the rataria and second of the corn variety of sterile culture comprehensive 31 (Z31) Agrobacterium co-cultivation in embodiment described in 3, the recombinant expression carrier DBN100745 that in second embodiment 2 are built, T-DNA (promoter sequence including corn Ubiquitin genes, Cry1A.105 nucleosides in DBN100744 and DBN100029 Acid sequence, Cry2Ab nucleotide sequences, Hpt genes and Nos terminator sequences) it is transferred in maize chromosome group, turned Enter the plant of Cry1A.105 nucleotide sequences, be transferred to the plant of Cry2Ab nucleotide sequences and be transferred to The plant of Cry1A.105-Cry2Ab nucleotide sequences；Simultaneously using wild-type corn plant as control.

For agriculture bacillus mediated corn transformation, briefly, immature rataria is detached from corn, is suspended with Agrobacterium Liquid contacts rataria, and wherein Agrobacterium can be by Cry1A.105 nucleotide sequences, Cry2Ab nucleotide sequences and Cry1A.105- Cry2Ab nucleotide sequences are transferred at least one cell (step 1 of one of rataria：Infect step), in this step, rataria Preferably immerse agrobacterium suspension (OD₆₆₀=0.4-0.6 infects culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, acetosyringone (AS) 40mg/L, 2,4 dichlorophenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in start inoculation.Rataria co-cultures one section of period (3 days) (step 2 with Agrobacterium：Co-culture step). Preferably, rataria after step is infected in solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 100mg/L, 2,4 dichlorophenoxyacetic acid (2,4-D) 1mg/L, agar 8g/ L, pH5.8) on cultivate.After the stage of co-cultivation herein, can there are one selectivity " recovery " step.In " recovery " step, Recovery media (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 2,4 dichlorophenoxyacetic acid (2,4- D) 1mg/L, plant gel 3g/L, pH5.8) at least there are it is a kind of oneself know inhibit Agrobacterium growth antibiotic (cephalo is mould Element), the selective agent (step 3 of vegetable transformant is not added：Recovering step).Preferably, rataria is having antibiotic but is not selecting It is cultivated on the solid medium of agent, to eliminate Agrobacterium and provide convalescence for infected cell.Then, the rataria of inoculation is containing choosing Select the transformed calli (step 4 that culture and growth selection on the culture medium of agent (hygromycin)：Select step).Preferably, Rataria is in screening solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 5g/L, the tide for having selective agent Mycin 50mg/L, sucrose 30g/L, 2,4- dichlorphenoxyacetic acids (2,4-D) 1mg/L, plant gel 3g/L, pH5.8) on cultivate, Lead to the cell selective growth of conversion.Then, callus regeneration is into plant (step 5：Regeneration step), it is preferable that containing The callus grown on the culture medium of selective agent is cultivated on solid medium (MS differential mediums and MS root medias) With aftergrowth.

It screens obtained resistant calli and is transferred to the MS differential mediums (MS salt 4.3g/L, MS vitamin, cheese Plain 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, plant gel 3g/L, pH5.8) on, differentiation is cultivated at 25 DEG C.Point It dissolves the seedling come and is transferred to the MS root medias (MS salt 2.15g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, plant gel 3g/L, pH5.8) on, it is cultivated at 25 DEG C to about 10cm high, moves to greenhouse training It supports to solid.In the greenhouse, it cultivates 16 hours at 28 DEG C, is cultivated 8 hours at 20 DEG C daily.

2nd, Transgenic Sorghum plant is obtained

Turn with reference to the sorghum of Molecular Biology and Genetic Engineering ISSN 2053-5767 Change method.The seed of sorghum variety APKI is collected, and is rinsed for several times with clear water；It is soaked in tween-20 immersion fluids 5 minutes；It It is suspended and cleaned with distilled water afterwards, and is dry in draught cupboard；The surface of the seed 70% (v/v) ethanol disinfection 30 seconds, is and then used 0.1% (w/v) HgCl₂Disinfection 6 minutes；It is cleaned 5-6 times with distilled water again；Seed is laid on containing MS bases solid medium (pH5.8) in culture dish, culture dish is placed in temperature is for 24 ± 2 DEG C, relative humidity 70%, photoperiod (light dark) 12:In between 12 culture；After 3-5 days, germination takes stem apex explant to be soaked in Agrobacterium 30 minutes；It takes out after impregnating Explant be placed on sterilized filter paper；It is co-cultured 72 hours under dark condition；Callus, which is used, contains 500mg/L cephalos The sterile water wash of mycin 3-5 times；Callus after cleaning is transferred on inducing culture and is cultivated 7 days；Transfer to sieve It selects on culture medium 2-3 weeks, repeats screening 3 times；Kanamycin-resistant callus tissue is transferred on regeneration culture medium；Blade etc. is regenerated, by seedling It moves on root media, after under growth root in transplanting to greenhouse.Culture medium prescription refers to Molecular Biology and Genetic Engineering ISSN 2053-5767, wherein selective agent are replaced according to used in transgenic carrier of the present invention For hygromycin.The height for thereby is achieved and be transferred to the sorghum plant of Cry1A.105 nucleotide sequences, being transferred to Cry2Ab nucleotide sequences Fine strain of millet plant and the sorghum plant for being transferred to Cry1A.105-Cry2Ab nucleotide sequences；Simultaneously using wild type sorghum plant as pair According to.

3rd, transgenic sugarcane plant is obtained

Page 22 to page 24 of the bright academic dissertation of master Lee of 2012 grades of method for transformation Primary Reference Guangxi University.Take sugarcane top Newborn stipes removes the sugarcane tip and leaf sheath, leaves stem apex growth cone and lobus cardiacus stem section.On superclean bench, with 75% (v/v) wine Smart cotton balls carries out cleaning disinfection to surface, carefully peels off lobus cardiacus outer layer with sterilized tweezers, takes the lobus cardiacus of 5-7cm long of centre Section, the crosscutting thin slice into thickness about 3mm is inoculated on inducing culture, under the conditions of 26 DEG C of temperature, dark culturing 20 days.Select life Long all right callus is transferred to preculture 4 days in new MS culture mediums, is used further to conversion test；During conversion, super Callus to be infected with sterilized tweezers is pressed from both sides out in net workbench, is placed on above clean filter paper and stands 2 hours, until Surface is completely dried, and is slightly shunk；Dry sugarcane callus is put into infect in liquid and is impregnated 30 minutes, while be placed on shaking table It is upper slowly to shake；Callus is pulled out and is transferred on clean filter paper, in superclean bench drying completely, until callus Tissue surface is dry, without moisture film.Callus lines are cut into the fritter of 0.6*0.6cm, are transferred to later containing 100 μm of ol/L second In the MR solid mediums of acyl syringone (AS), 23 DEG C of temperature light culture 3 days；Callus after infecting is pressed from both sides out, is placed in filter It dries up on superclean bench on paper, after material surface is dry and comfortable, transfers material into containing 500mg/L cephalosporins and tide In the differential medium of mycin screening；A subculture was replaced every 2 weeks, during which contaminated callus is rejected, works as children When seedling is about 3cm high, it is transferred to root induction in the root media containing hygromycin selection agent.It thereby is achieved and be transferred to The sugarcane plant of Cry1A.105 nucleotide sequences, the sugarcane plant for being transferred to Cry2Ab nucleotide sequences and it is transferred to Cry1A.105- The sugarcane plant of Cry2Ab nucleotide sequences；Simultaneously using wild type sugarcane plant as control.

Fourth embodiment verifies transfer-gen plant with TaqMan

The corn plant for take respectively and be transferred to the plant of Cry1A.105 nucleotide sequences, being transferred to Cry2Ab nucleotide sequences Strain and be transferred to Cry1A.105-Cry2Ab nucleotide sequences plant blade about 100mg as sample, with Qiagen's DNeasy Plant Maxi Kit extract its genomic DNA, are detected by Taqman fluorescence probe quantitative PCR methods The copy number of Cry1A.105 genes and Cry2Ab genes.Simultaneously using wild rice plant as compare, according to the method described above into Row detection and analysis.Experiment sets 3 repetitions, is averaged.

The specific method for detecting Cry1A.105 genes and Cry2Ab gene copy numbers is as follows：

Step 11 takes and is transferred to the plant of Cry1A.105 nucleotide sequences, is transferred to Cry2Ab nucleotide sequences respectively The blade of plant, the plant for being transferred to Cry1A.105-Cry2Ab nucleotide sequences and wild-type corn plant is each 100mg, is ground into homogenate in mortar with liquid nitrogen respectively, and each sample takes 3 repetitions；

Step 12, the genomic DNA that above-mentioned sample is extracted using the DNeasy Plant Mini Kit of Qiagen, specifically Method refers to its product description；

Step 13, the genomic DNA concentration that above-mentioned sample is measured with NanoDrop 2000 (Thermo Scientific)；

Step 14, the genomic DNA concentration of the above-mentioned sample of adjustment to same concentration value, the ranging from 80- of the concentration value 100ng/μl；

Step 15, the copy number using Taqman fluorescence probe quantitative PCR methods identification sample, with by being copied known to identification The sample of shellfish number is as standard items, and using the sample of wild-type corn plant as control, each 3 repetitions of sample take it average Value；Fluorescence quantification PCR primer and probe sequence are respectively：

Following primer and probe is used for detecting Cry1A.105 nucleotide sequences：

Primer 1：SEQ ID NO in GCGCATCCAGTTCAACGAC such as sequence table:Shown in 8；

Primer 2：SEQ ID NO in GTTCTGGACGGCGAAGAGTG such as sequence table:Shown in 9；

Probe 1：SEQ ID NO in TGAACAGCGCCCTGACCACCG such as sequence table:Shown in 10；

Following primer and probe is used for detecting Cry2Ab nucleotide sequences：

Primer 3：SEQ ID NO in CTGATACCCTTGCTCGCGTC such as sequence table:Shown in 11；

Primer 4：SEQ ID NO in CACTTGGCGGTTGAACTCCTC such as sequence table:Shown in 12；

Probe 2：SEQ ID NO in CGCTGAGCTGACGGGTCTGCAAG such as sequence table:Shown in 13；

PCR reaction systems are：

50 × the primer/probe mixture includes each 45 μ l of each primer of 1mM concentration, 50 μ of probe of 100 μM of concentration L and 860 μ l 1 × TE buffer solutions, and at 4 DEG C, be housed in amber tube.

PCR reaction conditions are：

Data are analyzed using SDS2.3 softwares (Applied Biosystems).

The experimental results showed that Cry1A.105 nucleotide sequences, Cry2Ab nucleotide sequences and Cry1A.105-Cry2Ab cores Oneself is integrated into the genome of detected plant, and be transferred to Cry1A.105 nucleotide sequences nucleotide sequence Plant, the plant for being transferred to Cry2Ab nucleotide sequences and the corn for being transferred to Cry1A.105-Cry2Ab nucleotide sequences The transgenic corn plant that plant is singly copied.

According to the above-mentioned method with TaqMan verification transgenic corn plants, to Transgenic Sorghum plant and transgenic sugarcane Plant is detected analysis.The experimental results showed that Cry1A.105 nucleotide sequences, Cry2Ab nucleotide sequences and Oneself is integrated into the genome of detected sorghum plant and sugarcane plant to Cry1A.105-Cry2Ab nucleotide sequences respectively In, and be transferred to the sorghum plant of Cry1A.105 nucleotide sequences, the sorghum plant for being transferred to Cry2Ab nucleotide sequences, be transferred to The sorghum plant of Cry1A.105-Cry2Ab nucleotide sequences, is transferred to the sugarcane plant for being transferred to Cry1A.105 nucleotide sequences The sugarcane plant of Cry2Ab nucleotide sequences obtains with the sugarcane plant for being transferred to Cry1A.105-Cry2Ab nucleotide sequences The transfer-gen plant singly copied.

The insect resistant effect detection of 5th embodiment, transfer-gen plant

By the plant for being transferred to Cry1A.105 nucleotide sequences, the plant that is transferred to Cry2Ab nucleotide sequences, turn Enter the plant of Cry1A.105-Cry2Ab nucleotide sequences；It is transferred to the sorghum plant of Cry1A.105 nucleotide sequences, is transferred to The sorghum plant of Cry2Ab nucleotide sequences, the sorghum plant for being transferred to Cry1A.105-Cry2Ab nucleotide sequences；It is transferred to The sugarcane plant of Cry1A.105 nucleotide sequences, is transferred to Cry1A.105- at the sugarcane plant for being transferred to Cry2Ab nucleotide sequences The sugarcane plant of Cry2Ab nucleotide sequences；Corresponding wild-type corn plant, sorghum plant and sugarcane plant, Yi Jijing Taqman is accredited as non-transgenic plant, sorghum plant and sugarcane plant pair striped stem borer and carries out insect resistant effect detection.

1st, the insect resistant effect detection of transgenic corn plant

The corn plant for take respectively and be transferred to the plant of Cry1A.105 nucleotide sequences, being transferred to Cry2Ab nucleotide sequences Strain, wild-type corn plant and is accredited as non-at the plant for being transferred to Cry1A.105-Cry2Ab nucleotide sequences through Taqman The fresh blade of the plant (expansion tender leaf) of transgenosis, totally and with gauze by the water on blade is inhaled with aseptic water washing It is dry, then maize leaf is cut into the strip of about 1cm × 2cm, take 1 cut after strip blade be put into round plastic culture On the moisturizing filter paper of ware bottom, 10 striped stem borers (newly hatched larvae) are put in each culture dish, after worm examination culture dish capping, in temperature 22-26 DEG C of degree, relative humidity 70%-80%, photoperiod (light dark) 0:After being placed 3 days under conditions of 24, according to striped stem borer children Three worm development progress, the death rate and blade injury rate indexs obtain resistance total score (full marks 300 divide)：Resistance total score=100 × The death rate+[100 × death rate+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/and connect worm sum)+ 10 × and (negative control borer population/connect worm sum)]+100 × (1- blade injuries rate).It is transferred to totally the 3 of Cry1A.105 nucleotide sequences A transformation event strain (S1, S2 and S3) is transferred to totally 3 transformation event strains (S4, S5 and S6) of Cry2Ab nucleotide sequences, Totally 3 transformation event strains (S7, S8 and S9) of Cry1A.105-Cry2Ab nucleotide sequences are transferred to, are accredited as through Taqman non- (NGM1) of transgenosis totally 1 strain, (CK1) of wild type totally 1 strain；3 plants are selected to be tested from each strain, per plant weight It is 6 times multiple.As a result as shown in table 1 and Fig. 3.

Table 1, the pest-resistant experimental result of transgenic corn plant inoculation striped stem borer

Table 1 the result shows that：It is transferred to the plant of Cry1A.105 nucleotide sequences, is transferred to Cry2Ab nucleotide sequences Plant and be transferred to the plants of Cry1A.105-Cry2Ab nucleotide sequences and striped stem borer is respectively provided with preferably kills Worm effect, the average mortality of striped stem borer substantially up to more than 70%, resistance total score also substantially 250 points with On；And the resistance total score of non-transgenic plant and wild-type corn plant is accredited as generally on 20 points of left sides through Taqman It is right.

Fig. 3's the result shows that：Compared with wild-type corn plant, be transferred to Cry1A.105 nucleotide sequences plant, The plant that is transferred to Cry2Ab nucleotide sequences and the plant for being transferred to Cry1A.105-Cry2Ab nucleotide sequences can be with The mortality of striped stem borer newly hatched larvae is caused, and larvae development progress of surviving on a small quantity is caused greatly to inhibit, development is slow It is slow, while show extremely weak vitality；And it is transferred to the plant of Cry1A.105 nucleotide sequences, is transferred to Cry2Ab nucleosides The plant of acid sequence is generally only slightly damaged with the plant for being transferred to Cry1A.105-Cry2Ab nucleotide sequences Wound, by feeding area very little, blade injury rate is below 10%.

Thus it proves be transferred to the plant of Cry1A.105 nucleotide sequences, be transferred to the corn of Cry2Ab nucleotide sequences It plant and is transferred to the plants of Cry1A.105-Cry2Ab nucleotide sequences and all shows the activity of highly resistance striped stem borer, it is this The growth that activity is enough to striped stem borer generates ill effect so as to which it be made to be controlled in field.Simultaneously by controlling sorghum item The brill moth of snout moth's larva causes harm, it is also possible to reduce the generation of disease on corn, greatly improve the yield and quality of corn.

2nd, the insect resistant effect detection of transgenic sugarcane plant

The sugarcane plant for being transferred to Cry1A.105 nucleotide sequences, the sugarcane planting for being transferred to Cry2Ab nucleotide sequences are taken respectively Strain, wild type sugarcane plant and is accredited as non-at the sugarcane plant for being transferred to Cry1A.105-Cry2Ab nucleotide sequences through Taqman The fresh blade of the sugarcane plant (expansion tender leaf) of transgenosis, totally and with gauze by the water on blade is inhaled with aseptic water washing It is dry, then Sugarcane Leaves are cut into the strip of about 1cm × 2cm, take 1 cut after strip blade be put into round plastic culture On the moisturizing filter paper of ware bottom, 10 striped stem borers (newly hatched larvae) are put in each culture dish, after worm examination culture dish capping, in temperature 22-26 DEG C of degree, relative humidity 70%-80%, photoperiod (light dark) 0:After being placed 3 days under conditions of 24, according to striped stem borer children Three worm development progress, the death rate and blade injury rate indexs obtain resistance total score：(full marks 300 divide)：Resistance total score=100 × the death rate+[100 × death rate+90 × (just incubate borer population/connect worm sum)+60 × (just incubating-negative control borer population/, it is total to connect worm Number)+10 × (negative control borer population/connect worm sum)]+100 × (1- blade injuries rate).It is transferred to Cry1A.105 nucleotide sequences Totally 3 transformation event strains (S10, S11 and S12), be transferred to totally 3 transformation event strains of Cry2Ab nucleotide sequences (S13, S14 and S15), be transferred to Cry1A.105-Cry2Ab nucleotide sequences totally 3 transformation event strains (S16, S17 and S18), it is accredited as non-transgenic (NGM2) totally 1 strain through Taqman, (CK2) of wild type totally 1 strain；From each strain System selects 3 plants to be tested, and every plant is repeated 6 times.The results are shown in Table 2.

Table 2, the pest-resistant experimental result of transgenic sugarcane plant inoculation striped stem borer

Table 2 the result shows that：It is transferred to the sugarcane plant of Cry1A.105 nucleotide sequences, is transferred to Cry2Ab nucleotide sequences Sugarcane plant and be transferred to the sugarcane plant pair striped stem borers of Cry1A.105-Cry2Ab nucleotide sequences and be respectively provided with and preferably kill Worm effect, the average mortality of striped stem borer substantially more than 80%, resistance total score also substantially 270 points with On；And the resistance total score of non-transgenic sugarcane plant and wild type sugarcane plant is accredited as generally on 50 points of left sides through Taqman It is right.

Compared with wild type sugarcane plant, it is transferred to the sugarcane plant of Cry1A.105 nucleotide sequences, is transferred to Cry2Ab nucleosides At the beginning of the sugarcane plant of acid sequence can cause striped stem borer with the sugarcane plant for being transferred to Cry1A.105-Cry2Ab nucleotide sequences The mortality of larva is incubated, and larvae development progress of surviving on a small quantity is caused significantly to inhibit, growth retardation shows simultaneously Go out weaker vitality, and be transferred to the sugarcane plant of Cry1A.105 nucleotide sequences, be transferred to the sugarcane of Cry2Ab nucleotide sequences Plant and the sugarcane plant of Cry1A.105-Cry2Ab nucleotide sequences is transferred to generally only by slight damage, by feeding area Very little, blade injury rate is below 10%.

Thus it proves be transferred to the sugarcane plant of Cry1A.105 nucleotide sequences, be transferred to the sugarcane of Cry2Ab nucleotide sequences It plant and is transferred to the sugarcane plant of Cry1A.105-Cry2Ab nucleotide sequences and all shows the activity of highly resistance striped stem borer, it is this The growth that activity is enough to striped stem borer generates ill effect so as to which it be made to be controlled in field.Simultaneously by controlling sorghum item The brill moth of snout moth's larva causes harm, it is also possible to reduce the generation of disease on sugarcane, greatly improve the yield and quality of sugarcane.

3rd, the insect resistant effect detection of Transgenic Sorghum plant

The sorghum plant for take respectively and be transferred to the sorghum plant of Cry1A.105 nucleotide sequences, being transferred to Cry2Ab nucleotide sequences Strain, wild type sorghum plant and is accredited as non-at the sorghum plant for being transferred to Cry1A.105-Cry2Ab nucleotide sequences through Taqman The fresh blade of the sorghum plant (expansion tender leaf) of transgenosis, totally and with gauze by the water on blade is inhaled with aseptic water washing It is dry, then Sorghum Leaves are cut into the strip of about 1cm × 2cm, take 1 cut after strip blade be put into round plastic culture On the moisturizing filter paper of ware bottom, 10 striped stem borers (newly hatched larvae) are put in each culture dish, after worm examination culture dish capping, in temperature 22-26 DEG C of degree, relative humidity 70%-80%, photoperiod (light dark) 0:After being placed 3 days under conditions of 24, according to striped stem borer children Three worm development progress, the death rate and blade injury rate indexs obtain resistance total score (full marks 300 divide)：Resistance total score=100 × The death rate+[100 × death rate+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/and connect worm sum)+ 10 × and (negative control borer population/connect worm sum)]+100 × (1- blade injuries rate).It is transferred to totally the 3 of Cry1A.105 nucleotide sequences A transformation event strain (S19, S20 and S21) is transferred to totally 3 transformation event strains (S22, S23 of Cry2Ab nucleotide sequences And S24), totally 3 transformation event strains (S25, S26 and S27) of Cry1A.105-Cry2Ab nucleotide sequences are transferred to, are passed through Taqman is accredited as non-transgenic (NGM3) totally 1 strain, (CK3) of wild type totally 1 strain；3 plants are selected from each strain It is tested, every plant is repeated 6 times.The results are shown in Table 3.

Table 3, the pest-resistant experimental result of Transgenic Sorghum plant inoculation striped stem borer

Table 3 the result shows that：It is transferred to the sorghum plant of Cry1A.105 nucleotide sequences, is transferred to Cry2Ab nucleotide sequences Sorghum plant and be transferred to the sorghum plants of Cry1A.105-Cry2Ab nucleotide sequences and striped stem borer is respectively provided with preferably kills Worm effect, the average mortality of striped stem borer substantially more than 70%, resistance total score also substantially 270 points with On；And the resistance total score of non-transgenic sorghum plant and wild type sorghum plant is accredited as generally on 20 points of left sides through Taqman It is right.

Compared with wild type sorghum plant, it is transferred to the sorghum plant of Cry1A.105 nucleotide sequences, is transferred to Cry2Ab nucleosides At the beginning of the sorghum plant of acid sequence can cause striped stem borer with the sorghum plant for being transferred to Cry1A.105-Cry2Ab nucleotide sequences The mortality of larva is incubated, and larvae development progress of surviving on a small quantity is caused significantly to inhibit, growth retardation shows simultaneously Go out very weak vitality, and be transferred to the sorghum plant of Cry1A.105 nucleotide sequences, the sorghum for being transferred to Cry2Ab nucleotide sequences Plant and the sorghum plants of Cry1A.105-Cry2Ab nucleotide sequences is transferred to generally only by slight damage, by feeding area Very little, blade injury rate is below 10%.

Thus it proves be transferred to the sorghum plant of Cry1A.105 nucleotide sequences, be transferred to the sorghum of Cry2Ab nucleotide sequences It plant and is transferred to the sorghum plants of Cry1A.105-Cry2Ab nucleotide sequences and all shows the activity of highly resistance striped stem borer, it is this The growth that activity is enough to striped stem borer generates ill effect so as to which it be made to be controlled in field.Simultaneously by controlling sorghum item The brill moth of snout moth's larva causes harm, it is also possible to reduce the generation of disease on sorghum, greatly improve the yield and quality of sorghum.

Above-mentioned experimental result also shows to be transferred to the plant of Cry1A.105 nucleotide sequences, is transferred to Cry2Ab nucleotide The plant of sequence, is transferred to Cry1A.105 nucleotides sequences at the plant for being transferred to Cry1A.105-Cry2Ab nucleotide sequences The sugarcane plant of row, is transferred to Cry1A.105-Cry2Ab nucleotide sequences at the sugarcane plant for being transferred to Cry2Ab nucleotide sequences Sugarcane plant, the sorghum plant for being transferred to Cry1A.105 nucleotide sequences, the sorghum plant for being transferred to Cry2Ab nucleotide sequences and turn Enter the sorghum plants of Cry1A.105-Cry2Ab nucleotide sequences to control/prevention of striped stem borer apparently because plant in itself Cry1A.105 albumen can be generated, so, it is well known to those skilled in the art, according to Cry1A.105 albumen to the phase of striped stem borer Same toxic action can generate the similar transfer-gen plant for expressing Cry1A.105 albumen and can be used in control/prevention sorghum item The harm of snout moth's larva.Cry1A.105 albumen includes but not limited to go out amino acid sequence given in specific embodiment in the present invention Cry1A.105 albumen, while transfer-gen plant can also generate at least one second of desinsection different from Cry1A.105 albumen Protein, such as Vip albuminoids, Cry albuminoids.

In conclusion the purposes of insecticidal proteins of the present invention can kill striped stem borer by being generated in plant Cry1A.105 albumen controls striped stem borer pest；Cultural control method, chemical prevention and control method and the object used with the prior art Reason control method is compared, and the present invention carries out plant the protection in the time of infertility, whole plant to prevent the infringement of striped stem borer pest, And pollution-free, noresidue, effect stability, thoroughly, it is simple, conveniently, it is economical.

It should be noted last that the above embodiments are merely illustrative of the technical solutions of the present invention and it is unrestricted, although ginseng The present invention is described in detail according to preferred embodiment, it will be understood by those of ordinary skill in the art that, it can be to the present invention Technical solution be modified or replaced equivalently, without departing from the spirit and scope of technical solution of the present invention.

Claims (33)

1. A kind of 1. method for controlling striped stem borer pest, which is characterized in that at least ingest Cry1A.105 including striped stem borer pest Albumen, the amino acid sequence such as SEQ ID NO of the Cry1A.105 albumen:Shown in 1.
2. 2. the method for control striped stem borer pest according to claim 1, which is characterized in that the Cry1A.105 albumen It is present in the host cell at least generating the Cry1A.105 albumen, the striped stem borer pest passes through the host that ingests Cell is at least contacted with the Cry1A.105 albumen.
3. 3. the method for control striped stem borer pest according to claim 2, which is characterized in that the Cry1A.105 albumen It is present in the bacterium or genetically modified plants at least generating the Cry1A.105 albumen, the striped stem borer pest is by ingesting The tissue of the bacterium or the genetically modified plants is at least contacted with the Cry1A.105 albumen, the striped stem borer after contact Pest growth is suppressed and/or leads to death, to realize the control for endangering striped stem borer plant.
4. 4. the method for control striped stem borer pest according to claim 3, which is characterized in that the plant is corn, height Fine strain of millet, sugarcane, grain, fiber crops or Semen Coicis.
5. 5. it is according to claim 3 or 4 control striped stem borer pest method, which is characterized in that the contact procedure it Preceding step is plant of the plantation containing the polynucleotides for encoding the Cry1A.105 albumen.
6. 6. the method for control striped stem borer pest according to claim 5, which is characterized in that the Cry1A.105 albumen Nucleotide sequence such as SEQ ID NO:Nucleotide sequence shown in 2.
7. 7. the method for control striped stem borer pest according to claim 6, which is characterized in that the plant further includes at least A kind of second of nucleotide of the nucleotide for being different from encoding the Cry1A.105 albumen.
8. 8. the method for control striped stem borer pest according to claim 7, which is characterized in that second of the nucleotide is compiled Code Cry classes insect-killing protein, Vip classes insect-killing protein, protease inhibitors, agglutinin, alpha-amylase or peroxidase.
9. 9. the method for control striped stem borer pest according to claim 8, which is characterized in that second of the nucleotide is compiled Code Cry2Ab albumen.
10. 10. the method for control striped stem borer pest according to claim 9, which is characterized in that the Cry2Ab albumen Amino acid sequence such as SEQ ID NO:Amino acid sequence shown in 3.
11. 11. the method for control striped stem borer pest according to claim 10, which is characterized in that second of the nucleotide Such as SEQ ID NO:Nucleotide sequence shown in 4.
12. 12. the method for control striped stem borer pest according to claim 7, which is characterized in that second of the nucleotide To inhibit the dsRNA of important gene in target insect pests.
13. 13. it is according to claim 5 control striped stem borer pest method, which is characterized in that the plant further include to A kind of second of nucleotide of few nucleotide for being different from encoding the Cry1A.105 albumen.
14. 14. the method for control striped stem borer pest according to claim 13, which is characterized in that second of the nucleotide Encode Cry classes insect-killing protein, Vip classes insect-killing protein, protease inhibitors, agglutinin, alpha-amylase or peroxidase.
15. 15. the method for control striped stem borer pest according to claim 14, which is characterized in that second of the nucleotide Encode Cry2Ab albumen.
16. 16. the method for control striped stem borer pest according to claim 15, which is characterized in that the Cry2Ab albumen Amino acid sequence such as SEQ ID NO:Amino acid sequence shown in 3.
17. 17. the method for control striped stem borer pest according to claim 16, which is characterized in that second of the nucleotide Such as SEQ ID NO:Nucleotide sequence shown in 4.
18. 18. the method for control striped stem borer pest according to claim 13, which is characterized in that second of the nucleotide To inhibit the dsRNA of important gene in target insect pests.
19. 19. the method for control striped stem borer pest according to claim 3 or 4, which is characterized in that the plant further includes Second of nucleotide of at least one nucleotide for being different from encoding the Cry1A.105 albumen.
20. 20. the method for control striped stem borer pest according to claim 19, which is characterized in that second of the nucleotide Encode Cry classes insect-killing protein, Vip classes insect-killing protein, protease inhibitors, agglutinin, alpha-amylase or peroxidase.
21. 21. the method for control striped stem borer pest according to claim 20, which is characterized in that second of the nucleotide Encode Cry2Ab albumen.
22. 22. the method for control striped stem borer pest according to claim 21, which is characterized in that the Cry2Ab albumen Amino acid sequence such as SEQ ID NO:Amino acid sequence shown in 3.
23. 23. the method for control striped stem borer pest according to claim 22, which is characterized in that second of the nucleotide Such as SEQ ID NO:Nucleotide sequence shown in 4.
24. 24. the method for control striped stem borer pest according to claim 19, which is characterized in that second of the nucleotide To inhibit the dsRNA of important gene in target insect pests.
25. 25. the method for control striped stem borer pest according to claim 3 or 4, which is characterized in that the Cry1A.105 The nucleotide sequence of albumen such as SEQ ID NO:Nucleotide sequence shown in 2.
26. 26. it is according to claim 25 control striped stem borer pest method, which is characterized in that the plant further include to A kind of second of nucleotide of few nucleotide for being different from encoding the Cry1A.105 albumen.
27. 27. the method for control striped stem borer pest according to claim 26, which is characterized in that second of the nucleotide Encode Cry classes insect-killing protein, Vip classes insect-killing protein, protease inhibitors, agglutinin, alpha-amylase or peroxidase.
28. 28. the method for control striped stem borer pest according to claim 27, which is characterized in that second of the nucleotide Encode Cry2Ab albumen.
29. 29. the method for control striped stem borer pest according to claim 28, which is characterized in that the Cry2Ab albumen Amino acid sequence such as SEQ ID NO:Amino acid sequence shown in 3.
30. 30. the method for control striped stem borer pest according to claim 29, which is characterized in that second of the nucleotide Such as SEQ ID NO:Nucleotide sequence shown in 4.
31. 31. the method for control striped stem borer pest according to claim 26, which is characterized in that second of the nucleotide To inhibit the dsRNA of important gene in target insect pests.
32. 32. the method for control striped stem borer pest according to claim 1 or 2, which is characterized in that the Cry1A.105 The nucleotide sequence of albumen such as SEQ ID NO:Nucleotide sequence shown in 2.
33. 33. a kind of purposes of Cry1A.105 protein control striped stem borer pest, wherein, the amino of the Cry1A.105 albumen Acid sequence such as SEQ ID NO:Amino acid sequence shown in 1.