CN104818262B - A kind of method for carrying out polygonin bioconversion using heat-resisting beta-glucosidase and its mutant - Google Patents
A kind of method for carrying out polygonin bioconversion using heat-resisting beta-glucosidase and its mutant Download PDFInfo
- Publication number
- CN104818262B CN104818262B CN201510203484.4A CN201510203484A CN104818262B CN 104818262 B CN104818262 B CN 104818262B CN 201510203484 A CN201510203484 A CN 201510203484A CN 104818262 B CN104818262 B CN 104818262B
- Authority
- CN
- China
- Prior art keywords
- beta
- glucosidase
- polygonin
- resveratrol
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2445—Beta-glucosidase (3.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/22—Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01021—Beta-glucosidase (3.2.1.21)
Abstract
The application of resveratrol is converted into polygonin the invention discloses a kind of mutant N223T, G224F and N223T/G224F of heat-resisting β glucuroides.A kind of mutant N223T, G224F and N223T/G224F of heat-resisting β glucuroides, amino acid sequence such as SEQ：Shown in ID NO.1, ID NO.2 and ID NO.3；Resveratrol is prepared using heat-resisting β glucuroides and its mutant hydrolysis polygonin of the invention, with respect to its wild-type enzyme, has transformation efficiency high, byproduct of reaction is few, and yield and purity are high, isolate and purify the advantages that easy, chemical contamination is few.
Description
Technical field
The present invention relates to biological technical field, in particular relate to a kind of heat-resisting beta-glucosidase enzyme mutant N223T,
G224F and N223T/G224F, and the enzyme and its mutant are converted into the application in resveratrol in polygonin.
Technical background
Resveratrol is that a kind of active polyphenol class material has anti-oxidant, anti-radical action, auspicious hard to causing artery congee
Change and each kinds of oxidation reaction of thrombosis plays inhibitory action, resveratrol has been cited as the most promising medicine of anti-cardiovascular anticancer
One of thing.Resveratrol is present in black false hellebore, giant knotweed and Grape Skin more, its usual content is relatively low, white in such as dry giant knotweed rhizome
Black false hellebore alcohol content is only 0.1%-0.2%, and the content of polygonin is apparently higher than resveratrol, is about 2% or so.Research hair
Existing, the polygonin and arctiin of glycoside forms do not have optimal physiological activity state, must be in the effect of beta-glucosidase
Under change into the resveratrol of glucoside n-ary form n and arctigenin and drug effect could be played by absorption.Therefore, if polygonin is turned
Resveratrol is melted into, resveratrol production yield can be greatly improved, its bioavailability is improved, reduce cost.Prepare at present white
The method of veratryl alcohol mainly has：Acid, Base hydrolysis method and enzyme hydrolysis method.Since the application of soda acid exists to glucoside member destructiveness greatly,
The shortcomings of pollution is big, and purpose is poor, therefore, enzyme hydrolysis method have the characteristics that efficient, safety, ecology and environmental protection are great Bai lamb's-quarters with it
Desirable route prepared by reed alcohol and arctigenin.Old snow perfume (or spice) et al. discloses a kind of resveratrol bioconversion bacterium and carries out white black false hellebore
The method (CN201210188784) of alcohol bioconversion；The white lamb's-quarters of high-purity is prepared to the open one kind of pole pricker et al. enzyme process from giant knotweed
The method (CN201210432150) of reed alcohol；Li Zhi equality people disclose a kind of preparation method of high-purity resveratrol will be former
Material medicinal material giant knotweed crushes the addition complex enzyme formulation after ethanol drawer and carries out enzymolysis acquisition high-purity resveratrol
(CN201310725682)；Yellow Li Feng people discloses a kind of new hydrolysis polygonin and prepares the beta-glucosidase of resveratrol, compiles
Code gene, carrier, engineering bacteria and its application (CN201210017857)；The open one kind in woods Yuanshan mountain et al. utilizes microbial strains spine
Complex enzyme prepared by spore aspergillus (Aspergillus.aculeatusCGMCCNo.3876) and its fermentation carries out the white lamb's-quarters of bioconversion
Reed alcohol glycosides is the method (CN200910234069) of resveratrol.Although related application is more, still fail to solve very well
The problem of certainly transformation time is grown, and zymolyte specificity is not high, and yield is low and of high cost.
The heat endurance of enzyme is directly related to the service life of enzyme, so as to determine the application efficiency of enzyme and the value of enzyme.Pole
Hold the produced beta-glucosidases of thermophilic robe Pseudomonas Thermotoga (Tm-BglA) to belong to hydrolase family 1, kept the temperature at 95 DEG C
6h still retains 60% activity, has high heat resistance, it has in bioconversion reduces risk of pollution, accelerates reaction speed
Degree, improve the advantages that zymolyte solubility and higher anti-chemical modification, while can realize that the hot water of high concentration of substrate is taken out
Carry and enzyme hydrolysis and the bio-conversion process deposited, great commercial application potentiality.But the substrate of wild type Tm-BglA hydrolysises
Scope is wide, including cellobiose, lactose, salicin, ursin, alkyl glycosides, p-nitrophenol-β-D-Glucose glycosides and to nitre
The sugared lactoside of base phenol-β-D-Fructose glycosides, p-nitrophenol-β-D- half, daidzin, genistin, malonyl daidzin, the third two
Acyl genistin, laminaribiose and sophorose, if the substrate specificity that Tm-BglA is converted into polygonin resveratrol can be improved,
Will greatly improve the transformation efficiency of polygonin and arctiin, reduce byproduct of reaction, so improve the yield of resveratrol with
Purity, reduces production cost.
Scientific investigations showed that：The resveratrol water solubility of free form is worst, is substantially insoluble in water, and glucoside type
Polygonin is soluble in hot water, and at 60-95 DEG C, its solubility is dramatically increased with the rise of temperature, therefore.The present invention is directed to
This characteristic, heat-resisting beta-glucosidase is used in the heat extracting taking technique of polygonin raw material, converted in extracting so that
Polygonin once removed glycosyl and then be converted into resveratrol from Solid raw materials by dissolution, is so directly extracted with 80% ethanol
Centrifugation gained precipitation can obtain resveratrol.Because high temperature resistant beta-glucosidase stability is high, enzyme is remaining living in gained raffinate
Property and active ingredient can reuses.
The content of the invention
The present invention by the beta-glucosidase Tm-BglA of the family 1 to extreme thermophilic robe Pseudomonas (Thermotiga) with
Cellotetrose carries out molecular docking, and the aglycon binding site prediction of Tm-BglA, selection are located in Tm-BglA protein structures
Two amino acid (N223 and G224) on 5th beta sheet stock carry out single mutation and double mutation, will be located at 223 and 224 respectively
Asparagine (N) and glycine (G) on position are substituted for threonine (T) and phenylalanine (F) respectively, obtain mutator, so
Be inserted into expression plasmid afterwards and convert host and obtain recombination engineering, make its expression, obtain beta-glucosidase enzyme mutant N223T,
G224F and N223T/G224F, further by after these heat-resisting beta-glucosidase and its mutant hydrolysis polygonins, enzymolysis produces
Thing is found through high performance liquid chromatography detection analysis：Mutant enzyme N223T and G224F is converted into polygonin white after hydrolysis 10-20min
41.65% and 25.87% has been respectively increased in the efficiency of veratryl alcohol；Beta-glucosidase and its mutant N223T and G224F conversion
For resveratrol unit, conversion ratio respectively reaches 92.1%, 96.2%, 93.7% to polygonin per hour.
The application being converted into the invention discloses heat-resisting beta-glucosidase and its mutant in polygonin in resveratrol,
The heat-resisting beta-glucosidase refers to that source thermobacillus belong to 1 beta-glucosidase of glycoside hydrolase Families of Thermotiga
TbglA；Heat-resisting beta-glucosidase enzyme mutant is N223T, G224F and N223T/G224F, amino acid sequence such as SEQ：ID
Shown in NO.1, ID NO.2 and ID NO.3.
Present invention also offers a kind of method that polygonin bioconversion prepares resveratrol, be with using above-mentioned heat-resisting β-
Glucuroide and its mutant hydrolysis polygonin substrate obtain resveratrol.
Specifically method is：Sodium phosphate-citric acid solution that pH is 4.2-7.5, material are added into polygonin substrate
Liquor ratio is 1:2-10(g/mL)；It is 100-1000U/g substrates to add beta-glucosidase and its mutant, its additive amount, mixing
5min-2h uniformly is reacted after stirring at low speed at 60-95 DEG C, extracts reaction solution and is centrifuged under 4-10 DEG C and 4000rpm-8000rpm
10-20min, taking precipitate is spare, and supernatant is used as the dispensing water of lower batch of extraction；Into sediment add 3-10 times of volume and
Concentration is extracted while stirring for 75%-100% ethanol, is then filtered and is removed slag, and filtrate further obtains white through vacuum concentration
Veratryl alcohol product.
The present invention prepares the prominent of the beta-glucosidase of resveratrol by rite-directed mutagenesis acquisition high activity hydrolysis polygonin
Variation N223T, G224F and N223T/G224F, and high efficient expression is carried out to it, further through broken cell, heat treatment and centrifugation point
Polygonin is hydrolyzed from the crude enzyme liquid of obtained beta-glucosidase and mutant and obtains the single resveratrol product of component,
This not only eliminates a series of interference of other enzyme systems of donor bacterium symbiosis, but also its opposite wild-type enzyme, hydrolyzes polygonin
Activity, which respectively obtains, to be significantly improved, and has transformation efficiency high, and transformation time is short and byproduct of reaction is few, and product separation and purifying are held
Easily, the resveratrol product amount obtained is big and the advantages that purity is high.
Brief description of the drawings
The SDS-PAGE collection of illustrative plates .1 of Fig. 1 purifying beta-glucosidases and mutant N223T, G224F and N223T/G224F:
Wild type Tm-BglA, 2：N223T, 3：G224T, 4：N223T/G224F
Fig. 2 Tm-BglA and mutant N223T and G224F are converted into polygonin the hydrolysis process of resveratrol (80
DEG C and pH 6.2 time react 2min, 5min, 10min, 20min, 60min)
Fig. 3 Tm-BglA (B:Wild type) and mutant N223T (C) and G224F (D) converting giant knotweed glycosides prepare resveratrol
The HPLC collection of illustrative plates of product is (in 80 DEG C and pH 6.2 times reactions 60min, A：It is not enzyme)
Chromatographic condition：Instrument：Agilent HPLC-1100 type high performance liquid chromatographs；Chromatographic column：Agilent
ZORBAX-C18(4.6 × 150mm, 5 μm)；Detector：UV detector；Detection wavelength：303nm；Column temperature：30℃；Flow velocity：
1.0mL/min；Mobile phase：A phases are methanol, and B phases are 0.05% phosphoric acid-aqueous solution.Sample size is 10 μ L.Determined with retention time
Property, with peak area quantification, calculated with external standard method.Standard sample is purchased from Shanghai Sinopharm Chemical Reagent Co., Ltd..Wherein, protect
It is polygonin to stay time 3.2min, and retention time 4.5min is resveratrol.
Gradient program：
Embodiment
It is the specific embodiment that should be invented below, but present disclosure is not limited merely to this.
Embodiment 1:
According to the beta-glucosidase gene sequence design mutant primer of the family 1 of thermobacillus category (Thermotiga), tool
Body is：
N223T-N:AGTTTTCAATACCGGATATTTCGAACCTGCGAGT (SEQ ID NO.4) and N223T-C:
ATTCCGATCTTTCCATCTTTCACG(SEQ ID NO.5)；Select the wild type beta-glucosidase gene of category containing thermobacillus
Recombinant plasmid pET-20b-bglA (J Ind Microbiol Biotechnol, 2009,36:1401-1408) carried out for template
Inverse PCR amplification obtains the nucleotide fragments of the enzyme mutant gene containing beta-glucosidase, by phosphorylation, connection, conversion, and carries
Plasmid is taken, obtains the recombinant plasmid containing N223T nucleotide fragments, host is further converted and makes its expression, that is, obtain this hair
Bright beta-glucosidase enzyme mutant N223T.
Embodiment 2：
Substantially the same manner as Example 1, difference is that the primer is respectively：Sense primer is G224F-N:5’-
AGTTTTCAACAACTTCTATTTCGAACCTGCGAGT-3 ' (SEQ ID NO.6) and anti-sense primer are G224F-C:5’-
ATTCCGATCTTTCCATCTTTCACG-3’(SEQ ID NO.7)；To obtain the recombinant plasmid containing G224F nucleotide fragments,
Further conversion host makes its expression, that is, obtains the beta-glucosidase enzyme mutant G224F of the present invention.
Embodiment 3：
Substantially the same manner as Example 1, difference is that the primer is respectively：N223T/G224F-N:
AGTTTTCAATACCTTCTATTTCGAACCTGCGAGT (SEQ ID NO.8), anti-sense primer N223T/G224F-C:
ATTCCGATCTTTCCATCTTTCACG (SEQ ID NO.9), to obtain the restructuring matter containing N223T/G224F nucleotide fragments
Grain, further converts host and makes its expression, that is, obtain the beta-glucosidase enzyme mutant N223T/G224F of the present invention.
Embodiment 4：The culture of recombinant bacterium and the preparation of crude enzyme liquid：
By the recombinant plasmid transformed host containing beta-glucosidase gene and its mutant, 25~37 DEG C in the medium
Temperature culture is to IPTG or lactose after OD600 values 0.8-1.0, is added in a DEG C temperature-induced culture 6-10h, then by bacterium solution in 0-10
DEG C, centrifuge under the conditions of rotating speed 4000-6000rpm, sediment is washed with water 3 times, with 1/10 volume 0.02-0.5M pH6.0-
8.0 buffer solution is resuspended, and puts ultrasonication in ice-water bath or is crushed with high pressure, and the bacterium solution after crushing is in 60-70 DEG C of temperature conditionss
Lower heat treatment 10-20min, 10-30min is centrifuged under the conditions of 0-4 DEG C, 10000-13000rpm, takes supernatant up to β-glucose
The crude enzyme liquid of glycosides enzyme and its mutant.
Embodiment 5：The preparation and purification of enzyme
Crude enzyme liquid obtained as above is heat-treated 20min at 70 DEG C, is heat-treated and is carried out in water-bath, select it is heated fast,
Be heated evenly and container that heating surface area is big, and constantly gently rotate in heat treatment process triangular flask make crude enzyme liquid uniformly by
Heat.With 13 after heat treatment, 000 × g, 30min, after 4 DEG C remove albuminate, upper nickel affinity chromatography (Ni-NTA) column is purified
Beta-glucosidase and its mutant are obtained, concrete operations refer to Novagen companies Ni-NTA specifications, and purity of protein is by SDS-
PAGE identifies (Fig. 1).
Embodiment 6：The conversion of purifying beta-glucosidase and its mutant to polygonin
In sodium phosphate-citric acid solution that pH is 6.2, the polygonin for adding isometric 0.4mg/ml is water-soluble
Liquid, is uniformly mixed, then using the pure beta-glucosidase of gained and its mutant as catalyst, beta-glucosidase and its mutant
Final concentration of 2 μ g/ml mix after at 80 DEG C shaking table react 2min~60min, enzymolysis product is through high performance liquid chromatography detection
Analysis is found (Fig. 2)：With respect to its wild-type enzyme, mutant enzyme N223T and G224F is converted into polygonin white after hydrolysis 10-20min
41.65% and 25.87% has been respectively increased in the efficiency of veratryl alcohol, and the conversion ratio that its converting giant knotweed glycosides is converted into resveratrol is notable
Improve；4000rpm-8000rpm centrifugation 15min are finally extracted reaction solution, it is 80% to take precipitation to add 5 times of volumes and concentration thereto
Ethanol is extracted while stirring, is then filtered and is removed slag, and filtrate further obtains resveratrol product (figure through being concentrated in vacuo
3)。
Embodiment 7：Conversions of the purified mutant body N223T/G224F to polygonin
Substantially the same manner as Example 6, difference is that enzyme catalyst used is purified mutant body N223T/G224F, water
Solution polygonin reaction condition be：PH 5.0, soaking time 5min at 95 DEG C of temperature.
Embodiment 8：Crude enzyme liquid carries out bioconversion to the polygonin in giant knotweed dry powder
By without the brave dry powder worn into after giant knotweed impurity elimination more than 80 mesh of going mouldy, by material-water ratio 1:4 are dissolved in pH 6.2100mM phosphoric acid
Sodium buffer solution, is heated to 80 DEG C of crude enzyme liquids for adding 500U/g beta-glucosidases and its mutant of temperature, insulation is simultaneously while stirring
When stirring at low speed 1 is small, 4000rpm centrifugation 20min are then extracted reaction solution, taking precipitate is carried with 10 times of 80 DEG C of 80% ethanol of volume
2h is taken, then filters and removes slag, filtrate is further through vacuum freeze drying.
Embodiment 9：Conversion of the crude enzyme liquid to the polygonin in Grape Skin
Substantially the same manner as Example 9, difference is that hydrolysis polygonin substrate used is Grape Skin dry powder, used thick
Enzyme liquid is the crude enzyme liquid of mutant N223T, 60 DEG C of hydrolysising reacting temperature, when 5.5 times insulations 2 of pH are small, enzyme amount 800U/g.
Embodiment 10：Conversion of the crude enzyme liquid to the polygonin in peanut shell
Substantially the same manner as Example 9, difference is that hydrolysis polygonin substrate used is peanut shell dry powder, used thick
Enzyme liquid is the crude enzyme liquid of mutant G224F, and the reaction condition for hydrolyzing polygonin is：PH 7.0, at 75 DEG C of temperature, soaking time
60min。
Embodiment 11：Conversion of the crude enzyme liquid to Lhasa rhubarb rhizome polygonin
Substantially the same manner as Example 9, difference is that hydrolysis polygonin substrate used is Lhasa rhubarb rhizome raw material
Powder, crude enzyme liquid used are the crude enzyme liquid from mutant G224F, and the reaction condition for hydrolyzing polygonin is：PH 5.5,90 DEG C of temperature
Under, soaking time 30min.
Claims (3)
1. heat-resisting beta-glucosidase enzyme mutant is converted into the application in resveratrol in polygonin, it is characterised in that described is resistance to
Hot beta-glucosidase refers to that source thermobacillus belong to the 1 beta-glucosidase TbglA of glycoside hydrolase Families of Thermotiga；It is resistance to
Hot beta-glucosidase enzyme mutant is N223T, G224F and N223T/G224F, amino acid sequence such as SEQ：ID NO.1、SEQ：ID
NO.2 and SEQ：Shown in ID NO.3.
2. a kind of method that polygonin bioconversion prepares resveratrol, it is characterised in that using polygonin as substrate, heat-resisting β-
Resveratrol is made by enzymatic isolation method under the action of glucoside enzyme mutant；The heat-resisting beta-glucosidase refers to source
Thermobacillus belong to the 1 beta-glucosidase TbglA of glycoside hydrolase Families of Thermotiga；Heat-resisting beta-glucosidase enzyme mutant is
N223T, G224F and N223T/G224F, amino acid sequence such as SEQ：ID NO.1、SEQ：ID NO.2 and SEQ：ID NO.3 institutes
Show.
3. according to the method described in claim 2, it is characterized in that, into polygonin substrate add pH be 4.2-7.5 sodium phosphate-
Citric acid solution, solid-liquid ratio 1:2-10g/mL；Beta-glucosidase enzyme mutant is added, its additive amount is 100-1000U/
G substrates, are uniformly mixed and react 5min-2h after stirring at low speed at 60-95 DEG C, extract reaction solution in 4-10 DEG C and 4000rpm-
10-20min is centrifuged under 8000rpm, taking precipitate is spare, and supernatant is used as the dispensing water of lower batch of extraction；Add into sediment
Enter 3-10 times of volume and concentration is extracted while stirring for 75%-100% ethanol, then filter and remove slag, filtrate further passes through
Vacuum concentration obtains resveratrol product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510203484.4A CN104818262B (en) | 2015-04-24 | 2015-04-24 | A kind of method for carrying out polygonin bioconversion using heat-resisting beta-glucosidase and its mutant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510203484.4A CN104818262B (en) | 2015-04-24 | 2015-04-24 | A kind of method for carrying out polygonin bioconversion using heat-resisting beta-glucosidase and its mutant |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104818262A CN104818262A (en) | 2015-08-05 |
| CN104818262B true CN104818262B (en) | 2018-04-24 |
Family
ID=53728743
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510203484.4A Expired - Fee Related CN104818262B (en) | 2015-04-24 | 2015-04-24 | A kind of method for carrying out polygonin bioconversion using heat-resisting beta-glucosidase and its mutant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104818262B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112094835B (en) * | 2020-09-24 | 2022-09-06 | 江南大学 | Application of beta-glucosidase mutant |
| CN116751721B (en) * | 2023-07-18 | 2024-02-13 | 陕西省微生物研究所 | Lactobacillus plantarum 121-5 and application thereof in preparing resveratrol by converting polydatin |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103589702A (en) * | 2013-11-19 | 2014-02-19 | 南京市第一医院 | Application of heat-resistant beta-glucosidase and mutants thereof |
| CN103687947A (en) * | 2011-07-14 | 2014-03-26 | 东丽株式会社 | Mutant beta-glucosidase, enzyme composition for decomposing biomass, and method for producing sugar solution |
-
2015
- 2015-04-24 CN CN201510203484.4A patent/CN104818262B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103687947A (en) * | 2011-07-14 | 2014-03-26 | 东丽株式会社 | Mutant beta-glucosidase, enzyme composition for decomposing biomass, and method for producing sugar solution |
| CN103589702A (en) * | 2013-11-19 | 2014-02-19 | 南京市第一医院 | Application of heat-resistant beta-glucosidase and mutants thereof |
Non-Patent Citations (2)
| Title |
|---|
| Comparison of three thermostable β-glucosidases for application in the hydrolysis of soybean isoflavone glycosides.;Xiangfei Song et al.;《Journal of agricultural and food chemistry》;20110202;第59卷(第5期);第1954-1961页 * |
| 大豆β-葡萄糖苷酶的提取及其酶学性质的研究;孙艳梅等;《食品工业科技》;20040131;第25卷(第1期);第108-110页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104818262A (en) | 2015-08-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103397064B (en) | Method for preparing rebaudioside M through enzyme method | |
| Wang et al. | Biotransformation of piceid in Polygonum cuspidatum to resveratrol by Aspergillus oryzae | |
| Jain et al. | Production of inulinase from Kluyveromyces marxianus using Dahlia tuber extract | |
| CN103589702B (en) | Application of heat-resistant beta-glucosidase and mutants thereof | |
| Zhang et al. | Highly selective production of compound K from ginsenoside Rd by hydrolyzing glucose at C-3 glycoside using β-glucosidase of Bifidobacterium breve ATCC 15700 | |
| CN104818262B (en) | A kind of method for carrying out polygonin bioconversion using heat-resisting beta-glucosidase and its mutant | |
| CN106755214B (en) | Method for obtaining baohuoside I by means of two-phase enzymatic hydrolysis | |
| CN103114100B (en) | Beta-glucosaccharase gene S-bgl3 and application thereof | |
| WO2019205025A1 (en) | METHOD FOR PREPARING BAOHUOSIDE I BY USING β-GLUCOSIDASE | |
| CN102888416B (en) | Beta-glycosidase gene for coding glycosyl hydrolase family and application thereof | |
| CN104480127B (en) | Hyperthermophilic glucosides enzyme mutant and its application in prepared by Ginsenoside compound K | |
| Pan et al. | α-L-rhamnosidase: Production, properties, and applications | |
| CN105886573A (en) | Method for preparing trehalose by continuous exoenzyme biological process | |
| CN104232671A (en) | Method for screening bacterial strains with ability of converting massively existing ginsenoside into rare ginsenoside | |
| CN101200744A (en) | High-effective clean method for preparing soybean isoflavone aglycone | |
| KR102258788B1 (en) | Novel Aspergillus niger C2-2 isolated from Nu-ruk producing ginsenoside compound K biotransformation enzyme and use thereof | |
| CN104818261B (en) | The application of a kind of heat-resisting β glucuroides and its mutant in arctigenin is prepared | |
| CN112575050A (en) | Method for preparing diosgenin by biological conversion | |
| WO2019205026A1 (en) | USAGE OF β-GLUCOSIDASE AND METHOD FOR PREPARING BAOHUOSIDE I BY USING SAME | |
| Zhang et al. | Research progress of diosgenin extraction from Dioscorea zingiberensis CH Wright: Inspiration of novel method with environmental protection and efficient characteristics | |
| CN106543243A (en) | A kind of rhodioside derivative and preparation method thereof | |
| CN113373168B (en) | Bacterial-derived alpha-L-rhamnosidase gene, gene expression and application thereof | |
| CN103898036A (en) | Genetically engineered bacterium for efficiently expressing catechins as well as construction method and application thereof | |
| CN107630057B (en) | Method for producing 2-oxygen-alpha-D-glucopyranosyl ascorbic acid and special engineering bacteria thereof | |
| KR101919091B1 (en) | Composition for producing aglycone protopanaxatriol comprising mixed enzyme and method for producing aglycone protopanaxatriol using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180424 |