CN104818261B - The application of a kind of heat-resisting β glucuroides and its mutant in arctigenin is prepared - Google Patents
The application of a kind of heat-resisting β glucuroides and its mutant in arctigenin is prepared Download PDFInfo
- Publication number
- CN104818261B CN104818261B CN201510203453.9A CN201510203453A CN104818261B CN 104818261 B CN104818261 B CN 104818261B CN 201510203453 A CN201510203453 A CN 201510203453A CN 104818261 B CN104818261 B CN 104818261B
- Authority
- CN
- China
- Prior art keywords
- beta
- glucosidase
- arctigenin
- heat
- arctiin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2445—Beta-glucosidase (3.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/04—Oxygen as only ring hetero atoms containing a five-membered hetero ring, e.g. griseofulvin, vitamin C
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01021—Beta-glucosidase (3.2.1.21)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The application being converted into the invention discloses a kind of mutant N223T, G224F and N223T/G224F of heat-resisting β glucuroides in arctiin in arctigenin.Mutant N223T, G224F and N223T/G224F of the heat-resisting β glucuroides, amino acid sequence such as SEQ：Shown in ID NO.1, ID NO.2 and ID NO.3；Arctigenin is prepared using heat-resisting β glucuroides and its mutant hydrolysis arctiin of the invention, with respect to its wild-type enzyme, has transformation efficiency high, byproduct of reaction is few, and yield and purity are high, isolate and purify the advantages that easy, chemical contamination is few.
Description
Technical field
The present invention relates to biological technical field, in particular relate to a kind of heat-resisting beta-glucosidase enzyme mutant N223T,
G224F and N223T/G224F, and the enzyme and its mutant are converted into the application in arctigenin in arctiin.
Technical background
Arctigenin is a kind of Chinese herbal medicine, have treat or prevent chronic renal failure and kidney fibrosis, it is antiviral,
It is antitumor and other effects, it is present in nature in great burdock achene, exists more with the arctiin of glucoside type, content is Aglycones content
4-5 times.Research finds that the arctiin of glycoside forms does not have optimal physiologically active state, must be in beta-glucosidase
In the presence of change into the arctigenin of glucoside n-ary form n and drug effect could be played by absorption.Therefore, if arctiin is converted
Into arctigenin, arctigenin production yield can be greatly improved, its bioavailability is improved, reduces cost.Prepare at present
The method of arctigenin mainly has：Acid, Base hydrolysis method and enzyme hydrolysis method.Because the application of soda acid is present to glucoside member destructiveness
Greatly, pollution is big, and the shortcomings of purpose difference, therefore, enzyme hydrolysis method has the characteristics that efficient, safety, ecology and environmental protection are oxen with it
Desirable route prepared by burdock aglycon.Ou Zhimin etc. reports prepares arctiin using beta-glucosidase hydrolysis arctiin
The optimum hydrolysis reaction condition of member is 35 DEG C, pH 5.0,40h, conversion ratio up to more than 80% (Pharmaceutical Biotechnology, 2009,16
(5):443-446)；Prepared using beta-glucosidase enzyme liquid hydrolysis arctiin caused by aspergillus niger CGMCCNo.2594 fermentations
The optimum hydrolysis reaction condition of arctigenin be pH value be 6.0,30 DEG C, 36h, the yield of arctigenin reaches 94.7%
(Zhejiang Polytechnical University's journal, 2009,37 (6)：629-633)；Feng Liu et al. report enzymatic hydrolysis arctiins prepare ox
The optimum hydrolysis reaction condition of burdock aglycon is 40 DEG C, pH 5.0,24h, its yield up to 89.6% (J.Sep.Sci., 2014,
37:376–381)；Wang Xiu actors et al. disclose a kind of substrate arctigenin crude product and co-culture conversion with Blaw spy bacterium AUH-JLD56
For 3 '-demethyl-arctigenin method (CN103509741B)；Chen Jie et al. discloses a kind of microbial association fermentation and carries out ox
Arctiin is converted into the method (CN103233056B) of arctiin in burdock；Cai Bao Chang et al. discloses one kind and directly utilizes second
The composition of arctiin in acetoacetic ester seepage pressure effects great burdock achene, pH is adjusted to make arctiin direct hydrolysis be arctigenin between 3.0-4.0
Crude product, then inverted high performance preparative liquid chromatography method purify to obtain high-purity production (CN103145655A).Although it is existing compared with
More related paper publishing and patent application, but still fail solve transformation time length very well, zymolyte specificity is not high, receives
Rate is low and the problem of cost is high.
The heat endurance of enzyme is directly connected to the service life of enzyme, so as to determine the value of the application efficiency of enzyme and enzyme.Pole
The beta-glucosidase (Tm-BglA) for holding thermophilic robe Pseudomonas Thermotoga to be produced belongs to hydrolase family 1, is incubated at 95 DEG C
6h still retains 60% activity, has high heat resistance, and it has in bioconversion reduces risk of pollution, accelerates reaction speed
Degree, the advantages that zymolyte solubility and higher anti-chemical modification is improved, while can realize that the hot water of high concentration of substrate is taken out
Carry and enzyme hydrolysis and the bio-conversion process deposited, great commercial application potentiality.But the substrate of wild type Tm-BglA hydrolysises
Scope is wide, including cellobiose, lactose, salicin, ursin, APG, p-nitrophenol-β-D-Glucose glycosides and to nitre
Base phenol-β-D-Fructose glycosides, half sugared lactosides of p-nitrophenol-β-D-, daidzin, genistin, malonyl daidzin, the third two
Acyl genistin, laminaribiose and sophorose, if the substrate specificity that Tm-BglA is converted into arctigenin to burdock glycosides can be improved,
The transformation efficiency of arctiin will be greatly improved, reduces byproduct of reaction, and then improves the yield and purity of arctigenin, drop
Low production cost.
Scientific investigations showed that：The arctigenin water solubility of free form is worst, is substantially insoluble in water, and glucoside type
Arctiin be soluble in hot water, at 60-95 DEG C, its solubility dramatically increases with the rise of temperature, therefore.Pin of the present invention
To this characteristic, heat-resisting beta-glucosidase is used in the heat extracting taking technique of arctiin raw material, converted in extracting, makes
Arctiin is obtained once dissolution is removed glycosyl and then is converted into arctigenin from Solid raw materials, is so directly extracted with ethanol
Centrifugation gained precipitation can obtain arctigenin.Because high temperature resistant beta-glucosidase stability is high, enzyme is residual in gained raffinate
Remaining activity and active ingredient can reuses.
The content of the invention
The present invention by the beta-glucosidase Tm-BglA of the family 1 to extreme thermophilic robe Pseudomonas (Thermotiga) with
Cellotetrose carries out molecular docking, and Tm-BglA aglycon binding site prediction, selection are located in Tm-BglA protein structures
Two amino acid (N223 and G224) on 5th beta sheet stock carry out single mutation and double mutation, will be located at 223 and 224 respectively
Asparagine (N) and glycine (G) on position are substituted for threonine (T) and phenylalanine (F) respectively, obtain mutator, so
Insert expression plasmid afterwards and convert host and obtain recombination engineering, make its expression, obtain beta-glucosidase enzyme mutant N223T,
G224F and N223T/G224F, further by after these heat-resisting beta-glucosidase and its mutant hydrolysis arctiins, enzymolysis produces
Thing is found through high performance liquid chromatography detection analysis：Mutant enzyme N223T and G224F are converted into ox to arctiin after hydrolysis 10-20min
12% and 12.6% has been respectively increased in the efficiency of burdock aglycon；Beta-glucosidase and its mutant N223T and G224F conversion ox
Burdock glycosides is converted into unit in arctigenin, and conversion ratio reaches 95-98% per hour.
The invention discloses heat-resisting beta-glucosidase and its mutant to be converted into answering in arctigenin in arctiin
With described heat-resisting beta-glucosidase refers to source thermobacillus category Thermotiga 1 β of glycoside hydrolase Families-glucose
Glycosides enzyme TbglA；Heat-resisting beta-glucosidase enzyme mutant is N223T, G224F and N223T/G224F, amino acid sequence such as SEQ：ID
Shown in NO.1, ID NO.2 and ID NO.3.
Present invention also offers a kind of method for preparing arctigenin, be using above-mentioned heat-resisting beta-glucosidase and its
Arctigenin is made in mutant hydrolysis arctiin substrate.
Specifically method is：Sodium phosphate-citric acid solution that pH is 4.2-7.5, material are added into arctiin substrate
Liquor ratio is 1:2-10(g/mL).；It is 100-1000U/g substrates to add beta-glucosidase and its mutant, its addition, mixing
5-90min uniformly is reacted after stirring at low speed at 60-95 DEG C, extracts reaction solution and is centrifuged under 4-10 DEG C and 4000rpm-8000rpm
10-20min, taking precipitate is standby, and supernatant is used as the dispensing water of lower batch of extraction；Into sediment add 3-10 times of volume and
Concentration is that 75%-100% ethanol is extracted while stirring, then filters and removes slag, filtrate further obtains institute through being concentrated in vacuo
State arctigenin product.
The present invention prepares the beta-glucosidase of arctigenin by rite-directed mutagenesis acquisition high activity hydrolysis arctiin
Mutant N223T, G224F and N223T/G224F, and high efficient expression is carried out to it, further through broken cell, heat treatment and centrifugation
The beta-glucosidase of resulting separation and the crude enzyme liquid of mutant hydrolyze to arctiin obtains the single arctigenin of component
Product, this not only eliminates a series of interference of other enzyme systems of donor bacterium symbiosis, and its relative wild-type enzyme, hydrolyzes burdock
The activity of glycosides, which respectively obtains, to be significantly improved, and has that transformation efficiency is high, and transformation time is short and byproduct of reaction is few, product separation and pure
The advantages that it is easy to change, and obtained arctigenin product amount is big and purity is high.
Brief description of the drawings
The SDS-PAGE collection of illustrative plates .1 of Fig. 1 purifying beta-glucosidases and mutant N223T, G224F and N223T/G224F:
Wild type Tm-BglA, 2：N223T, 3：G224T, 4：N223T/G224F
Fig. 2 Tm-BglA and mutant N223T and G224F are converted into the hydrolysis process of arctigenin to arctiin (80
DEG C and pH 6.2 time react 2min, 5min, 10min, 20min, 60min)
Fig. 3 Tm-BglA (B:Wild type) and mutant N223T (C) and G224F (D) conversion arctiin prepare arctiin
The HPLC collection of illustrative plates of first product is (in 80 DEG C and pH 6.2 times reactions 30min, A：It is not enzyme-added) chromatographic conditions：Instrument：Agilent
HPLC-1100 type high performance liquid chromatographs；Chromatographic column：Agilent ZORBAX-C18(4.6 × 150mm, 5 μm)；Detector：UV
detector；Detection wavelength：280nm；Column temperature：30℃；Flow velocity：1.0mL/min；Mobile phase：A phases are acetonitrile, and B phases are water.Enter
Sample amount is 10 μ L.It is qualitative with retention time, with peak area quantification, calculated with external standard method.Standard sample arctiin is purchased from me
Fourth (Shanghai) reagent Co., Ltd, arctigenin are purchased from Shanghai Yuan Ye bio tech ltd.Wherein, retention time
7.3min is arctiin, and retention time 11.3min is arctigenin.
Gradient program：
Embodiment
It is the specific embodiment that should be invented below, but present disclosure is not limited merely to this.
Embodiment 1:
According to the beta-glucosidase gene sequences Design mutant primer of the family 1 of thermobacillus category (Thermotiga), tool
Body is：
N223T-N:AGTTTTCAATACCGGATATTTCGAACCTGCGAGT (SEQ ID NO.4) and N223T-C:
ATTCCGATCTTTCCATCTTTCACG(SEQ ID NO.5)；Select the wild type beta-glucosidase gene of category containing thermobacillus
Recombinant plasmid pET-20b-bglA (J Ind Microbiol Biotechnol, 2009,36:1401-1408) carried out for template
Inverse PCR amplification obtains the nucleotide fragments of the enzyme mutant gene containing beta-glucosidase, by phosphorylation, connection, conversion, and carries
Plasmid is taken, obtains the recombinant plasmid containing N223T nucleotide fragments, host is further converted and makes its expression, that is, obtain this hair
Bright beta-glucosidase enzyme mutant N223T.
Embodiment 2：
Substantially the same manner as Example 1, difference is that the primer is respectively：Sense primer is G224F-N:5’-
AGTTTTCAACAACTTCTATTTCGAACCTGCGAGT-3 ' (SEQ ID NO.6) and anti-sense primer are G224F-C:5’-
ATTCCGATCTTTCCATCTTTCACG-3’(SEQ ID NO.7)；To obtain the recombinant plasmid containing G224F nucleotide fragments,
Further conversion host makes its expression, that is, obtains the beta-glucosidase enzyme mutant G224F of the present invention.
Embodiment 3：
Substantially the same manner as Example 1, difference is that the primer is respectively：N223T/G224F-N:
AGTTTTCAATACCTTCTATTTCGAACCTGCGAGT (SEQ ID NO.8), anti-sense primer N223T/G224F-C:
ATTCCGATCTTTCCATCTTTCACG (SEQ ID NO.9), to obtain the restructuring matter containing N223T/G224F nucleotide fragments
Grain, further convert host and make its expression, that is, obtain the beta-glucosidase enzyme mutant N223T/G224F of the present invention.
Embodiment 4：The culture of recombinant bacterium and the preparation of crude enzyme liquid：
By the recombinant plasmid transformed host containing beta-glucosidase gene and its mutant, 25~37 DEG C in the medium
Temperature culture is to IPTG or lactose after OD600 values 0.8-1.0, is added in a DEG C temperature-induced culture 6-10h, then by bacterium solution in 0-10
DEG C, centrifuge under the conditions of rotating speed 4000-6000rpm, sediment is washed with water 3 times, with 1/10 volume 0.02-0.5M pH6.0-
8.0 buffer solution is resuspended, and puts ultrasonication in ice-water bath or is crushed with high pressure, and the bacterium solution after crushing is in 60-70 DEG C of temperature conditionss
Lower heat treatment 10-20min, 10-30min is centrifuged under the conditions of 0-4 DEG C, 10000-13000rpm, takes supernatant to produce β-glucose
The crude enzyme liquid of glycosides enzyme and its mutant.
Embodiment 5：The preparation and purification of enzyme
Crude enzyme liquid obtained as above is heat-treated 20min at 70 DEG C, is heat-treated and is carried out in water-bath, from it is heated fast,
Be heated evenly and container that heating surface area is big, and constantly gently rotate in heat treatment process triangular flask make crude enzyme liquid uniformly by
Heat.With 13 after heat treatment, 000 × g, 30min, after 4 DEG C remove albuminate, upper nickel affinity chromatography (Ni-NTA) post is purified
Beta-glucosidase and its mutant are obtained, concrete operations refer to Novagen companies Ni-NTA specifications, and purity of protein is by SDS-
PAGE identifies (Fig. 1).
Embodiment 6：The conversion of purifying beta-glucosidase and its mutant to arctiin
In sodium phosphate-citric acid solution that pH is 6.2, isometric 0.5374mg/ml arctiin water is added
Solution, it is well mixed, then using the pure beta-glucosidase of gained and its mutant as catalyst, beta-glucosidase and its mutation
The final concentration of 2 μ g/ml of body mix reacts 2min~60min after shaking table at 80 DEG C, and enzymolysis product is examined through high performance liquid chromatography
Analysis is surveyed to find (Fig. 2)：With respect to its wild-type enzyme, mutant enzyme N223T and G224F are converted into arctiin after hydrolyzing 10-20min
12% and 12.6% has been respectively increased in the efficiency of arctigenin, and the conversion ratio that its conversion arctiin is converted into arctigenin shows
Write and improve；4000rpm-8000rpm centrifugation 15min are finally extracted reaction solution, take precipitation to add 3 times of volumes and concentration thereto to be
95% ethanol is extracted while stirring, is then filtered and is removed slag, and filtrate further obtains arctigenin production through being concentrated in vacuo
Product (Fig. 3).HPLC analysis conditions：Chromatographic column：Agilent ZORBAX-C18(4.6 × 150mm, 5 μm)；Detector：UV
detector；Detection wavelength：280nm；Column temperature：30℃；Flow velocity：1.0mL/min；Mobile phase：A phases are acetonitrile, and B phases are water.Enter
Sample amount is 10 μ L.It is qualitative with retention time, with peak area quantification, calculated with external standard method.Standard sample arctiin is purchased from me
Fourth (Shanghai) reagent Co., Ltd, arctigenin are purchased from Shanghai Yuan Ye bio tech ltd.
Embodiment 7：Crude enzyme liquid carries out bioconversion to the arctiin in great burdock achene dry powder
More than 80 mesh great burdock achene dry powder will be worn into after great burdock achene impurity elimination without going mouldy, by material-water ratio 1:4 are dissolved in pH
6.2100mM sodium phosphate buffers, the thick of warm 80 DEG C of addition 300U/g beta-glucosidases and its mutant is heated to while stirring
Enzyme liquid, simultaneously stirring at low speed 1 hour is incubated, then extracts reaction solution 4000rpm centrifugation 20min, 8 times of second of volume 80% of taking precipitate
2h is extracted at 80 DEG C of alcohol, then filters and removes slag, filtrate is further through vacuum freeze drying.
Embodiment 8：Crude enzyme liquid carries out bioconversion to the arctiin in great burdock achene dry powder
Substantially the same manner as Example 7, difference is that the addition of beta-glucosidase and its mutant is 500U/g
Substrate, hydrolysis condition are：PH 5.0, at 95 DEG C of temperature, soaking time 10min.
Embodiment 9：Crude enzyme liquid is substantially the same manner as Example 7 to carrying out bioconversion to the arctiin in great burdock achene dry powder,
Difference is 75 DEG C of hydrolysising reacting temperature used, 7.0 times insulation 60min of pH.
Embodiment 10：Crude enzyme liquid is substantially the same manner as Example 7 to the arctiin progress bioconversion in great burdock achene dry powder, no
It is that hydrolysis condition used is with part：PH 5.5, at 65 DEG C of temperature, soaking time 90min.
Claims (3)
1. heat-resisting beta-glucosidase enzyme mutant is converted into the application in arctigenin in arctiin, it is characterised in that described
Heat-resisting beta-glucosidase refers to the source thermobacillus category Thermotiga beta-glucosidase TbglA of glycoside hydrolase Families 1；
Heat-resisting beta-glucosidase enzyme mutant is N223T, G224F and N223T/G224F, amino acid sequence such as SEQ：ID NO.1、ID
Shown in NO.2 and ID NO.3.
A kind of 2. method for preparing arctigenin, it is characterised in that using arctiin as substrate, dashed forward in heat-resisting beta-glucosidase
Arctigenin is made by enzymatic isolation method in the presence of variant；Described heat-resisting beta-glucosidase refers to source thermobacillus category
The Thermotiga beta-glucosidase TbglA of glycoside hydrolase Families 1；Heat-resisting beta-glucosidase enzyme mutant be N223T,
G224F and N223T/G224F, amino acid sequence such as SEQ：Shown in ID NO.1, ID NO.2 and ID NO.3.
3. the method according to claim 11, it is characterized in that, the sodium phosphate that addition pH is 4.2-7.5 into arctiin substrate-
Citric acid solution, solid-liquid ratio 1:2-10g/mL；Beta-glucosidase enzyme mutant is added, its addition is 100-1000U/
G substrates, it is well mixed and reacts 5-90min after stirring at low speed at 60-95 DEG C, extract reaction solution in 4-10 DEG C and 4000rpm-
10-20min is centrifuged under 8000rpm, taking precipitate is standby, and supernatant is used as the dispensing water of lower batch of extraction；Add into sediment
It is that 75%-100% ethanol is extracted while stirring to enter 3-10 times of volume and concentration, then filters and removes slag, filtrate further passes through
Vacuum concentration obtains the arctigenin product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510203453.9A CN104818261B (en) | 2015-04-24 | 2015-04-24 | The application of a kind of heat-resisting β glucuroides and its mutant in arctigenin is prepared |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510203453.9A CN104818261B (en) | 2015-04-24 | 2015-04-24 | The application of a kind of heat-resisting β glucuroides and its mutant in arctigenin is prepared |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104818261A CN104818261A (en) | 2015-08-05 |
| CN104818261B true CN104818261B (en) | 2017-11-17 |
Family
ID=53728742
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510203453.9A Expired - Fee Related CN104818261B (en) | 2015-04-24 | 2015-04-24 | The application of a kind of heat-resisting β glucuroides and its mutant in arctigenin is prepared |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104818261B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112094835B (en) * | 2020-09-24 | 2022-09-06 | 江南大学 | Application of beta-glucosidase mutant |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101200744A (en) * | 2007-12-07 | 2008-06-18 | 南京师范大学 | High-effective clean method for preparing soybean isoflavone aglycone |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9249432B2 (en) * | 2012-07-13 | 2016-02-02 | Alliance For Sustainable Energy, Llc | Enzymes for improved biomass conversion |
| CN103589702B (en) * | 2013-11-19 | 2014-09-10 | 南京市第一医院 | Application of heat-resistant beta-glucosidase and mutants thereof |
-
2015
- 2015-04-24 CN CN201510203453.9A patent/CN104818261B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101200744A (en) * | 2007-12-07 | 2008-06-18 | 南京师范大学 | High-effective clean method for preparing soybean isoflavone aglycone |
Non-Patent Citations (2)
| Title |
|---|
| SERVE W. M. KENGEN et al..AN EXTREMELY THERMOSTABLE HYPERTHERMOPHILIC ARCHAEON PYROCOCCUS FURIOSUS;A COMPARISON WITH OTHER GLYCOSIDASES.《Biocatalysis》.1994,第11卷第79-88页. * |
| β-葡萄糖苷酶水解牛蒡子苷制备牛蒡子苷元;欧志敏等;《药物生物技术》;20091231;第16卷(第5期);第443-446页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104818261A (en) | 2015-08-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Cloning, overexpression and characterization of a thermostable β-xylosidase from Thermotoga petrophila and cooperated transformation of ginsenoside extract to ginsenoside 20 (S)-Rg3 with a β-glucosidase | |
| CN108384769B (en) | High-temperature-resistant complex enzyme and application thereof | |
| Zhang et al. | Biotransformation of the total flavonoid extract of epimedium into icaritin by two thermostable glycosidases from Dictyoglomus thermophilum DSM3960 | |
| Gao et al. | A highly selective ginsenoside Rb1-hydrolyzing β-D-glucosidase from Cladosporium fulvum | |
| CN111690630A (en) | Beta-glucosidase, encoding gene thereof, expression and application thereof | |
| CN114107255A (en) | Panax japonicus glycoside hydrolase and application thereof in production of zingiber officinale-shaped notoginsenoside R1 | |
| CN113980931B (en) | Application of glucuronic acid hydrolase and mutant thereof in preparation of oleanolic acid-beta-D-glucopyranosyl ester | |
| CN114107341B (en) | Application of fungal source alpha-L-rhamnosidase in icariin production | |
| CN106755214B (en) | Method for obtaining baohuoside I by means of two-phase enzymatic hydrolysis | |
| CN112226395A (en) | Escherichia coli engineering bacterium and method for producing icariin through whole-cell catalysis of escherichia coli engineering bacterium | |
| CN111893158B (en) | Method for preparing cycloastragenol by double-enzyme composite conversion of astragaloside | |
| WO2019205025A1 (en) | METHOD FOR PREPARING BAOHUOSIDE I BY USING β-GLUCOSIDASE | |
| CN104818262B (en) | A kind of method for carrying out polygonin bioconversion using heat-resisting beta-glucosidase and its mutant | |
| CN104818261B (en) | The application of a kind of heat-resisting β glucuroides and its mutant in arctigenin is prepared | |
| WO2019205026A1 (en) | USAGE OF β-GLUCOSIDASE AND METHOD FOR PREPARING BAOHUOSIDE I BY USING SAME | |
| CN104232671A (en) | Method for screening bacterial strains with ability of converting massively existing ginsenoside into rare ginsenoside | |
| CN106480005A (en) | A kind of preparation method of the 3 epimerase immobilised enzymes of D psicose with side chain | |
| CN109182439A (en) | The bioconversion method of the rare saponin(e Rg3 of ginseng | |
| Qu et al. | Highly efficient biotransformation of phenolic glycosides using a recombinant β-glucosidase from white rot fungus Trametes trogii | |
| KR101392987B1 (en) | Production of the rare ginsenosides compound Mc, compound Y, aglycon protopanaxadiol by a thermostable beta-glucosidase | |
| CN104725443B (en) | A kind of method that rebaudioside A is purified by Reaction Separation | |
| KR20210058416A (en) | Novel Aspergillus tubingensis C2-2 isolated from Nu-ruk producing ginsenoside compound K biotransformation enzyme and use thereof | |
| CN113373168B (en) | Bacterial-derived alpha-L-rhamnosidase gene, gene expression and application thereof | |
| CN113584002B (en) | Alpha-L-rhamnosidase and preparation method and application thereof | |
| Zhong et al. | Characterization of a novel thermophilic beta-glucosidase from Thermotoga sp. and its application in the transformation of notoginsenoside R1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20171117 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |