CN104789575A - Major gene TaTGW-2D for controlling wheat thousand seed weight and marking method thereof - Google Patents
Major gene TaTGW-2D for controlling wheat thousand seed weight and marking method thereof Download PDFInfo
- Publication number
- CN104789575A CN104789575A CN201510206133.9A CN201510206133A CN104789575A CN 104789575 A CN104789575 A CN 104789575A CN 201510206133 A CN201510206133 A CN 201510206133A CN 104789575 A CN104789575 A CN 104789575A
- Authority
- CN
- China
- Prior art keywords
- tatgw
- wheat
- primer
- major gene
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a major gene TaTGW-2D for controlling wheat thousand seed weight and also discloses a marking method of the major gene TaTGW-2D for controlling wheat thousand seed weight. The major gene has the beneficial effects that a candidate region closely related to the wheat seed weight is authenticated by simplifying a genome sequencing technology, and the candidate region of the region is cloned; the man-made population proves that the gene is a novel candidate major gene with obvious effect on the seed weight and a functional mark (TaTGW-2D) is developed. The bioinformatics analysis shows that the TaTGW-2D contains a gelsolin functional domain and is capable of adjusting the synthesis and decomposition of the actin microfilament; the actin microfilament has an important effect on the cytoplasmic division, the organelle movement and the plasmalemma mobility. The actin microfilament is capable of influencing the cell growth and additionally influencing the seed weight. A novel gene resource for wheat yield breeding is provided and additionally a molecular mechanism of the yield formation is illuminated.
Description
Technical field
The present invention relates to the major gene TaTGW-2D and marking method thereof that control thousand grain weight of wheat, belong to the technical field of Crop Genetic Breeding.
Background technology
Wheat (Triticum aestivumL.) is that ultimate production occupies the food crop of second in the world, improves wheat yield and all has very important strategic importance to national food security and increase agriculture production benefit.Thousand seed weight is that wheat yield forms one of three elements, and have higher heritability (Giura and Saulescu, 1996), therefore, the breeding process of wheat is exactly improve constantly grain weight to a great extent.But the molecular regulation mechanism that grain is heavy is still unintelligible.
Sum up forefathers' report, thousand seed weight belongs to quantitative character, adds minor-polygene co-controlling by main effect.At present, it is more that grain heavy phase closes QTL site report, is extensively distributed in (Araki etc., 1999 on wheat 21 karyomit(e)s; Shah etc., 1999; Kato etc., 2000; Groos etc., 2003; Huang etc., 2003; Breseghello etc., 2006; Huang etc., 2006; Sun etc., 2009; Marta etc., 2013; Simmonds etc., 2014).Wherein main effect QTL site is positioned at 1A, 2A, 2D, 3A, 4B, 5A, 6A 7A, 7B, 7D (Campbell etc., 2003; Huang etc., 2003; Vasilis etc., 2010).In wheat, the some functional gene that regulation and control grain is heavy is cloned.The major gene TaGW2 that grain is wide and grain is heavy is controlled as (2011) homologous clones such as Su in paddy rice.Ma etc. (2012) have cloned the cell walls invertase gene TaCWI relevant to Grain Weight in Common Wheat.Comprehensive above-mentioned known, the Genetic Mechanisms of thousand seed weight is more complicated, differing materials, and genetic background is different, controls the heavy major gene of grain also difference to some extent.Identify more heavy phase correlation genes, be not only conducive to the process accelerating multiple gene polymerization breeding, contribute to the molecular mechanism illustrating yield composition further simultaneously.
Summary of the invention
The technical problem to be solved in the present invention is to provide the major gene TaTGW-2D and marking method thereof that control thousand grain weight of wheat.
The present invention is achieved through the following technical solutions.
Control the major gene TaTGW-2D of thousand grain weight of wheat, kind is capital 411, and sequence is as sequence table.
Control the major gene TaTGW-2D of thousand grain weight of wheat, kind is the red awns spring 21, and sequence is as sequence table.
For the marking method of the major gene TaTGW-2D of control thousand grain weight of wheat, step comprises:
(1) Wheat volatiles DNA extraction;
(2) to detecting qualified each sample genomic dna restriction enzyme HaeIII, carry out enzyme to cut, the endonuclease bamhi obtained Klenow Fragment (3 ' → 5 ' exo –) (NEB) and dATP are carried out at 37 DEG C that 3 ' end adds A process, is connected Dual-index sequence measuring joints, pcr amplification, purifying, mixes sample, cut glue and choose object fragment, pcr amplification primer: F AATGATACGGCGACCACCGA, RCAAGCAGAAGACGGCATACG, quality inspection qualified rear IlluminaHiSeqTM2500 in library checks order;
(3) primer TaTGW-2D full length gene primer 2 D13F:TTCCGTCTCAGAACGACAACA is designed, 2D13R:CGCACCAGGCTACAACTCATT, 2D19F:GCGTGCTCAGTATGCTTTA; 2D19R:AGGCTACAACTCATTCCGA; Marker development primer 2 DB5F:GCCGCCGATAAGTAGATCTA 2DB5R:ATGGCAGTTCATACCAAAGG
Primer 2 D13,2D19 for the TaTGW-2D full length gene that increases, PCR primer cloning and sequencing; Primer 2 DB5 is used for TaTGW-2D marker development, is positioned at the 12nd intron T → C suddenlys change according to the 3rd place, design marking primer 2 DB5F, 2DB5R, and product is separated on the agarose gel electrophoresis of 1.5%, observes note band under ultraviolet light after dyeing.
Further, the step of (1) Wheat volatiles DNA extraction comprises:
1) wheat single grain is ground, get 0.1g and add 0.7mLSDS extracting solution (0.1MTris-HCl (PH=8.5), 0.1M NaCl, 0.05M EDTA (PH=8.0), 2%SDS) cracking 45min under 60 DEG C of constant temperature, repeatedly shakes therebetween;
2) under 4 DEG C of 12000rpm conditions, centrifugal 10min;
3) get supernatant liquor and add isopyknic phenol: chloroform: primary isoamyl alcohol (25:24:1) turns upside down and rotates to the not bery fast layering of two-phase;
4) under 4 DEG C of 12000rpm conditions, centrifugal 10min;
5) get supernatant liquor and add isopyknic phenol: chloroform: primary isoamyl alcohol (25:24:1) turns upside down and rotates for several times;
6) under 4 DEG C of 12000rpm conditions, centrifugal 10min;
7) get supernatant liquor to add isopyknic Virahol and leave standstill 30min in-20 DEG C of refrigerators;
9) with 70% washing with alcohol twice;
10) under 4 DEG C of 12000rpm conditions, centrifugal 10min;
11) precipitate natural air drying, deposit for 4 DEG C, for subsequent use.
Further, (2) select Arabidopis thaliana to check order in contrast.
Further, the PCR reaction system of (3) TaTGW-2D mark: 1 μ L 2.5mMdNTP, 0.25 μ L 10uM primer, 1 μ L 10*La Tap Buffer, 0.5U TaKaRa LaTap, 100ng DNA profiling, with bi-distilled water polishing to 10uL.
Further, the PCR response procedures of (3) TaTGW-2D mark: 95 DEG C of sex change 5min; 95 DEG C of sex change 45s; 55 DEG C of annealing 50s; 72 DEG C extend 50s, 35 circulations, and 72 DEG C extend 10min.
Further, (3) agarose gel electrophoresis: 1.5-2% sepharose, buffer system is 1 × TAE solution, and under 100V constant voltage, electrophoresis 50min, ethidium bromide (EB) dyes, and gel imaging system scans and preserves.Polyacrylamide gel electrophoresis: the denaturing polyacrylamide gel of 6%, buffer system is 1 × TBE solution, voltage 1200V, electric current 55A, power 55W, electrophoresis 90-110min.
The cardinal principle of this technology is:
(1) simplify genomic sequencing technique (1) based on information biology carry out scheme system design utilize bioinformatics method, systems analysis is carried out to the reference genome (or known BAC sequence) of wheat, according to information such as genomic GC content, tumor-necrosis factor glycoproteins situation and genetic traits, design marker development scheme, to ensure the accuracy of the density of its molecular markers development, homogeneity, efficiency and association analysis.(2) SLAF-seq library construction and order-checking select wheat as research material, build SLAF-seq library, and according to the scheme of previous information method design, screening specificity long fragment, application high throughput sequencing technologies obtains magnanimity sequence label.(3) SLAF-seq data analysis carries out base conditioning to data, assesses sequencing data, the SLAF fragment that the acquisition order-checking degree of depth and quality meet the demands, and represents Wheat volatiles information.The present invention utilizes the hot spot region of SLAF-seq technical evaluation Grain Weight in Common Wheat genes involved.
(2) polymerase chain reaction (PCR), reactions steps: the 1. sex change of template DNA: template DNA is after being heated to about 93 DEG C certain hours, make template DNA double-strand or dissociate through the double-stranded DNA that pcr amplification is formed, make it to become strand, so that it is combined with primer, for lower whorl reaction is prepared; 2. the annealing (renaturation) of template DNA and primer: template DNA becomes after strand through heat denatured, and temperature is down to about 55 DEG C, and the complementary sequence of primer and template DNA strand matches and combines; 3. the extension of primer: DNA profiling--primer binding substances is under the effect of Taq DNA polymerase, take dNTP as reaction raw materials, target sequence is template, by base pair complementarity and semiconservative replication principle, synthesize a semiconservative replication chain that the is new and complementation of template DNA chain, through 30 circulation left and right, object fragment is increased in a large number.The present invention adopts Primer Premier 5 software design primer, closes candidate gene clone grain heavy phase.
Beneficial effect of the present invention:
Utilize and simplify genomic sequencing technique, identify the candidate region with Grain Weight in Common Wheat tight association, and cloned the candidate gene in this region, verify through artificial colony, this gene is a kind of candidate major gene new significantly to grain ghost image sound, and develops functional label (TaTGW-2D).Through bioinformatic analysis, TaTGW-2D contains gelsolin functional domain, and the synthesis Sum decomposition of modulate actin microfilament, actinmicrofilament has vital role in the mobility of division of cytoplasm, Organelle movement, plasma membrane.Actinmicrofilament affects Growth of Cells, may heavily have an impact to grain further.The present invention is that Yield Potential Breeding of Wheat provides new genetic resources, further illustrates the molecular mechanism of yield composition simultaneously.
Accompanying drawing explanation
Fig. 1 is the observation note band schematic diagram in capital 411 and red awns spring 21; (1,2: capital 411; 3,4: the red awns spring 21; Be illustrated as containing large seed allelotrope without band, have band to illustrate containing fine grain allelotrope)
Fig. 2 is the schematic diagram of the Genes location of TaTGW-2D.(TaTGW-2D and Xwmc112 and Xgdm148 close linkage, LOD value gets 3.0)
Embodiment
According to drawings and embodiments the present invention is described in further detail below.
(1) Wheat volatiles DNA extraction
Test materials for DNA extraction mixes pond, RIL RIL (capital 411/ red awns spring 21) F for parent capital 411 and 21, two height of red awns spring
9the each family of colony.Concrete grammar is:
1, wheat single grain is ground, get 0.1g and add 0.7mLSDS extracting solution (0.1MTris-HCl (PH=8.5), 0.1M NaCl, 0.05M EDTA (PH=8.0), 2%SDS) cracking 45min under 60 DEG C of constant temperature, repeatedly shakes therebetween.
2, under 4 DEG C of 12000rpm conditions, centrifugal 10min.
3, get supernatant liquor and add isopyknic phenol: chloroform: primary isoamyl alcohol (25:24:1) turns upside down and rotates to the not bery fast layering of two-phase.
4, under 4 DEG C of 12000rpm conditions, centrifugal 10min.
5, get supernatant liquor and add isopyknic phenol: chloroform: primary isoamyl alcohol (25:24:1) turns upside down and rotates for several times.
6, under 4 DEG C of 12000rpm conditions, centrifugal 10min.
7, get supernatant liquor to add isopyknic Virahol and leave standstill 30min in-20 DEG C of refrigerators.
8, under 4 DEG C of 12000rpm conditions, centrifugal 10min.
9, with 70% washing with alcohol twice.
10, under 4 DEG C of 12000rpm conditions, centrifugal 10min.
11, precipitate natural air drying, deposit for 4 DEG C, for subsequent use.
(2) simplification gene order-checking and enzyme cut conceptual design
1, determine with reference to genome: according to information such as the Genome Size of wheat and GC content, finally choose wheat A genome and cut prediction as carrying out enzyme with reference to genome.
2, enzyme butt case is determined: utilize enzyme to cut forecasting software and cut prediction to carrying out enzyme with reference to genome, select the suitableeest enzyme butt case.
3, experiment flow: according to the suitableeest selected enzyme butt case, to detecting qualified each sample genomic dna restriction enzyme HaeIII (New England Biolabs, NEB), carrying out enzyme and cutting.The endonuclease bamhi obtained (SLAF label) is carried out at 37 DEG C with Klenow Fragment (3 ' → 5 ' exo –) (NEB) and dATP to 3 ' end adds A process, is connected Dual-index sequence measuring joints, pcr amplification (pcr amplification primer: FAATGATACGGCGACCACCGA RCAAGCAGAAGACGGCATACG), purifying (Agencourt AMPure XP beads (Beckman Coulter, High Wycombe, UK)), mixed sample, cut glue and choose object fragment, quality inspection qualified rear IlluminaHiSeqTM2500 in library checks order.For the accuracy conscientiously tested of assessment enzyme, select Arabidopis thaliana (Arabidopsis thaliana ecotype Columbia) in contrast (Control) check order.
4, information analysis flow process: utilize Dual-index to identify the raw data obtained that checks order, obtain the reads of each sample.After filtering the joint of order-checking reads, carry out the assessment of sequencing quality and data volume.By Control data evaluation digesting efficiency, with the accuracy of this judgment experiment process and validity.By the method for cluster between reads, in parent and mixed pond, develop SLAF label, find the SLAF label that there is polymorphism in parent.The polymorphism SLAF label obtained is carried out association analysis, obtain the SLAF label with proterties tight association, and be located with reference on genome, determine candidate region, obtain and the molecule marker of Grain Weight in Common Wheat tight association and candidate region, and gene clone and function labeling development are carried out to the transcript in region.
(3) design of primers
1, TaTGW-2D full length gene primer 2 D13F:TTCCGTCTCAGAACGACAACA 2D13R:CGCACCAGGCTACAACTCATT 2D19F:GCGTGCTCAGTATGCTTTA; 2D19R:AGGCTACAACTCATTCCGA.Marker development primer 2 DB5F:GCCGCCGATAAGTAGATCTA 2DB5R:ATGGCAGTTCATACCAAAGG.SSR primer information is from Gremene database (http://wheat.pw.usda.gov/GG2/index.shtml).Primer has Primer Premier5 software design, is synthesized by the raw work in Shanghai.
2, PCR reaction system: 1 μ L 2.5mM dNTP, 0.25 μ L 10uM primer, 1 μ L10*La Tap Buffer, 0.5U TaKaRa LaTap, 100ng DNA profiling, with bi-distilled water polishing to 10uL.
PCR response procedures: 95 DEG C of sex change 5min; 95 DEG C of sex change 45s; 55 DEG C of annealing 50s (annealing temperature is depending on primer); 72 DEG C extend 50s, 35 circulations, and 72 DEG C extend 10min.
3, PCR primer agarose gel electrophoresis: 1.5-2% sepharose, buffer system is 1 × TAE solution, and under 100V constant voltage, electrophoresis 50min, ethidium bromide (EB) dyes, and gel imaging system scans and preserves.Polyacrylamide gel electrophoresis: the denaturing polyacrylamide gel of 6%, buffer system is 1 × TBE solution, voltage 1200V, electric current 55A, power 55W, electrophoresis 90-110min.
(4) TaTGW-2D full length gene clone
Primer 2 D13,2D19 for the TaTGW-2D full length gene that increases, PCR primer cloning and sequencing; Primer 2 DB5 is used for TaTGW-2D marker development (see Table 1).
(5) gene structure and sequence analysis
TaTGW-2D gene, from translation initiation codon to terminator total length 4241bp, comprises 13 exons and 12 introns, the long 1689bp of gene reading frame, 562 amino acid of encoding.By larger seed capital 411 and the sequence difference in fine grain red awns spring 21, find existence 3 SNP site variations.First place is positioned at A → G on the 12nd exon, and causing has granule kind lysine mutation to be large grain kind L-glutamic acid; Second and the 3rd place be positioned at the 12nd intron C → T, T → C; TaTGW-2D contains gelsolin functional domain, and the synthesis Sum decomposition of modulate actin microfilament, actinmicrofilament has vital role in the mobility of division of cytoplasm, Organelle movement, plasma membrane.Actinmicrofilament affects Growth of Cells, may heavily have an impact to grain further.
(6) marker development, Genes location and the dependency heavy with grain
Be positioned at the 12nd intron T → C according to the 3rd place to suddenly change, design marking primer 2 DB5F:GCCGCCGATAAGTAGATCTA 2DB5R:ATGGCAGTTCATACCAAAGG.PCR response procedures: 95 DEG C of sex change 5min; 95 DEG C of sex change 45s; 65 DEG C (0.3 DEG C/c ↓) annealing 50s; 72 DEG C extend 50s, 30 circulations, 95 DEG C of sex change 45s; 60 DEG C of annealing 50s; 72 DEG C extend 50s, 7 circulations, and 72 DEG C extend 10min, and product is separated on the agarose gel electrophoresis of 1.5%, observe note band (Fig. 1) under ultraviolet light after dyeing.
The present invention utilizes RIL colony to carry out TaTGW-2D and grain correlation analysis heavily.
Result shows, under 3 years environment (2010-2012,2014), TaTGW-2D can explain the phenotypic variation of 16-19.8% in recombinant inbred lines.Illustrating that TaTGW-2D rings grain ghost image really comparatively remarkable, is the main effect QTL that regulation and control grain is heavy.The present invention continues to utilize above-mentioned recombinant inbred lines, chooses the SSR primer that 2D is evenly distributed and carries out Genes location analysis, and result shows TaTGW-2D and Xwmc112 and Xgdm148 close linkage (Fig. 2)
Above-described embodiment, only for technical conceive of the present invention and feature are described, its object is to allow the personage being familiar with this art can understand content of the present invention and be implemented, can not limit the scope of the invention with this.All equivalences done according to spirit of the present invention change or modify, and all should be encompassed in protection scope of the present invention.
Claims (8)
1. control the major gene TaTGW-2D of thousand grain weight of wheat, it is characterized in that, kind is capital 411, and sequence is as sequence table.
2. control the major gene TaTGW-2D of thousand grain weight of wheat, it is characterized in that, kind is the red awns spring 21, and sequence is as sequence table.
3., for the marking method of the major gene TaTGW-2D of control thousand grain weight of wheat, it is characterized in that, step comprises:
(1) Wheat volatiles DNA extraction;
(2) to detecting qualified each sample genomic dna restriction enzyme HaeIII, carry out enzyme to cut, the endonuclease bamhi obtained Klenow Fragment (3 ' → 5 ' exo –) (NEB) and dATP are carried out at 37 DEG C that 3 ' end adds A process, is connected Dual-index sequence measuring joints, pcr amplification, purifying, mixes sample, cut glue and choose object fragment, pcr amplification primer: F AATGATACGGCGACCACCGA, RCAAGCAGAAGACGGCATACG, quality inspection qualified rear IlluminaHiSeqTM2500 in library checks order;
(3) primer TaTGW-2D full length gene primer 2 D13F:TTCCGTCTCAGAACGACAACA is designed, 2D13R:CGCACCAGGCTACAACTCATT, 2D19F:GCGTGCTCAGTATGCTTTA; 2D19R:AGGCTACAACTCATTCCGA; Marker development primer 2 DB5F:GCCGCCGATAAGTAGATCTA 2DB5R:ATGGCAGTTCATACCAAAGG
Primer 2 D13,2D19 for the TaTGW-2D full length gene that increases, PCR primer cloning and sequencing; Primer 2 DB5 is used for TaTGW-2D marker development, is positioned at the 12nd intron T → C suddenlys change according to the 3rd place, design marking primer 2 DB5F, 2DB5R, and product is separated on the agarose gel electrophoresis of 1.5%, observes note band under ultraviolet light after dyeing.
4. the marking method of the major gene TaTGW-2D for control thousand grain weight of wheat according to claim 3, it is characterized in that, the step of (1) Wheat volatiles DNA extraction comprises:
1) wheat single grain is ground, get 0.1g and add 0.7mLSDS extracting solution (0.1MTris-HCl (PH=8.5), 0.1M NaCl, 0.05M EDTA (PH=8.0), 2%SDS) cracking 45min under 60 DEG C of constant temperature, repeatedly shakes therebetween;
2) under 4 DEG C of 12000rpm conditions, centrifugal 10min;
3) get supernatant liquor and add isopyknic phenol: chloroform: primary isoamyl alcohol (25:24:1) turns upside down and rotates to the not bery fast layering of two-phase;
4) under 4 DEG C of 12000rpm conditions, centrifugal 10min;
5) get supernatant liquor and add isopyknic phenol: chloroform: primary isoamyl alcohol (25:24:1) turns upside down and rotates for several times;
6) under 4 DEG C of 12000rpm conditions, centrifugal 10min;
7) get supernatant liquor to add isopyknic Virahol and leave standstill 30min in-20 DEG C of refrigerators;
9) with 70% washing with alcohol twice;
10) under 4 DEG C of 12000rpm conditions, centrifugal 10min;
11) precipitate natural air drying, deposit for 4 DEG C, for subsequent use.
5. the marking method of the major gene TaTGW-2D for control thousand grain weight of wheat according to claim 3, it is characterized in that, (2) select Arabidopis thaliana to check order in contrast.
6. the marking method of the major gene TaTGW-2D for control thousand grain weight of wheat according to claim 3, it is characterized in that, (3) the PCR reaction system of TaTGW-2D mark: 1 μ L2.5mM dNTP, 0.25 μ L 10uM primer, 1 μ L 10*La Tap Buffer, 0.5U TaKaRaLaTap, 100ng DNA profiling, with bi-distilled water polishing to 10uL.
7. the marking method of the major gene TaTGW-2D for control thousand grain weight of wheat according to claim 3, is characterized in that, the PCR response procedures that (3) TaTGW-2D marks: 95 DEG C of sex change 5min; 95 DEG C of sex change 45s; 55 DEG C of annealing 50s; 72 DEG C extend 50s, 35 circulations, and 72 DEG C extend 10min.
8. the marking method of the major gene TaTGW-2D for control thousand grain weight of wheat according to claim 3, it is characterized in that, (3) agarose gel electrophoresis: 1.5-2% sepharose, buffer system is 1 × TAE solution, under 100V constant voltage, electrophoresis 50min, ethidium bromide (EB) dyes, and gel imaging system scans and preserves.Polyacrylamide gel electrophoresis: the denaturing polyacrylamide gel of 6%, buffer system is 1 × TBE solution, voltage 1200V, electric current 55A, power 55W, electrophoresis 90-110min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510206133.9A CN104789575B (en) | 2015-04-27 | 2015-04-27 | Control the major gene resistance TaTGW 2D and its labeling method of thousand grain weight of wheat |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510206133.9A CN104789575B (en) | 2015-04-27 | 2015-04-27 | Control the major gene resistance TaTGW 2D and its labeling method of thousand grain weight of wheat |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104789575A true CN104789575A (en) | 2015-07-22 |
| CN104789575B CN104789575B (en) | 2018-01-05 |
Family
ID=53554768
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510206133.9A Expired - Fee Related CN104789575B (en) | 2015-04-27 | 2015-04-27 | Control the major gene resistance TaTGW 2D and its labeling method of thousand grain weight of wheat |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104789575B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110055317A (en) * | 2019-04-29 | 2019-07-26 | 中国农业科学院作物科学研究所 | The method of external source function candidate gene is excavated in wheat distance edge hybrid offspring's Small piece transposition system |
| CN112680505A (en) * | 2021-01-07 | 2021-04-20 | 河南农业大学 | Functional marker development method based on wheat potassium transport protein gene |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101775439A (en) * | 2010-01-12 | 2010-07-14 | 中国农业科学院作物科学研究所 | Auxiliary method for screening wheat of different 1000-grain weights and special marker thereof |
| CN103695418A (en) * | 2013-12-25 | 2014-04-02 | 四川农业大学 | Maize phosphate starvation responses intron length polymorphism marker for corn |
-
2015
- 2015-04-27 CN CN201510206133.9A patent/CN104789575B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101775439A (en) * | 2010-01-12 | 2010-07-14 | 中国农业科学院作物科学研究所 | Auxiliary method for screening wheat of different 1000-grain weights and special marker thereof |
| CN103695418A (en) * | 2013-12-25 | 2014-04-02 | 四川农业大学 | Maize phosphate starvation responses intron length polymorphism marker for corn |
Non-Patent Citations (2)
| Title |
|---|
| BRENCHLEY R.等: "W5BWD0_WHEAT", 《UNIPROTKB》 * |
| 宿振起: "小麦粒重基因TaGW2的克隆、标记的开发及功能验证", 《中国博士学位论文全文数据库农业科技辑》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110055317A (en) * | 2019-04-29 | 2019-07-26 | 中国农业科学院作物科学研究所 | The method of external source function candidate gene is excavated in wheat distance edge hybrid offspring's Small piece transposition system |
| CN110055317B (en) * | 2019-04-29 | 2022-04-26 | 中国农业科学院作物科学研究所 | Method for discovering exogenous functional candidate genes in wheat distant hybridization progeny small-fragment translocation line |
| CN112680505A (en) * | 2021-01-07 | 2021-04-20 | 河南农业大学 | Functional marker development method based on wheat potassium transport protein gene |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104789575B (en) | 2018-01-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104774852A (en) | Major gene TaTGW-2A for controlling thousand-grain weight of triticum aestivum and CAPS marking method of major gene TaTGW-2A | |
| Daware et al. | An efficient strategy combining SSR markers-and advanced QTL-seq-driven QTL mapping unravels candidate genes regulating grain weight in rice | |
| CN111593060B (en) | Rice grain length gene and application of molecular marker thereof | |
| CN110578015A (en) | SNP marker closely linked with cabbage type rape high and short characters and application thereof | |
| CN104672315B (en) | Control gene and to Cucumber Roll palpus character related SNP marker of the cucumber without tendril character | |
| CN104774858A (en) | Major gene TaTGW-7A for controlling thousand-grain weight of triticum aestivum and CAPS marking method of major gene TaTGW-7A | |
| CN109112146A (en) | Control clone and the Breeding Application of the gene qSLWA9 of cabbage type rape silique length and grain principal characteristic shape | |
| Pan et al. | Natural variation in OsMKK3 contributes to grain size and chalkiness in rice | |
| CN107418957A (en) | Control rice cold tolerance gene C OLD2 and its application | |
| CN107603963A (en) | A kind of rice honeysuckle small ear gene DF1 and its coding protein and application | |
| CN104789575A (en) | Major gene TaTGW-2D for controlling wheat thousand seed weight and marking method thereof | |
| CN108570474A (en) | Rice flower development gene EH1 and its application | |
| CN110698550A (en) | Molecular detection method for rapidly identifying real plum/apricot plum strain | |
| Harper et al. | Integrating a newly developed BAC-based physical mapping resource for Lolium perenne with a genome-wide association study across a L. perenne European ecotype collection identifies genomic contexts associated with agriculturally important traits | |
| CN106566872A (en) | A pig SNP marker site analyzing method based on a sequence-based typing technique | |
| CN108642209A (en) | A kind of wheat plant mass of 1000 kernel judge mark and its application | |
| CN105506147B (en) | The Functional marker of corn germination gesture gene ZmGLP and its application | |
| CN108690848A (en) | Rice interspecific hybrid pollen fertility gene and its application | |
| CN104404052B (en) | Rice blast resistance gene RMg39 and its application | |
| CN113462696A (en) | Rice low-temperature sensitive leaf-shaped gene SRNL9 and application thereof | |
| Ai-Hong et al. | Screening for and genetic analysis on T-DNA-inserted mutant pool in rice | |
| CN112226442A (en) | Wheat grain size character related gene TaSRK, and coding protein and application thereof | |
| CN112779350A (en) | Molecular marker closely linked with wheat spikelet grain number QTLQGns | |
| CN109456984A (en) | Rice glume development gene AH1 and its application | |
| Han et al. | Rice genome research: current status and future perspectives |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Chang Cheng Inventor after: Hu Mingjian Inventor after: Zhang Haiping Inventor after: Zhu Xiaofeng Inventor after: Liu Peng Inventor after: Ma Gang Inventor after: Shao Hui Inventor after: Si Hongqi Inventor after: Ma Chuanxi Inventor before: Hu Mingjian Inventor before: Ma Chuanxi Inventor before: Chang Cheng Inventor before: Zhang Haiping Inventor before: Lu Jie Inventor before: Zhu Xiaofeng Inventor before: Liu Peng Inventor before: Ma Gang Inventor before: Shao Hui Inventor before: Si Hongqi |
|
| COR | Change of bibliographic data | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180105 Termination date: 20210427 |