CN108690848A - Rice interspecific hybrid pollen fertility gene and its application - Google Patents

Rice interspecific hybrid pollen fertility gene and its application Download PDF

Info

Publication number
CN108690848A
CN108690848A CN201810164610.3A CN201810164610A CN108690848A CN 108690848 A CN108690848 A CN 108690848A CN 201810164610 A CN201810164610 A CN 201810164610A CN 108690848 A CN108690848 A CN 108690848A
Authority
CN
China
Prior art keywords
gene
orf2
leu
sequence
glu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810164610.3A
Other languages
Chinese (zh)
Other versions
CN108690848B (en
Inventor
万建民
余晓文
赵志刚
张欣
江玲
朱杉杉
刘喜
刘世家
田云录
陈亮明
刘裕强
王益华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN201810164610.3A priority Critical patent/CN108690848B/en
Publication of CN108690848A publication Critical patent/CN108690848A/en
Application granted granted Critical
Publication of CN108690848B publication Critical patent/CN108690848B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Plant Pathology (AREA)
  • Botany (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention discloses a kind of rice interspecific hybrid pollen fertility gene and its application, more particularly to the relevant locus qHMS7 of rice interspecific hybrid pollen fertility, on the 7th chromosome long arm, in the regions 31.6kb between molecular labeling D17 and YU-33, and provide the DNA fragmentation of the related gene of rice interspecific sterility site qHMS7;The encoded protein sequence of hybrid pollen fertility gene is provided;The concrete application method of hybrid pollen fertility gene affine system of selection and breeding in rice genetic improved, process is provided;Provide the compact linkage molecule label generated according to the sequence of hybrid pollen sterile gene and its application in paddy rice cross breeding breeding.

Description

Rice interspecific hybrid pollen fertility gene and its application
Technical field
The present invention relates to field of plant genetic, and in particular to rice interspecific hybrid pollen fertility gene seat The separation clone of two genes of qHMS7, functional verification, and the application in paddy rice cross breeding breeding.
Background technology
There are powerful hybrid vigour, yield potentials for the intermolecular hybrid of between rice subspecies or Asia cultigen and wild relatives It is very big.Wild relatives also provide excellent germ plasm resource for the genetic improvement of Asian Cultivated Rice.Rice heterosis have with The increase of Parent genetic distance and increased trend, but accompanying this with reproduction isolation can also become more serious, this It is to excavate rice yield potentiality to increase natural obstacle (Peng et al., 1999) again.Therefore, to making full use of these Abundant genetic resources improves existing rice varieties, using the hybrid vigour of inter-species, first has to solve the problems, such as be exactly inter-species Or the hybrid dysgenesis problem of subspecies.
Hybrid dysgenesis is a kind of principal mode of reproduction isolation after zygote, is inherent caused by gene genetic interaction Isolation caused by factor.The Hybrid sterility between indica and japonica rice phenomenon of rice since nineteen twenty-eight is reported for the first time (Kato et al., 1928) what, many scientists did one's utmost goes this phenomenon of exploratory development.Have tens at present and controls paddy rice hybrid fertility Site is found, including influences hybrid pollen fertility, Spikelet fertility and pollen fertility and Spikelet fertility impacted three type simultaneously Type, however at present it has been reported that site most cases the type of its genetic locus and abortion on chromosome is only determined (Doi et al.,2008;Ouyang et al.,2009;Ma Shengjian et al., 2014).The Whole genome analysis in sterile site What we were replaced using wide compatibility gene or chromosome segment will be helpful to the influence degree analysis of hybrid fertile with them Method overcomes paddy rice hybrid Sterile barrier.Currently, hybrid pollen fertility site has positioning to report in 12 chromosomes of rice Road (Sano et al., 1979;Sano,1983,1990;Lin and Ikehashi,1993;Zhang Guiquan, Lu Yonggen, Zhang Hua, Yang Jinchang, Liu Guifu, 1994;Kubo et al.,2000;Sobrial et al.,2000;Sobrizal et al., 2000;And osmanthus power of Zhang Zemin, 2001;Li Wen great waves et al., 2002;Fourth imitate China et al., 2003;Taneichi et al.,2005;Hu et al.,2006;Chen Jing et al., 2006;Li Wen great waves et al., 2006;Fourth imitate China et al., 2007; Koide et al.,2008;Kubo et al.,2008;Li et al., 2008;Mizuta et al.,2010; Yamagata et al.,2010;Li et al.,2011;Liu et al.,2011;Win et al., 2011;Zhao et al.,2012;Sakata et al.,2014;Xu et al.,2014).These sites are referred to as in different cross combination For different names, subsequent research find some sites may be widely present in indica and japonica subspecies or rice inter-species or they Between there are epistatic interaction, codetermine hybrid dysgenesis;On the other hand, due to the limitation of study condition at that time, the area of positioning Between it is not fine enough, the site that may be previously reported was broken down into several sites later.Currently, the inter-species cloned or Asia The hybrid dysgenesis site of inter-species is very few, and the announcement of molecule mechanism is less, and which imply the difficulty of hybrid dysgenesis research is big With the weight of meaning.
Invention content
The present invention detaches the DNA fragmentation of the related gene of cloning rice interspecific sterility site qHMS7;Hybrid pollen is provided to educate The protein sequence of property coded by said gene;Hybrid pollen fertility gene affine system of selection and breeding in rice genetic improved, process is provided Concrete application method;Provide the compact linkage molecule label generated according to the sequence of hybrid pollen sterile gene and its in rice Application in crossbreeding.
One of the objects of the present invention is to provide with the relevant gene locus of rice interspecific hybrid pollen fertility, more precisely It is and the relevant locus qHMS7 of the interspecific hybrid fertility of southern wild rice and Asian Cultivated Rice.
The second object of the present invention is to provide the locus qHMS7 genes for being included:ORF1,ORF2,ORF3.
The third object of the present invention is to provide the albumen for the coded by said gene that locus qHMS7 is included.
The fourth object of the present invention is to provide a kind of mutation allele ORF2 of gene ORF2D-CR。
The fifth object of the present invention be to provide locus qHMS7 or it includes gene or mutation allele in rice Application in breeding.
The specific technical solution of purpose of the present invention is as follows:
The relevant locus qHMS7 of rice interspecific hybrid pollen fertility is located on the 7th chromosome long arm, and finely positioning exists Molecular labeling D17 and YU-33 be flanking marker the sections 31.6kb in,
The sequence of wherein molecular labeling D17 is:
D17F AGATCCCTCATCTTGTCGTCG (such as sequence SEQ ID NO:Shown in 12)
D17R GAAAGCAACGATAGATCCGCTA (such as sequence SEQ ID NO:Shown in 13);
The sequence of molecular labeling YU-33 is:
YU-33F GGAAGGTAATGGGAAAGAGAGAC (such as sequence SEQ ID NO:Shown in 14)
YU-33R GCGAGGATAAAGTTGGTATAGCC (such as sequence SEQ ID NO:Shown in 15).
The genotype that locus qHMS7 of the present invention includes can determine the kind of southern wild rice and Asian Cultivated Rice Species hybrid pollen whether abortion.
Further, the present invention provides specific gene ORF1, ORF2 or ORF3 in locus qHMS7, locus QHMS7 is one or more close linkages in gene ORF1, ORF2 or ORF3;The wherein allelic form packet of gene ORF1 Include ORF1D,ORF1M, gene ORF1DSequence such as SEQ ID NO:Shown in 10, gene ORF1MSequence such as SEQ ID NO:11 It is shown;The allelic form of gene ORF2 includes ORF2D,ORF2MAnd ORF2N, gene ORF2DSequence such as SEQ ID NO:1 It is shown, encoded protein sequence such as SEQ ID NO:Shown in 2, gene ORF2MSequence such as SEQ ID NO:Shown in 3, institute The protein sequence of coding such as SEQ ID NO:Shown in 4;Gene ORF2N, sequence such as SEQ ID NO:Shown in 5, encoded egg White matter sequence such as SEQ ID NO:Shown in 6;The sequence of gene ORF3 such as SEQ ID NO:Shown in 7, encoded protein sequence Such as SEQ ID NO:Shown in 8.
Invention relates further specifically to two related gene ORF2 for detaching and being included using qHMS7 locusDWith ORF3, their biological function are the pollen fertilities for the hybrid for controlling rice inter-species or inter-subspecies hybrid generation.Wherein ORF2DIt can cause its pollen stamen abortion in a manner of sporinite, and ORF3 can restore pollen fertility in a manner of gametophyte.
Gene ORF2 provided by the present inventionDSequence such as SEQ ID NO:Shown in 1.
Gene ORF2 provided by the present inventionDEncoded protein sequence such as SEQ ID NO:Shown in 2.
The sequence of gene ORF3 provided by the present invention such as SEQ ID NO:Shown in 7.
The encoded protein sequences of gene ORF3 such as SEQ ID NO provided by the present invention:Shown in 8.
The present invention also specifies gene ORF2NNucleotide sequence, it is specific such as SEQ ID NO:Shown in 5, with gene The ORF2 of the chain formation of ORF3N- ORF3 genotypic rices can become wide affine type rice strain, for overcoming rice inter-species Or the hybrid sterility of subspecies.
The present invention provides gene ORF2NEncoded protein sequence such as SEQ ID NO:Shown in 6.
The invention further relates to the carrying RIP structural domains detached and application rice hybrid pollen fertility gene ORF2 is encoded The DNA fragmentation of (Ribosome-inactivating protein) toxic protein or its correspondence protein fragments, and to the segment The mechanism of action be illustrated.
The invention further relates to the rice hybrid pollen fertility bases for detaching and encoding the peculiar solution toxalbumin of grass family using one Because of the DNA fragmentation of ORF3 or its correspondence protein fragments, and the mechanism of action of the segment is illustrated.
The present invention also provides locus qHMS7, gene ORF2DOr applications of the gene ORF3 in paddy rice cross breeding breeding.
Application of the present invention, can be by destroying gene ORF2DFunction or knock out gene ORF2D, improve rice The destruction methods of hybrid pollen fertility, gene function can select currently used method, such as gene mutation;Or by turning base Because of means transgene ORF3, rice hybrid pollen fertility is improved.
The present invention also provides a kind of ORF2DNonfunctioning artificial mutation allele ORF2D-CR, sequence such as SEQ ID NO:Shown in 9.Gene ORF2 of the present inventionD-CRIt can become completely fertile by pollen fertility in the sites qHMS7 heterozygosis.
The present invention also provides gene ORF2D-CRApplication in paddy rice cross breeding breeding.
The present invention also provides a kind of methods for cultivating wide affine type rice strain, pass through artificial mutation ORF2D- ORF3 groups It closes in genotypic rice such as SEQ ID NO:Gene ORF2 shown in 1DFor SEQ ID NO:Gene ORF2 shown in 9D-CR, selection " ORF2 after mutationD-CR- ORF3 " genotypic rices are wide affine type rice strain.The strain rice again with other rice Hybridization, which is no longer result in pollen sterility." the ORF2 that the present invention is obtainedD-CRThe wide affine type rice of-ORF3 " genotype Strain can be used for overcoming rice inter-species or the hybrid sterility of subspecies, to enable the hybrid vigour of inter-species to play profit With, be also beneficial to the utilization of excellent Wild ornamental resources, further increase hybrid rice yield and rice genetic improvement.
The present invention also provides the molecular labeling D7-3 for identifying paddy rice hybrid fertility gene type, sequence is as follows:
D7-3F:CCAGGGAATACAATCACAATG (such as sequence SEQ ID NO:Shown in 16);
D7-3R:AAGCAGGAAGCAACTAAACAA (such as sequence SEQ ID NO:Shown in 17).
The present invention also provides applications of the molecular labeling D7-3 in paddy rice cross breeding breeding, specifically can be used for turning base Cause or filial generation detection, it can also be used to molecular marker assisted selection breeding.
The present invention is analyzed by the QTL methods detected, and be found that leads to south for the first time on the 7th chromosome long arm The seats qHMS7 of the interspecific hybrid pollen abortion of wild rice and Asian Cultivated Rice.By being returned molecular marker assisted selection and flower The method that powder Fertility identification is combined constructs NIL-qHMS7, and the present invention is obtained by map-based cloning in qHMS7 locus 2 adjacent hybrid pollen fertility related genes, including ORF2DAllele, ORF2MAllele and ORF2NEquipotential base Cause and ORF3 allele, the function of these genes is demonstrated by transgenic experiments.And provide a kind of wide compatibility Allelic combination ORF2D-CR-ORF.The separation clone of neighboring gene ORF2 and ORF3 on the seats qHMS7 and functional study, It will be helpful to effective profit preferably using the hybrid vigour and wild rice fine genes between rice subspecies in breeding With.
Description of the drawings
Fig. 1, show rice qHMS7 locus two parents and near isogenic lines genotype and to pollen fertility It influences.
Fig. 2, the finely positioning figure for showing rice qHMS7 locus.
The gene and protein structure figure of Fig. 3, rice qHMS7 gene locis ORF2 and ORF3.
Fig. 4, NIL-qHMS7 are transferred to the display function confirmatory experiment after the ORF3 from DJY1.
Fig. 5, NIL-M/M are transferred to the ORF2 of DJY1DDisplay transfer-gen plant functional verification experiment.
Fig. 6, display CRISPR-CAS9 knock out ORF2DFunctional verification experiment.
Specific implementation mode
The content that following embodiment further illustrates the present invention, and describe the present invention and divide on the basis of above-mentioned previous work From the DNA fragmentation that clone includes the complete sections of ORF2 and ORF3 on qHMS7 locus, and verify the work(of gene contained by qHMS7 The method of energy.According to description below and these embodiments, those skilled in the art can determine the essential characteristic of the present invention.If It does not specialize, the conventional means that technological means used is well known to those skilled in the art.
With reference to example, the present invention will be further described, but is not the limitation present invention.
Embodiment 1:The screening of polymorphic molecular marker and the finely positioning of qHMS7
Use japonica rice variety DJY1 for recurrent parent first in the present invention, the southern wild rice (O. of affiliation farther out Meridionalis, Mer) it is donor parents, build the BC of DJY1/Mer//DJY11F1Group carries out QTL detections, finds qHMS7 Effect is very big, and the location proximate found in various combination positioned at forefathers, it may be possible to be prevalent in one of rice inter-species Hybrid dysgenesis site, thus it be Study On Rice hybrid dysgenesis ideal site (Lin and Ikehashi, 1993; DOI et al.,1998;Sobrial et al.,2000;Yan et al.,2003a;Chen et al.,2006;Miyazaki et al., 2006a).By the Backcrossing methods of molecular marker assisted selection, finally in BC6F2It has found in population material and is inserted containing Mer It is small to enter segment, genetic background is clean, the single plant (BC of pollen semi-sterility6F2- 2009-11), it is denoted as " NIL-qHMS7 ", but due to M Type pollen stamen abortion, therefore BC6F2The near isogenic lines that still cannot get southern wild rice Insert Fragment homozygosis in group, originally grinds It is heterozygosis that near isogene in studying carefully, which ties up to the sites qHMS7,.Pass through the I of 1% (w/v)2The shape of-KI solution dyeing identification pollen The pollen fertility of state, DJY1 and Mer are normal, and pollen fertility semisterility (Fig. 1, (A) background parent japonica rice of NIL-qHMS7 The pollen fertility that DJY1 (D/D) is generated is normal;(B) flower that donor parents south wild rice O.meridionalis (M/M) is generated Powder fertility is normal;(C) the pollen fertility semisterility that near isogenic lines NIL-qHMS7 (D/M) is generated;(D) near isogenic lines NIL- The genome schematic diagram of qHMS7 (D/M)).
According to the data (http in disclosed Public Rice Genome Sequence Data library://ensembl.gramene.org), at this The multiple polymorphic molecular markers of regional development, as shown in table 1.
Table 1. and qHMS7 close linkages or the polymorphic molecular marker isolated
InDel marker developments in table 1:The related sequences of Nipponbare (japonica rice) that oneself announces are downloaded from the websites Gramene Row and indica rice 93-11 (long-grained nonglutinous rice) sequence, finding existing insertion or missing between Nipponbare and 93-11, (general difference is wanted More than or equal to 4bp), design respective markers with Primer Premier 5.0.
DCAPS label designs:This is a kind of SNP (Single Nucleotide Polymorphism) to be converted to molecule The method of label introduces base mismatch in amplified production and forms the recognizable site of restriction enzyme by special primer, To achieve the purpose that digestion detects single nucleotide polymorphism (SNPs), this method can almost turn all sites SNPs The molecular labeling being melted into based on PCR.First download the Nipponbare and 93-11 for wishing to develop label respectively from the websites NCBI Genome sequence, then two sequences are compared, difference site is found out, Dianjingyou No.1 and south are then confirmed by sequencing It whether there is this difference site in wild rice, finally use 2.0 (http of dCAPS Finder:// Helix.wustl.edu/dcaps) website and 5.0 softwares of Primer Premier separately design mismatched primers and normal primer Carry out PCR amplification.
The method of above-mentioned molecular marker analysis is as described below:
(1) total DNA of above-mentioned selection single plant is extracted as template, and the specific method is as follows:1. taking 0.2 gram or so of rice children Leaflet tablet is placed in the Eppendorf pipes for having placed steel ball, 5min is freezed in liquid nitrogen, is placed in 2000 type GENO/GRINDER instrument Sample 1min is crushed on device;2. 660 μ l CTAB extracting solutions, water-bath 30min is added;3. 900 μ l chloroforms are added, mix well, 12000rpm centrifuges 3min;4. it shifts in supernatant to 1.5mL Eppendorf pipes, 600 μ l isopropanols of addition, mixing, 12000rpm centrifuges 5min;5. abandoning supernatant, 70% (volumn concentration) ethyl alcohol of precipitation rinses primary, room temperature airing;⑥ 100 1 × TE of μ l (121 grams of Tris are dissolved in 1 liter of water, the solution obtained with hydrochloric acid tune pH value to 8.0) dissolving DNA is added;7. taking 2 μ l electrophoresis detection DNA mass, are used in combination DU800 spectrophotometric determinations concentration (Bechman Instrument Inc.U.S.A)。
(2) DNA of said extracted is diluted to about 20ng/ μ l, PCR amplification is carried out as template;
PCR reaction systems (10 μ l):DNA (20ng/ul) 1ul, sense primer (2pmol/ul) 1ul, downstream primer (2pmol/ul) 1ul, 10xBuffer (MgCl2Free) 1ul, dNTP (10mM) 0.2ul, MgCl2(25mM) 0.6ul, rTaq (5u/ul) 0.1ul, ddH2O 5.1ul, total 10ul.
PCR response procedures:94.0 DEG C of denaturation 5min;94.0 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 1min, altogether Cycle 35 times;72 DEG C of extension 7min;10 DEG C of preservations.
(3) the PCR product detection of molecular labeling
Amplified production is analyzed with 8% native polyacrylamide gel electrophoresis.Using the DNA Ladder of 50bp as contrast ratio Compared with the molecular size range of amplified production, silver staining colour developing.
Using molecular labeling to BC6F2About 19000 single plants are analyzed in group, construct qHMS7 locus (Fig. 2 develops molecular labeling used for positioning and is shown in " molecular labeling " a line in figure genetic linkage maps, horizontal green Or white rectangles represent the genotype of corresponding single plant, recombinate the pollen fertility of single plant as shown in figure block diagram, " Mer ", Black arrow on long line at " DJY1 " represents corresponding gene in positioning section).Finally target interval is locked as shown in the figure It is scheduled in the regions 31.6kb between molecular labeling D17 and YU-33.
Embodiment 2:The sequence analysis of qHMS7 locus related genes
According to NCBI and RGAP (Rice genome annotation project) website forecast analysis, in the area In:Japonica rice strain DJY1 is respectively designated as ORF1 there are three expression albumenD, ORF2D, ORF3;And in southern wild rice (Mer) ORF1 is only existed inMAnd ORF2MTwo genes finally specify ORF1, ORF2 and ORF3 by generation sequencing technologies DNA sequence dna, the wherein ORF2 of DJY1D, the corresponding nucleotides sequences of ORF3 are classified as SEQ ID NO:1, SEQ ID NO:7;They are right The protein sequence answered is SEQ ID NO:2, SEQ ID NO:8;The ORF2 of MerMCorresponding nucleotides sequence is classified as SEQ ID NO:3;Corresponding protein sequence is SEQ ID NO:4.The gene and protein of rice qHMS7 gene locis ORF2 and ORF3 Structure chart is as shown in figure 3, wherein Fig. 3 A show ORF2D, ORF2N, ORF2MProtein structure schematic diagram, Fig. 3 B show ORF3 Protein structure schematic diagram.
Embodiment 3:The function of genetic transformation hard objectives gene
By the ORF2 in embodiment 2D, ORF3 complete genome group section (include promoter region and 3 ' end non-coding Area) it is cloned into binary transformation vector pCAMBIA1305 (Australian CAMBIA companies).Carrier after sequencing confirms passes through chemistry Conversion method, which is gone in Agrobacterium EH105, to be prepared to infect callus.When using NIL-qHMS7 as transgene receptor, recipient genotypes are D/M, its pollen fertility can partly be restored (Fig. 4, Fig. 4 A, which are shown, is used as transformation receptor to 75% or so by being transferred to the ORF3 from DJY1 Heterozygosis strain (D/M types) pollen semi-sterility, Fig. 4 B show that heterozygosis strain (D/M types) pollen after transgenosis imports ORF3 is educated Property part restore (about 75%), Fig. 4 C are shown saved the gametes of M types because of ORF3 after there are M/M type carry genetic modifications The plant of ORF3 segments, pollen fertility are normal);When using NIL-M/M as transgene receptor, recipient genotypes M/M is transferred to The ORF2 of DJY1DLeading to its pollen stamen abortion in a manner of sporinite, (Fig. 5, Fig. 5 A are shown by M/M type carry genetic modifications The plant pollen fertility of the isolated M/M types of plant selfing of ORF3 segments is normal, and Fig. 5 B show that transgenosis imports ORF2D The plant pollen stamen abortion of M/M types afterwards).This example demonstrates the biological functions of each allele, and prove ORF2D can cause the pollen stamen abortion, ORF3 to restore pollen fertility in a manner of gametophyte in the case where ORF3 is not present.
Embodiment 4:Utilize the wide affine system of CRISPR-CAS9 system creations
According to described as a result, ORF2 in embodiment 2DAnd ORF2MThere are many places differences, can be defined according to embodiment 3 ORF2DIt is the gene for leading to pollen stamen abortion, we utilize CRISPR-CAS9 (GeneArt CRISPR Nuclease Vector Kit, Invitrogen) create ORF2DNonfunctioning be mutated ORF2D-CR, sequence such as SEQ ID NO:9 institutes Show, it is found that pollen fertility becomes completely fertile in the sites qHMS7 heterozygosis.This material is allowed to be selfed again, selection, which does not carry, turns base It because of the plant of carrier, is returned with DJY1, has obtained the nonfunctional " ORF2 under DJY1 backgroundsD-CR- ORF3 " composite types are producing In for the sites qHMS7, as wide affine type plant lines, such as carry " ORF2D-CRThe plant of-ORF3 " The genotype heterozygosis of " A5518-1-3 " at qHMS7, but the normal (target site of Fig. 6, Fig. 6 A displays CRISPR of pollen fertility With for analysing whether to knock out successful molecular labeling, Fig. 6 B show heterozygous (D/M) adjoining tree for not carrying out gene knockout Pollen semi-sterility, successful knockout ORF2DHeterozygous plant pollen fertility restorer it is normal).
Embodiment 5:Utilize the genotype of the molecular markers for identification rice interspecific hybridization hybrid of ORF2
ORF2 can be generated using sequence information provided by the inventionDAnd ORF2NMolecular labeling " the D7- of allele specific 3 " (tables 1), D7-3F CCAGGGAATACAATCACAATG (such as sequence SEQ ID NO:Shown in 16), D7-3R AAGCAGGAAGCAACTAAACAA (such as sequence SEQ ID NO:Shown in 17), for identifying wild rice and cultivated rice in qHMS7 bases Because of the genotype of seat, can be used in molecular marker assisted selection breeding process.It is obtained using the Markers for Detection ORF2 genes main effect allele ORF2DPCR product and allele ORF2N(first passage of the present invention such as embodiment 1 Its clear nucleotide sequence of the scheme such as SEQ ID NO:Shown in 5, the protein sequence such as SEQ ID NO of coding:Shown in 6) Nucleotides sequence shows SNP differences at 6, and these differences are relatively conservative difference sites, can identify Asia by sequencing The main effect allele ORF2 of ORF2 genes in cultivated riceDOr ORF2DAllele ORF2NGenotype.Meanwhile and because ORF2N- ORF3 is the combining form of affinity type, therefore can utilize this label sorting and cultivate the affine kind of new hybrid.
Sequence table
<110>Agricultural University Of Nanjing
<120>Rice interspecific hybrid pollen fertility gene and its application
<160> 17
<170> SIPOSequenceListing 1.0
<210> 1
<211> 6191
<212> DNA
<213>Dianjingyou No.1 (Dianjingyou1)
<400> 1
atcgctttct tgttcgaggt cggcgaggcg cgcgggcggc ggcgatcggc tagggctcga 60
tgagcggcgg caggtctccg gcggacggcc ggggatcacc gccgcttggc accaggctcc 120
ggccgccggt gcaacgggta ttctcatcct cgttctctcc aatcccattc ccccctctta 180
aaacccacct ccactgggtt tcaatcgctg ggatttatcc aattttctcc tctactaatc 240
cctccccaat acccacctcc actgggtttc aatcgctggg atttatccaa ttttctcctc 300
tactaatccc tccccaattg ggttcagaaa ccagttcatg ccgccattcc cgggtggcat 360
ttcgattccc gacatccaaa cgggaatcga ctcgccgttg ctgtgctcgg ttcagcgaac 420
cgccttctcc actgcgcgcg catagcgcta tataaaccct cctcctcctc ctcctcctcc 480
tcctcccgag aattaggaga gggacaccaa caagcgaaat ccacagcccg atcgaattgc 540
catccgcggc ggaatccatt tcgttagcaa gcaagcaagc cggtgcgcgc gagaggcgtc 600
gcggcattag catcagcgcc gcttcgtcgc cttcgtctcc cttctcccct gctcccctcc 660
actgctcggt gtcgcacggt ggtgcgcttc ctggacgaca atgtatgtac tagtaaattg 720
gggagctagc gcggcgttgc atttgatctt ttctgtcgtt tgcttgattc ttgtgcgttc 780
ttgaggtggt ttgtggagca tctggtacaa tcaagagcgg ttttggttga attccgggga 840
cgggtgggtt cttggctaga acgatccttc gcttcttgtc tactctttac gcgggtgaat 900
tcttgtaacg gtttgtggat tatctggtac aatcttgatg gttctagttg aactctggat 960
actgattctt ggccgggacg atgcctttta ctcttgtgat tctttgcggg ttcagctctt 1020
ctaggggttc gtggattatc gagtacaatc ttggcggttt tagttgcact ctggatactg 1080
attcttggcc agaacgatgc tttgtactct tgtgattctt tgcggggtga gctcttctag 1140
gggttcgtgg agtatctagt acaatctgag tggtattggt ttaattccga gattatgttc 1200
ttggctggaa tggttctcgt ttgtagatat acaacttctc ttttcttctt ttcgtgtgtt 1260
cttgtggagg ctccggttct atggcattac aggaggagta ggtttcggtt agttttggtt 1320
ggattctgag aagggttatt ggaaagaaca gttcttgctc attgggttcg ttctcttact 1380
atgatgattt tggctgggtt ggtgggtata gagttcctgt tttgcatcaa tgtggaaaaa 1440
cacgagttgg tgcaaatgtt tcctcttttg tgggtgcaaa cagagctaga tgcaacatgc 1500
aaggcttctg gttttgcttg cataattttc tctactgcca cattttggtt taattgttat 1560
ccttgtaatc ttttagaaat aactgccgat ttttctaatc agaaacattg gtttgcagtg 1620
ggtttttata ttttgtccct tgtgttgcag gaacggggag catatgctcc aatgtcaact 1680
ggttttgcgg cacaaaatcg agaagttgga gccatcatgt gcaaatgcta ctgttcagta 1740
cgccaacata gcaaagccaa gttggatcag ttggtatgca ttttcagctc cggatgaggc 1800
aatacaagcc ctgattagtg aggcgaagtc atactacatg aggctccccc caatacaaca 1860
cctccagcag ttacccttac tgcagtcacc ttcaacgcgg tatgattatg aatccccatc 1920
gctctatttg gagcctcagt ttcaggtcct tttctgatct tgatttattt ggccggcaaa 1980
agatcaatcc ctcgcatcca aggacttgca caaaatcttc cataagtact ttcttgagga 2040
ttttaaaact agttattagt tgaagatatg tttgatcttg tactcttaaa gttagtttct 2100
ggttattatg ttttcatcaa gacatatttg attgatggat ggatgtaatg cttaggattt 2160
catcagataa aattacaggg tagaaatttg cattatatat atttaattgc aatgtatata 2220
tcataggaac aataaatttc tacagcttga gatgtacaaa tgagcaaaag atacaatgca 2280
gttattctta ttcaagaact gcagtcgtta ctgttttgca agtttaactt ttggcattcc 2340
attttatatt tctttgtttc tgctgagggt tcagctttat ttctccgaga tattaagtta 2400
gttctgctgc tcagacagct tgcaatggat aataatgctg atgtctccac accaacattg 2460
ttgtcaatat caggtgattt ttttgtcgat ttattattcg gtgatgatat agaatttacc 2520
atatataata tatgattgat agagtttgac ctttggcatt ccattttata atatctgatc 2580
gatagagttg ctaatatgct atgggaccat gatagtcaaa tagtgtacat actgccacat 2640
cacctattga ctcgtgatag aaactttact aatcaaggct aaaaaatcac acaactgttg 2700
aacatgttat tataggaaga gctcatattt agtgtcaatg catgcttaaa agtagttaaa 2760
tttttaccct gaaatctgtc tcaaatacaa ttatttcctg agttagtgtg gtcctaggat 2820
ggtagagtag aatctgaaag tttgtcatag attaataata gaatccaata gtgccgcagt 2880
actctagtat tgtatagtta cataaaacat tcaatagaga tttaacatga aatttggtga 2940
atccagtaac ttgtactgct aaaatgccat atattgattt tatctttcat gtcagcaatc 3000
gaatcctttt taggctcagc tgtaatatgt tactaacatc taaaagtatg ttctgccaat 3060
tatttcaatc aacatgttaa tttctttgca tgtgggcagc tctggttggc gatgttacta 3120
atttaagtgc cgaggaatcg agaagaaggc agcaacgtga aataaacaat tctttgaaag 3180
tggaagcatg gaatgaatac acatttcttg gatgtgctaa tacagctggg tcaggtaatg 3240
cccctatttt ttcacacacg atgtaaatta caaattcact gttgctctat tttgaagtta 3300
attagcgatt ctttgtttca acaggaagtg taactcgcca acccgtgatc acacctagac 3360
gcctcacgcc tctcatttag aatttacatc cagtccaagt taattgcaaa tctttgttaa 3420
tctttgataa cttacaaccc gacactactg tttatatgtt ctatacttgt ctttatacat 3480
ctgtatgaca tgttaatcga ttgaatggtt aacaacgtgc taaatatttc tcaaactatt 3540
tgacagtgct gtctcttgtc caattaaaac tgcaatgaga aattctgtaa aattattaaa 3600
tccaagatat tttatttcca aaaatgtggc atgagtttgg aaaaatgaca ttcattagtc 3660
attcaattat tacatctacc cctttgggtg tgcctgcaca ttggagcata ggaatcagga 3720
ctgtgatctg ataattgcaa cacttgcagc ttgcaagaaa agagtcaaag cttcatcact 3780
tgataatgta aaagcacaat gccatatgat acttgaagat aaacgaatag agctgaagga 3840
gtacttgaat gatctgtgtc acgacaagca caaggtatta tgtttctata atttgcagta 3900
ctattattaa ttttgtaaca ctatggtatc tcagttacga atgaactttg caggttattg 3960
ataatatctg taagaaatat gaactagaaa atatagaaat cactaatgcc aaaaaacaaa 4020
aggtaagcta agtttctttt ttcttttgaa aagtatttaa gctaggtatt tggattgctg 4080
gtgttattct aatgctatat tttttctgaa tgttggaaaa ttcaggcaga aaaactctct 4140
agggaaatga aaaacaaatg taataaaaag atgcccaagt cacaaggagc aaaggtaagt 4200
tgaactagtt tgatttcttc atttgaaaca aatgaatgtt acttttttgt gatgcatgtg 4260
ccattggaat gctgcaaaag ttgtttgtgt aatagttgaa taaagtaagc taagcatttc 4320
agctactgat agttttcttt aatgatgctc atttctttca ctactatgaa actgaaaact 4380
gaccatatgc ttgagtcatg gggggttttg tactaatgtt taatgaaagt tgtataaaaa 4440
tgaaaaatac taatagatcc ttgagtcacg aagggcaata ttcttttcag gtgttgaaca 4500
ccatgaggtt cttccataca actccttcta aggagaaatc aaaaacaaaa aaggtatggt 4560
gattgaggga tttttaagat cgttcatgct atatttagtc tattttggtt tttgttgtct 4620
ccttatctca aggaaatcca acaagggaat attttcttgt ttttatatta tgcagttcag 4680
agatccaaag gatggttatc caggaaattc aaaggatgga agttatccag ggaatacaat 4740
cacaatggat atggataaag acaacctgcc tgcatttagg cgtagtttta aaagggcaat 4800
taaaaaaggc cgagcatggt gccaggcaaa cagcaattcg gttgacatat caggactctt 4860
tggtcccgga gccgaagttt atacaacccc cgcagccgga actttgcatg tgaagcttag 4920
gaacaaaggg cgtgaactta cactcttctt ccgtggtaga gacttatacc tgaaagggtg 4980
gagaagtgat aggtttggtc tgtttgctgc ccaccctgat aggtttgata agaagaattg 5040
cttcatacaa gacaaagctt gcaaacacct gaacatcgag gataattatc atcagcttgt 5100
tccaggagga agaatcggga aagtcagagt gggacccctt gcaatgctag actattttga 5160
agtccttcac aaatgcaatg gaatagtgac aacagatgtt ctgggggctg tggctggatt 5220
tgctgttaac ttcgcagaac caatacgcca ggaagatgtc ttggaggata tcttagagtc 5280
gtttgttcat tttgatgtgg ctatgctgga tagcagaagg gcactatcct tggacgtaag 5340
gaaatacgac cactactcaa gggagtttct aactggtgtt gattgcttat tgcacggtag 5400
accaatgcca gagattttga agcgtgagga agttacagtc aagtcactcc atgagttgtg 5460
gtgcagaatc aaagttccgc tgagagactc ttataatgat ggtgcatttt atcatgatga 5520
taaagttggc atacccgtct ggtctccccc ctaccctgat gggaataatt gggaggagga 5580
ggaagatgaa gaggaagaag aggaagaggg agataaagag gaagaggctg aggaagaaga 5640
ggaagaggaa gaagaggaag aggctgagga agatgcaaac caccgtgatc taaaattcac 5700
aagccaacag gacttctttt cagttgggat gaaggctaat gaaatcaaca cctcttgtct 5760
ctgtcgtcct ttctctgcag ttgcctcagg tgggatgagg ccccttgttg tccctccaag 5820
tcagggtggg gaagtccaga gccggtttct gagcaggagg ccacagtggt tctccagatt 5880
cattaatgga ccaagggctg cgtgtttttt gaggaggcta ctaaaatagc gaccacggct 5940
ggtggagcgg gcttcttgat tcttttgtgt ctgtctgaaa ttttgatatg tctgaaatgt 6000
atctcttttg ctttgtttag ttgcttcctg cttacaaaca tgtaaaattt ctctaaagga 6060
gaagttgtcc agaagtttca tttgcatcat gctcttttct gccttccaaa catgagcaaa 6120
ctccattagg atacttggct ttgtcttgag tacatcatgg atcatgaagc acatttatgc 6180
taagtgagat t 6191
<210> 3
<211> 669
<212> PRT
<213>Dianjingyou No.1 (Dianjingyou1)
<400> 3
Met Leu Gln Cys Gln Leu Val Leu Arg His Lys Ile Glu Lys Leu Glu
1 5 10 15
Pro Ser Cys Ala Asn Ala Thr Val Gln Tyr Ala Asn Ile Ala Lys Pro
20 25 30
Ser Trp Ile Ser Trp Tyr Ala Phe Ser Ala Pro Asp Glu Ala Ile Gln
35 40 45
Ala Leu Ile Ser Glu Ala Lys Ser Tyr Tyr Met Arg Leu Pro Pro Ile
50 55 60
Gln His Leu Gln Gln Leu Pro Leu Leu Gln Ser Pro Ser Thr Arg Gln
65 70 75 80
Leu Ala Met Asp Asn Asn Ala Asp Val Ser Thr Pro Thr Leu Leu Ser
85 90 95
Ile Ser Ala Leu Val Gly Asp Val Thr Asn Leu Ser Ala Glu Glu Ser
100 105 110
Arg Arg Arg Gln Gln Arg Glu Ile Asn Asn Ser Leu Lys Val Glu Ala
115 120 125
Trp Asn Glu Tyr Thr Phe Leu Gly Cys Ala Asn Thr Ala Gly Ser Ala
130 135 140
Cys Lys Lys Arg Val Lys Ala Ser Ser Leu Asp Asn Val Lys Ala Gln
145 150 155 160
Cys His Met Ile Leu Glu Asp Lys Arg Ile Glu Leu Lys Glu Tyr Leu
165 170 175
Asn Asp Leu Cys His Asp Lys His Lys Val Ile Asp Asn Ile Cys Lys
180 185 190
Lys Tyr Glu Leu Glu Asn Ile Glu Ile Thr Asn Ala Lys Lys Gln Lys
195 200 205
Ala Glu Lys Leu Ser Arg Glu Met Lys Asn Lys Cys Asn Lys Lys Met
210 215 220
Pro Lys Ser Gln Gly Ala Lys Val Leu Asn Thr Met Arg Phe Phe His
225 230 235 240
Thr Thr Pro Ser Lys Glu Lys Ser Lys Thr Lys Lys Phe Arg Asp Pro
245 250 255
Lys Asp Gly Tyr Pro Gly Asn Ser Lys Asp Gly Ser Tyr Pro Gly Asn
260 265 270
Thr Ile Thr Met Asp Met Asp Lys Asp Asn Leu Pro Ala Phe Arg Arg
275 280 285
Ser Phe Lys Arg Ala Ile Lys Lys Gly Arg Ala Trp Cys Gln Ala Asn
290 295 300
Ser Asn Ser Val Asp Ile Ser Gly Leu Phe Gly Pro Gly Ala Glu Val
305 310 315 320
Tyr Thr Thr Pro Ala Ala Gly Thr Leu His Val Lys Leu Arg Asn Lys
325 330 335
Gly Arg Glu Leu Thr Leu Phe Phe Arg Gly Arg Asp Leu Tyr Leu Lys
340 345 350
Gly Trp Arg Ser Asp Arg Phe Gly Leu Phe Ala Ala His Pro Asp Arg
355 360 365
Phe Asp Lys Lys Asn Cys Phe Ile Gln Asp Lys Ala Cys Lys His Leu
370 375 380
Asn Ile Glu Asp Asn Tyr His Gln Leu Val Pro Gly Gly Arg Ile Gly
385 390 395 400
Lys Val Arg Val Gly Pro Leu Ala Met Leu Asp Tyr Phe Glu Val Leu
405 410 415
His Lys Cys Asn Gly Ile Val Thr Thr Asp Val Leu Gly Ala Val Ala
420 425 430
Gly Phe Ala Val Asn Phe Ala Glu Pro Ile Arg Gln Glu Asp Val Leu
435 440 445
Glu Asp Ile Leu Glu Ser Phe Val His Phe Asp Val Ala Met Leu Asp
450 455 460
Ser Arg Arg Ala Leu Ser Leu Asp Val Arg Lys Tyr Asp His Tyr Ser
465 470 475 480
Arg Glu Phe Leu Thr Gly Val Asp Cys Leu Leu His Gly Arg Pro Met
485 490 495
Pro Glu Ile Leu Lys Arg Glu Glu Val Thr Val Lys Ser Leu His Glu
500 505 510
Leu Trp Cys Arg Ile Lys Val Pro Leu Arg Asp Ser Tyr Asn Asp Gly
515 520 525
Ala Phe Tyr His Asp Asp Lys Val Gly Ile Pro Val Trp Ser Pro Pro
530 535 540
Tyr Pro Asp Gly Asn Asn Trp Glu Glu Glu Glu Asp Glu Glu Glu Glu
545 550 555 560
Glu Glu Glu Gly Asp Lys Glu Glu Glu Ala Glu Glu Glu Glu Glu Glu
565 570 575
Glu Glu Glu Glu Glu Ala Glu Glu Asp Ala Asn His Arg Asp Leu Lys
580 585 590
Phe Thr Ser Gln Gln Asp Phe Phe Ser Val Gly Met Lys Ala Asn Glu
595 600 605
Ile Asn Thr Ser Cys Leu Cys Arg Pro Phe Ser Ala Val Ala Ser Gly
610 615 620
Gly Met Arg Pro Leu Val Val Pro Pro Ser Gln Gly Gly Glu Val Gln
625 630 635 640
Ser Arg Phe Leu Ser Arg Arg Pro Gln Trp Phe Ser Arg Phe Ile Asn
645 650 655
Gly Pro Arg Ala Ala Cys Phe Leu Arg Arg Leu Leu Lys
660 665
<210> 3
<211> 6462
<212> DNA
<213>Southern wild rice (O. meridionalis, Mer)
<400> 3
atcgctttct tgttcgaggt cggcgaggcg cgcgggcggc ggcgatcggc tagggctcga 60
tgagcggcgg caggtctccg gcggacggcc ggggatcacc gccgcttggc accaggctcc 120
ggccgccggt gcaacgggta ttctcatcct cgttctctcc aatcccattc ccccctccta 180
aaacccacct ccactgggtt tcaatcgctg ggatttatcc aattttctcc tctactaatc 240
cctccccaat tgggttcaga aaccagttca tgccgccatt cccgggtggc atttcgattc 300
ccgacatcca aacgggaatc gactcgccgt tgctgtgctc ggttcagcga accgccttct 360
ccactgcgcg cgcatagcgc tatataaacc ctcctcctcc tcctcctcct cctcccgaga 420
attaggagag ggacaccaac aagcgaaatc cacagcccga tcgaattgcc atccgcggcg 480
gaatccattt cgttagcaag caagcaagcc ggtgcgcgcg agaggcgtcg cggcattagc 540
atcagcgccg cttcgtcgcc ttcgtctccc ttctcccctg ctcccctcca ctgctcggtg 600
tcgcacggtg gtgcgcttcc tggacgacaa tgtatgtact agtaaattgg ggagctagcg 660
cggcgttgca tttgatcttt tctgtcgttt gcttgattct tgtgcgttct tgaggtggtt 720
tgtggagcat ctggtacaat caagagcggt tttggttgaa ttccggggac gggtgggttc 780
ttggctagaa cgatccttcg cttcttgtct actctttacg cgggtgaatt cttgtaacgg 840
tttgtggatt atctggtaca atcttgatgg ttctagttga actctggata ctgattcttg 900
gccgggacga tgccttttac tcttgtgatt ctttgcgggt tcagctcttc taggggttcg 960
tggattatcg agtacaatct tggcggtttt agttgcactc tggatactga ttcttggcca 1020
gaacgatgct ttgtactctt gtgattcttt gcggggtgag ctcttctagg ggttcgtgga 1080
gtatctagta caatctgagt ggtattggtt taattccgag attatgttct tggctggaat 1140
ggttctcgtt tgtagatata caacttctct tttcttcttt tcgtgtgttc ttgtggaggc 1200
tccgggtcta tggcattaca ggaggagtag gtttcggtta gttttggttg gattctgaga 1260
agggttattg gaaagaacag ttcttgctca ttgggttcgt tctcttacta tgatgatttt 1320
ggctgggttg gtgggtatag agttcctgtt ttgcatcaat gtggaaaaac acgagttggt 1380
gcaaatgttt cctcttttgt gggtgcaaac agagctagat gcaacatgca aggcttctgg 1440
ttttgcttgc ataattttct ctactgccac attttggttt aattgttatc cttgtaatct 1500
tttagaaata actgccgatt tttctaatca gaaacattgg tttgcagtgg gtttttatat 1560
tttgtccctt gtgttgcagg aacggggagc atatgctcca atgtcaactg gttttgcggc 1620
acaaaatcga gaagttggag ccatcatgtg caaatgctac tgttcagtac gccaacatag 1680
caaagccaag ttggatcagt tggtatgcat tttcagctcc ggatgaggca atacaagccc 1740
tgattagtga ggcgaagtca tactacatga ggctcccccc aatacaacac ctccagcagt 1800
tacccttact gcagtcacct tcaacgcggt atctaacttc gttgtttgga gtagaagtta 1860
gagtcaagcg ttacctggaa tggaccaaac aagagcaaag gtctgttatc taacttcgtt 1920
gtttcttttg ttgattgctt ctcgcagttt ttttttaatt aacctacagt gtaaacctac 1980
tgttgttttc gtccaaacaa tatctgagtt atggtttaca aactatactg ttgagcgcct 2040
gtttggagga gtacatgcta acaattccca aatcgatccc tatgtcctgg caagcagctg 2100
ggtgcgcctc ttgttcagtg tggttatgta acttatgcca cagtattctg ctaaatgcag 2160
actttgagtt tgatgtgttc ttgtttgttc taaggtccaa atggtagtct tgccacaatg 2220
tactctccct tttctgatct tgatttattt ggccggcaaa agatcaatcc ctcgcatcca 2280
aggacttgca caaaatcttc cataagtact ttcttgagga ttttaaaact agttattagt 2340
tgaagatatg tttgatcttg tactcttaaa gttagtttct ggttattatg ttttcatcaa 2400
gacatatttg attgatggat ggatgtaatg cttaggattt catcagataa aattataggg 2460
tagaaatttg cattatatat atttaattgc aatgtatata tcataggaac aataaatttc 2520
tacagcttga gatgtacaaa tgagcaaaag atacaatgca gttattctta ttcaagaact 2580
gcagtcgtta ctgttttgca agtttaactt ttggcattcc attttatatt tctttgtttc 2640
tgctgagggt tcagctttat ttctccgaga tattaagtta gttctgctgc tcagacagct 2700
tgcaatggat aataatgctg atgtctccac accaacattg ttgtcaatat caggtgattt 2760
ttttgtcgat ttattattcg gtgatgatat agaatttacc atatataata tatgattgat 2820
agagtttgac ctttggcatt ccattttata atatctgatc gatagagttg ctaatatgct 2880
atgggaccat gatagtcaaa tagtgtacat actgccacat cacctattga ctcgtgatag 2940
aaactttact aatcaaggct aaaaattcac acaactgttg aacatgttat tataggaaga 3000
gctcatattt agtgtcaatg catgcttaaa agtagttaaa tttttaccct gaaatctgtc 3060
tcaaatacaa ttatttcctg agttagtgtg gtcctaggat ggtagagtag aatctgaaag 3120
tttgtcatag attaataata gaatccaata gtgccgcagt actctagtat tgtatagtta 3180
cataaaacat tcaatagaga tttaacatga aatttggtga atccagtaac ttgtactgct 3240
aaaatgccat atattgattt tatctttcat gtcagcaatc gaatcctttt taggctcagc 3300
tgtaatatgt tactaacatc taaaagtatg ttctgccaat tatttcaatc aacatgttaa 3360
tttctttgca tgtgggcagc tctggttggc gatgttacta atttaagtgc cgaggaatcg 3420
agaagaaggc agcaacgtga aataaacaat tctttgaaag tggaagcatg gaatgaatac 3480
acatttcttg gatgtgctaa tacagctggg tcaggtaatg cccctatttt ttcacacacg 3540
atgtaaatta caaattcact gttgctctat tttgaagtta attagcgatt ctttgtttca 3600
acaggaagtg taactcgcca acccgtgatc acacctagac gcctcacgcc tctcatttag 3660
aatttacatc cagtccaagt taattgcaaa tctttgttaa tctttgataa cttacaaccc 3720
gacactactg tttatatgtt ctatacttgt ctttatacat ctgtatgaca tgttaatcga 3780
ttgaatggtt aacaacgtgc taaatatttc tcaaactatt tgacagtgct gtctcttgtc 3840
caattaaaac tgcaatgaga aattctgtaa aattattaaa tccaagatat tttatttcca 3900
aaaatgtggc atgagtttgg aaaaatgaca ttcattagtc attcaattat tacatctacc 3960
cctttgggtg tgcctgcaca ttggagcata ggaatcagga ctgtgatctg ataattgcaa 4020
cacttgcagc ttgcaagaaa agagtcaaag cttcatcact tgataatgta aaagcacaat 4080
gccatatgat acttgaagat aaacgaatag agctgaagga gtacttgaat gatctgtgtc 4140
acgacaagca caaggtatta tgtttctata atttgcagta ctattattaa ttttgtaaca 4200
ctatggtatc tcagttacga atgaactttg caggttattg ataatatctg taagaaatat 4260
gaactagaaa atatagaaat cactaatgcc aaaaaacaaa aggtaagcta tgtttctttt 4320
ttcttttgaa aagtatttaa gctaggtatt tggattgctg gtgttattct aatgctatat 4380
tttttctgaa tgttggaaaa ttcaggcaga aaaactctct agggaaatga aaaacaaatg 4440
taataaaaag atgcccaagt cacatggagc aaaggtaagt tgaactagtt tgatttcttc 4500
atttgaaaca aatgaatgtt acttttttgt gatgcatgtg ccattggaat gctgcaaaag 4560
ttgtttgtgt aatagttgaa taaagtaagc taagcatttc agctactgat agttttcttt 4620
aatgatgctc atttctttca ctactatgaa actgaaaact gaccatatgc ttgagtcatg 4680
gggggttttg tactaatgtt taatgaaagt tgtataaaaa tgaaaaatac taatagatcc 4740
ttgagtcacg aagggcaata ttcttttcag gtgttgaaca ccatgaggtt cttccataca 4800
actccttcta aggagaaatc aaaaacaaaa aaggtatggt gattgaggga tttttaagat 4860
cgttcatgct atatttagtc tattttggtt tttgttgtct ccttatctca aggaaatcca 4920
acaagggaat attttcttgt ttttatatta tgcagttcag agatccaaag gatggttatc 4980
caggaaattc aaaggatgga agttatccag ggaatacaat cacaatggat atggataaag 5040
acaacctgcc tgcatttagg cgtagtttta aaagggcaat taaaaaaggc cgagcatggt 5100
gccaggcaaa cagcaattcg gttgacatat caggactctt tggtcccgga gccgaagttt 5160
atacaacccc cgcaaccgga actttgcatg tgaagcttag gaacaaaggg cgtgaactta 5220
cactcttctt ccgtggtaga gacttatacc tgaaagggtg gagaagtgat aggtttggtc 5280
tgtttgctgc ccaccctgat aggtttgata agaaggattg cttcatacaa gacaaagctt 5340
gcaaacacct gaacatcgag gataattatc atcagcttgt tccaggagga agaatcggga 5400
aagttagagt gggacccctt gcaatgctag actattttga agtccttcac aaatgcaatg 5460
gaatagtgac aacagatgtt ctgggggctg tggctggatt tgctgttaac ttcgcagaac 5520
caatacgcca ggaagatgtc ttggaggata tcttagagtc gtttgttcat tttgatgtgg 5580
ctatgctgga tagcagaagg gcactatcct tgtacgtaag gaaatacgac cactactcaa 5640
gggagtttct aactggtgtt gataacttct tgcacggtag accaatgcca gagattttga 5700
atcgtgagga agttacagtc aagtcactcc atgagttgtg gtgcagaatc aaagttccgc 5760
tgagagactc ttataatgat ggtgcatttt atcatgatga taaatttggc atacccgtct 5820
ggtctccccc ctaccctgat gggaataatt gggaggagga ggaagatgaa gaggaagaag 5880
aggaagaggg agataaagag gaagaggctg aggaagaaga ggaagaggaa gaagaggaag 5940
aggctgagga agatgcaaac caccgtgatc taaaattcac aagccaacag gacttctttt 6000
cagttgggat gaaggctaat gaaatcaaca cctcttgtct ctgtcgtcct ttctctgcag 6060
ttgcctcagg tgggatgagg ccccttgttg tccctccaag tcagggtggg gaagtccaga 6120
gccagtttct gagcaggtgg ttctccagat tcattaatgg accaagggct gcgtgttttt 6180
tgaggaggct actaaaatag cgaccacggc tggtggagcg ggcttcttga ttcttttgtg 6240
tctgtctgaa attttgatat gtctgaaatg tatctctttt gctttgttta gttgcttcct 6300
gcttacaaac atgtaaaatt tctctaaagg agaagttgtc cagaagtttc atttgcatca 6360
tgctcttttc tgccttccaa acatgagcaa actccattag gatacttggc tttgtcttga 6420
gtacatcatg gatcatgaag cacatttatg ctaagtgaga tt 6462
<210> 4
<211> 690
<212> PRT
<213>Southern wild rice (O. meridionalis, Mer)
<400> 4
Met Leu Gln Cys Gln Leu Val Leu Arg His Lys Ile Glu Lys Leu Glu
1 5 10 15
Pro Ser Cys Ala Asn Ala Thr Val Gln Tyr Ala Asn Ile Ala Lys Pro
20 25 30
Ser Trp Ile Ser Trp Tyr Ala Phe Ser Ala Pro Asp Glu Ala Ile Gln
35 40 45
Ala Leu Ile Ser Glu Ala Lys Ser Tyr Tyr Met Arg Leu Pro Pro Ile
50 55 60
Gln His Leu Gln Gln Leu Pro Leu Leu Gln Ser Pro Ser Thr Arg Tyr
65 70 75 80
Leu Thr Ser Leu Phe Gly Val Glu Val Arg Val Lys Arg Tyr Leu Glu
85 90 95
Trp Thr Lys Gln Glu Gln Arg Gln Leu Ala Met Asp Asn Asn Ala Asp
100 105 110
Val Ser Thr Pro Thr Leu Leu Ser Ile Ser Ala Leu Val Gly Asp Val
115 120 125
Thr Asn Leu Ser Ala Glu Glu Ser Arg Arg Arg Gln Gln Arg Glu Ile
130 135 140
Asn Asn Ser Leu Lys Val Glu Ala Trp Asn Glu Tyr Thr Phe Leu Gly
145 150 155 160
Cys Ala Asn Thr Ala Gly Ser Ala Cys Lys Lys Arg Val Lys Ala Ser
165 170 175
Ser Leu Asp Asn Val Lys Ala Gln Cys His Met Ile Leu Glu Asp Lys
180 185 190
Arg Ile Glu Leu Lys Glu Tyr Leu Asn Asp Leu Cys His Asp Lys His
195 200 205
Lys Val Ile Asp Asn Ile Cys Lys Lys Tyr Glu Leu Glu Asn Ile Glu
210 215 220
Ile Thr Asn Ala Lys Lys Gln Lys Ala Glu Lys Leu Ser Arg Glu Met
225 230 235 240
Lys Asn Lys Cys Asn Lys Lys Met Pro Lys Ser His Gly Ala Lys Val
245 250 255
Leu Asn Thr Met Arg Phe Phe His Thr Thr Pro Ser Lys Glu Lys Ser
260 265 270
Lys Thr Lys Lys Phe Arg Asp Pro Lys Asp Gly Tyr Pro Gly Asn Ser
275 280 285
Lys Asp Gly Ser Tyr Pro Gly Asn Thr Ile Thr Met Asp Met Asp Lys
290 295 300
Asp Asn Leu Pro Ala Phe Arg Arg Ser Phe Lys Arg Ala Ile Lys Lys
305 310 315 320
Gly Arg Ala Trp Cys Gln Ala Asn Ser Asn Ser Val Asp Ile Ser Gly
325 330 335
Leu Phe Gly Pro Gly Ala Glu Val Tyr Thr Thr Pro Ala Thr Gly Thr
340 345 350
Leu His Val Lys Leu Arg Asn Lys Gly Arg Glu Leu Thr Leu Phe Phe
355 360 365
Arg Gly Arg Asp Leu Tyr Leu Lys Gly Trp Arg Ser Asp Arg Phe Gly
370 375 380
Leu Phe Ala Ala His Pro Asp Arg Phe Asp Lys Lys Asp Cys Phe Ile
385 390 395 400
Gln Asp Lys Ala Cys Lys His Leu Asn Ile Glu Asp Asn Tyr His Gln
405 410 415
Leu Val Pro Gly Gly Arg Ile Gly Lys Val Arg Val Gly Pro Leu Ala
420 425 430
Met Leu Asp Tyr Phe Glu Val Leu His Lys Cys Asn Gly Ile Val Thr
435 440 445
Thr Asp Val Leu Gly Ala Val Ala Gly Phe Ala Val Asn Phe Ala Glu
450 455 460
Pro Ile Arg Gln Glu Asp Val Leu Glu Asp Ile Leu Glu Ser Phe Val
465 470 475 480
His Phe Asp Val Ala Met Leu Asp Ser Arg Arg Ala Leu Ser Leu Tyr
485 490 495
Val Arg Lys Tyr Asp His Tyr Ser Arg Glu Phe Leu Thr Gly Val Asp
500 505 510
Asn Phe Leu His Gly Arg Pro Met Pro Glu Ile Leu Asn Arg Glu Glu
515 520 525
Val Thr Val Lys Ser Leu His Glu Leu Trp Cys Arg Ile Lys Val Pro
530 535 540
Leu Arg Asp Ser Tyr Asn Asp Gly Ala Phe Tyr His Asp Asp Lys Phe
545 550 555 560
Gly Ile Pro Val Trp Ser Pro Pro Tyr Pro Asp Gly Asn Asn Trp Glu
565 570 575
Glu Glu Glu Asp Glu Glu Glu Glu Glu Glu Glu Gly Asp Lys Glu Glu
580 585 590
Glu Ala Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Ala Glu Glu
595 600 605
Asp Ala Asn His Arg Asp Leu Lys Phe Thr Ser Gln Gln Asp Phe Phe
610 615 620
Ser Val Gly Met Lys Ala Asn Glu Ile Asn Thr Ser Cys Leu Cys Arg
625 630 635 640
Pro Phe Ser Ala Val Ala Ser Gly Gly Met Arg Pro Leu Val Val Pro
645 650 655
Pro Ser Gln Gly Gly Glu Val Gln Ser Gln Phe Leu Ser Arg Trp Phe
660 665 670
Ser Arg Phe Ile Asn Gly Pro Arg Ala Ala Cys Phe Leu Arg Arg Leu
675 680 685
Leu Lys
690
<210> 5
<211> 6191
<212> DNA
<213>Long-grained nonglutinous rice strain (Oryza sativa ssp. indica)
<400> 5
atcgctttct tgttcgaggt cggcgaggcg cgcgggcggc ggcgatcggc tagggctcga 60
tgagcggcgg caggtctccg gcggacggcc ggggatcacc gccgcttggc accaggctcc 120
ggccgccggt gcaacgggta ttctcatcct cgttctctcc aatcccattc ccccctctta 180
aaacccacct ccactgggtt tcaatcgctg ggatttatcc aattttctcc tctactaatc 240
cctccccaat acccacctcc actgggtttc aatcgctggg atttatccaa ttttctcctc 300
tactaatccc tccccaattg ggttcagaaa ccagttcatg ccgccattcc cgggtggcat 360
ttcgattccc gacatccaaa cgggaatcga ctcgccgttg ctgtgctcgg ttcagcgaac 420
cgccttctcc actgcgcgcg catagcgcta tataaaccct cctcctcctc ctcctcctcc 480
tcctcccgag aattaggaga gggacaccaa caagcgaaat ccacagcccg atcgaattgc 540
catccgcggc ggaatccatt tcgttagcaa gcaagcaagc cggtgcgcgc gagaggcgtc 600
gcggcattag catcagcgcc gcttcgtcgc cttcgtctcc cttctcccct gctcccctcc 660
actgctcggt gtcgcacggt ggtgcgcttc ctggacgaca atgtatgtac tagtaaattg 720
gggagctagc gcggcgttgc atttgatctt ttctgtcgtt tgcttgattc ttgtgcgttc 780
ttgaggtggt ttgtggagca tctggtacaa tcaagagcgg ttttggttga attccgggga 840
cgggtgggtt cttggctaga acgatccttc gcttcttgtc tactctttac gcgggtgaat 900
tcttgtaacg gtttgtggat tatctggtac aatcttgatg gttctagttg aactctggat 960
actgattctt ggccgggacg atgcctttta ctcttgtgat tctttgcggg ttcagctctt 1020
ctaggggttc gtggattatc gagtacaatc ttggcggttt tagttgcact ctggatactg 1080
attcttggcc agaacgatgc tttgtactct tgtgattctt tgcggggtga gctcttctag 1140
gggttcgtgg agtatctagt acaatctgag tggtattggt ttaattccga gattatgttc 1200
ttggctggaa tggttctcgt ttgtagatat acaacttctc ttttcttctt ttcgtgtgtt 1260
cttgtggagg ctccggttct atggcattac aggaggagta ggtttcggtt agttttggtt 1320
ggattctgag aagggttatt ggaaagaaca gttcttgctc attgggttcg ttctcttact 1380
atgatgattt tggctgggtt ggtgggtata gagttcctgt tttgcatcaa tgtggaaaaa 1440
cacgagttgg tgcaaatgtt tcctcttttg tgggtgcaaa cagagctaga tgcaacatgc 1500
aaggcttctg gttttgcttg cataattttc tctactgcca cattttggtt taattgttat 1560
ccttgtaatc ttttagaaat aactgccgat ttttctaatc agaaacattg gtttgcagtg 1620
ggtttttata ttttgtccct tgtgttgcag gaacggggag catatgctcc aatgtcaact 1680
ggttttgcgg cacaaaatcg agaagttgga gccatcatgt gcaaatgcta ctgttcagta 1740
cgccaacata gcaaagccaa gttggatcag ttggtatgca ttttcagctc cggatgaggc 1800
aatacaagcc ctgattagtg aggcgaagtc atactacatg aggctccccc caatacaaca 1860
cctccagcag ttacccttac tgcagtcacc ttcaacgcgg tatgattatg aatccccatc 1920
gctctatttg gagcctcagt ttcaggtcct tttctgatct tgatttattt ggccggcaaa 1980
agatcaatcc ctcgcatcca aggacttgca caaaatcttc cataagtact ttcttgagga 2040
ttttaaaact agttattagt tgaagatatg tttgatcttg tactcttaaa gttagtttct 2100
ggttattatg ttttcatcaa gacatatttg attgatggat ggatgtaatg cttaggattt 2160
catcagataa aattataggg tagaaatttg cattatatat atttaattgc aatgtatata 2220
tcataggaac aataaatttc tacagcttga gatgtacaaa tgagcaaaag atacaatgca 2280
gttattctta ttcaagaact gcagtcgtta ctgttttgca agtttaactt ttggcattcc 2340
attttatatt tctttgtttc tgctgagggt tcagctttat ttctccgaga tattaagtta 2400
gttctgctgc tcagacagct tgcaatggat aataatgctg atgtctccac accaacattg 2460
ttgtcaatat caggtgattt ttttgtcgat ttattattcg gtgatgatat agaatttacc 2520
atatataata tatgattgat agagtttgac ctttggcatt ccattttata atatctgatc 2580
gatagagttg ctaatatgct atgggaccat gatagtcaaa tagtgtacat actgccacat 2640
cacctattga ctcgtgatag aaactttact aatcaaggct aaaaaatcac acaactgttg 2700
aacatgttat tataggaaga gctcatattt agtgtcaatg catgcttaaa agtagttaaa 2760
tttttaccct gaaatctgtc tcaaatacaa ttatttcctg agttagtgtg gtcctaggat 2820
ggtagagtag aatctgaaag tttgtcatag attaataata gaatccaata gtgccgcagt 2880
actctagtat tgtatagtta cataaaacat tcaatagaga tttaacatga aatttggtga 2940
atccagtaac ttgtactgct aaaatgccat atattgattt tatctttcat gtcagcaatc 3000
gaatcctttt taggctcagc tgtaatatgt tactaacatc taaaagtatg ttctgccaat 3060
tatttcaatc aacatgttaa tttctttgca tgtgggcagc tctggttggc gatgttacta 3120
atttaagtgc cgaggaattg agaagaaggc agcaacgtga aataaacaat tctttgaaag 3180
tggaaggatg gaatgaatac acatttcttg gatgtgctaa tacagctggg tcaggtaatg 3240
cccctatttt ttcacacacg atgtaaatta caaattcact gttgctctat tttgaagtta 3300
attagcgatt ctttgtttca acaggaagtg taactcgcca acccgtgatc acacctagac 3360
gcctcacgcc tctcatttag aatttacatc cagtccaagt taattgcaaa tctttgttaa 3420
tctttgataa cttacaaccc gacactactg tttatatgtt ctatacttgt ctttatacat 3480
ctgtatgaca tgttaatcga ttgaatggtt aacaacgtgc taaatatttc tcaaactatt 3540
tgacagtgct gtctcttgtc caattaaaac tgcaatgaga aattctgtaa aattattaaa 3600
tccaagatat tttatttcca aaaatgtggc atgagtttgg aaaaatgaca tccattagtc 3660
attcaattat tacatctacc cctttgggtg tgcctgcaca ttggagcata ggaatcagga 3720
ctgtgatctg ataattgcaa cacttgcagc ttgcaagaaa agagtcaaag cttcatcact 3780
tgataatgta aaagcacaat gccatatgat acttgaagat aaacgaatag agctgaagga 3840
gtacttgaat gatctgtgtc acgacaagca caaggtatta tgtttctata atttgcagta 3900
ctattattaa ttttgtaaca ctatggtatc tcagttacga atgaactttg caggttattg 3960
ataatatctg taagaaatat gaactagaaa atatagaaat cactaatgcc aaaaaacaaa 4020
aggtaagcta tgtttctttt ttcttttgaa aagtatttaa gctaggtctt tggattgctg 4080
gtgttattct aatgctatat tttttctgaa tgttggaaaa ttcaggcaga aaaactctct 4140
agggaaatga aaaacaaatg taataaaaag atgcccaagt cacatggagc aaaggtaagt 4200
tgaactagtt tgatttcttc atttgaaaca aatgaatgtt acttttttgt gatgcatgtg 4260
ccattggaat gctgcaaaag ttgtttgtgt aatagttgaa taaagtaagc taagcatttc 4320
agctactgat agttttcttt aatgatgctc atttctttca ctactatgaa actgaaaact 4380
gaccatatgc ttgagtcatg gggggttttg tactaatgtt taatgaaagt tgtataaaaa 4440
tgaaaaatac taatagatcc ttgagtcacg aagggcaata ttcttttcag gtgttgaaca 4500
ccatgaggtt cttccataca actccttcta aggagaaatc aaaaacaaaa aaggtatggt 4560
gattgaggga tttttaagat cgttcatgct atatttagtc tattttggtt tttgttgtct 4620
ccttatctca aggaaatcca acaagggaat attttcttgt ttttatatta tgcagttcag 4680
agatccaaag gatggttatc caggaaattc aaaggatgga agttatccag ggaatacaat 4740
cacaatggat atggataaag acaacctgcc tgcatttagg cgtagtttta aaagggcaat 4800
taaaaaaggc cgagcatggt gccaggcaaa cagcaattcg gttgacatat caggactctt 4860
tggtcccgga gccgaagttt atacaacccc cgcaaccgga actttgcatg tgaagcttag 4920
gaacaaaggg cgtgaactta cactcttctt ccgtggtaga gacttatacc tgaaagggtg 4980
gagaagtgat aggtttggtc tgtttgctgc ccaccctgat aggtttgata agaaggattg 5040
cttcatacaa gacaaagctt gcaaacacct gaacatcgag gataattatc atcagcttgt 5100
tccaggagga agaatcggga aagttagagt gggacccctt gcaatgctag actattttga 5160
agtccttcac aaatgcaatg gaatagtgac aacagatgtt ctgggggctg tggctggatt 5220
tgctgttaac ttcgcagaac caatacgcca ggaagatgtc ttggaggata tcttagagtc 5280
gtttgttcat tttgatgtgg ctatgctgga tagcagaagg gcactatcct tgtacgtaag 5340
gaaatacgac cactactcaa gggagtttct aactggtgtt gataacttct tgcacggtag 5400
accaatgcca gagattttga atcgtgagga agttacagtc aagtcactcc atgagttgtg 5460
gtgcagaatc aaagttccgc tgagagactc ttatactgat ggtgcatttt atcatgatga 5520
tgaagttggc atacccgtct ggtctccccc ctaccctgat gggaataatt gggaggagga 5580
ggaagatgaa gaggaagaag aggaagaggg agataaagag gaagaggctg aggaagaaga 5640
ggaagaggaa gaagaggaag aggctgagga agatgcaaac caccgtgatc taaaattcac 5700
aagccaacag gacttctttt cagttgggat gaaggctaat gaaatcaaca cctcttgtct 5760
ctgtcgtcct ttctctgcag ttgcctcagg tgggatgagg ccccttgttg tccctccaag 5820
tcagggtggg gaagtccaga gccggtttct gagcaggagg ccacagtggt tctccagatt 5880
cattaatgga ccaagggctg cgtgtttttt gaggaggcta ctaaaatagc gaccacggct 5940
ggtggagcgg gcttcttgat tcttttgtgt ctgtctgaaa ttttgatatg tctgaaatgt 6000
atctcttttg ctttgtttag ttgcttcctg cttacaaaca tgtaaaattt ctctaaagga 6060
gaagttgtcc agaagtttca tttgcatcat gctcttttct gccttccaaa catgagcaaa 6120
ctccattagg atacttggct ttgtcttgag tacatcatgg atcatgaagc acatttatgc 6180
taagtgagat t 6191
<210> 6
<211> 669
<212> PRT
<213>Long-grained nonglutinous rice strain (Oryza sativa ssp. indica)
<400> 6
Met Leu Gln Cys Gln Leu Val Leu Arg His Lys Ile Glu Lys Leu Glu
1 5 10 15
Pro Ser Cys Ala Asn Ala Thr Val Gln Tyr Ala Asn Ile Ala Lys Pro
20 25 30
Ser Trp Ile Ser Trp Tyr Ala Phe Ser Ala Pro Asp Glu Ala Ile Gln
35 40 45
Ala Leu Ile Ser Glu Ala Lys Ser Tyr Tyr Met Arg Leu Pro Pro Ile
50 55 60
Gln His Leu Gln Gln Leu Pro Leu Leu Gln Ser Pro Ser Thr Arg Gln
65 70 75 80
Leu Ala Met Asp Asn Asn Ala Asp Val Ser Thr Pro Thr Leu Leu Ser
85 90 95
Ile Ser Ala Leu Val Gly Asp Val Thr Asn Leu Ser Ala Glu Glu Leu
100 105 110
Arg Arg Arg Gln Gln Arg Glu Ile Asn Asn Ser Leu Lys Val Glu Gly
115 120 125
Trp Asn Glu Tyr Thr Phe Leu Gly Cys Ala Asn Thr Ala Gly Ser Ala
130 135 140
Cys Lys Lys Arg Val Lys Ala Ser Ser Leu Asp Asn Val Lys Ala Gln
145 150 155 160
Cys His Met Ile Leu Glu Asp Lys Arg Ile Glu Leu Lys Glu Tyr Leu
165 170 175
Asn Asp Leu Cys His Asp Lys His Lys Val Ile Asp Asn Ile Cys Lys
180 185 190
Lys Tyr Glu Leu Glu Asn Ile Glu Ile Thr Asn Ala Lys Lys Gln Lys
195 200 205
Ala Glu Lys Leu Ser Arg Glu Met Lys Asn Lys Cys Asn Lys Lys Met
210 215 220
Pro Lys Ser His Gly Ala Lys Val Leu Asn Thr Met Arg Phe Phe His
225 230 235 240
Thr Thr Pro Ser Lys Glu Lys Ser Lys Thr Lys Lys Phe Arg Asp Pro
245 250 255
Lys Asp Gly Tyr Pro Gly Asn Ser Lys Asp Gly Ser Tyr Pro Gly Asn
260 265 270
Thr Ile Thr Met Asp Met Asp Lys Asp Asn Leu Pro Ala Phe Arg Arg
275 280 285
Ser Phe Lys Arg Ala Ile Lys Lys Gly Arg Ala Trp Cys Gln Ala Asn
290 295 300
Ser Asn Ser Val Asp Ile Ser Gly Leu Phe Gly Pro Gly Ala Glu Val
305 310 315 320
Tyr Thr Thr Pro Ala Thr Gly Thr Leu His Val Lys Leu Arg Asn Lys
325 330 335
Gly Arg Glu Leu Thr Leu Phe Phe Arg Gly Arg Asp Leu Tyr Leu Lys
340 345 350
Gly Trp Arg Ser Asp Arg Phe Gly Leu Phe Ala Ala His Pro Asp Arg
355 360 365
Phe Asp Lys Lys Asp Cys Phe Ile Gln Asp Lys Ala Cys Lys His Leu
370 375 380
Asn Ile Glu Asp Asn Tyr His Gln Leu Val Pro Gly Gly Arg Ile Gly
385 390 395 400
Lys Val Arg Val Gly Pro Leu Ala Met Leu Asp Tyr Phe Glu Val Leu
405 410 415
His Lys Cys Asn Gly Ile Val Thr Thr Asp Val Leu Gly Ala Val Ala
420 425 430
Gly Phe Ala Val Asn Phe Ala Glu Pro Ile Arg Gln Glu Asp Val Leu
435 440 445
Glu Asp Ile Leu Glu Ser Phe Val His Phe Asp Val Ala Met Leu Asp
450 455 460
Ser Arg Arg Ala Leu Ser Leu Tyr Val Arg Lys Tyr Asp His Tyr Ser
465 470 475 480
Arg Glu Phe Leu Thr Gly Val Asp Asn Phe Leu His Gly Arg Pro Met
485 490 495
Pro Glu Ile Leu Asn Arg Glu Glu Val Thr Val Lys Ser Leu His Glu
500 505 510
Leu Trp Cys Arg Ile Lys Val Pro Leu Arg Asp Ser Tyr Thr Asp Gly
515 520 525
Ala Phe Tyr His Asp Asp Glu Val Gly Ile Pro Val Trp Ser Pro Pro
530 535 540
Tyr Pro Asp Gly Asn Asn Trp Glu Glu Glu Glu Asp Glu Glu Glu Glu
545 550 555 560
Glu Glu Glu Gly Asp Lys Glu Glu Glu Ala Glu Glu Glu Glu Glu Glu
565 570 575
Glu Glu Glu Glu Glu Ala Glu Glu Asp Ala Asn His Arg Asp Leu Lys
580 585 590
Phe Thr Ser Gln Gln Asp Phe Phe Ser Val Gly Met Lys Ala Asn Glu
595 600 605
Ile Asn Thr Ser Cys Leu Cys Arg Pro Phe Ser Ala Val Ala Ser Gly
610 615 620
Gly Met Arg Pro Leu Val Val Pro Pro Ser Gln Gly Gly Glu Val Gln
625 630 635 640
Ser Arg Phe Leu Ser Arg Arg Pro Gln Trp Phe Ser Arg Phe Ile Asn
645 650 655
Gly Pro Arg Ala Ala Cys Phe Leu Arg Arg Leu Leu Lys
660 665
<210> 7
<211> 5953
<212> DNA
<213>Dianjingyou No.1 (Dianjingyou1)
<400> 7
gcccgggttc gcgaaggtgg ccgctcgccg gctacgtcga ggtggaagac gctggaaatt 60
tcttctccga gttgcccaac gattctgcgg tgtggagggc ggccgcgacg tctgcggctg 120
gccccgcctc gtgcgtctcg gctcgcccgt ttcgatcggc tgctgctttg cgagattaca 180
agacgactgg ttcctgacat ccacaccgga atctgagctc gagcccctct agagcgcagc 240
ccacgccggc gccggtgacg agcgtgacga ggtggagaag acgacggaaa agctggcgtt 300
ggggacggac ggacggatcg gcgacggagt ggcacggaat aaaggaattc gctatcgcag 360
tgacaaaatc tgaaaggaat gtgtattgag tggcttgccc tgaaaggcct gcgaattgga 420
tgtcaaataa tgaaatttct ccaattatgt ccatccacat gatgcccgtt tctgatgatg 480
acagaaatcc cccacgcagc cacagcacgg ctattccccc taacccccgc cgccgcccag 540
atgcgaattc tccgccgctt tccgcgtctg ctccgacgct ctaacgccgc cgcccgatct 600
cctgccccga tgcaccgcct catctcttct ccctctctca tggcatctgc agcggctagc 660
tggtgctggt ggtcaccatt gcttgctcga ggaggacctg tcgtccgtcg tgtttcccgg 720
tgtgttttct tgtgctgatc gatgctaaag tctgcgcctt tacttggtta ttactacagt 780
tttggcatga ttttcataga cagatttttt gggcatgtgt tttttttcct tgttctgatg 840
ctaaagtttg cgtcttttgc cacagttttt ggatctgcga tcaactttgg gttttgtttt 900
cctcgcaaaa aaaaaaaaac tttgggtttt gttttcattt gtttgaaggt agttgtggaa 960
aataagtttc tttaaactaa ttcgaaacaa agacaaagga gatcgagaaa aaaaatttag 1020
aaatcgatta tcgatttcag ggttagatga tctcaatcct gactgatggt accgtcttat 1080
ttattttagt tgttgatatt ggtttttcat tctcttaatt aatgatagat ttccttggga 1140
acctcggaac atgaccacca tcagtcgagt aaaaggcgac gagtcataca ggcgacttcc 1200
atcccaggaa aagaagcata ctgcgatcac tcaaggtatg aaaaccattg acaccagggg 1260
cacaatcttg gaggctagag ctggagatga gaaaagtaat agagatgcgg cgtcctcaga 1320
ggtttcatac atcaaatacg atgtactggg gcaaagtgcg aagcaggatg gctgtgatga 1380
ggatgatcga aggagtgaaa cggaggaaca tgttgaggag gacgaagttc ttgatcctga 1440
agaatatact gtgaacaaca tacttccaaa aagtagacac cgtgatggct ctatatatag 1500
ggacatcatg gacacaccgt ggaaaaggga gtttcatatt gcagaccgta atgagagtaa 1560
gctatctttt ctctatcttt atttgctata ttatttttta ttagagataa tttgtttcct 1620
tgaacataac gaatctcttt ccatatctat aaatatttta ttgcgatcct agagatcatt 1680
gtatatgtgg tgctatgcag cactgccata attttacccg ccttacactc ttttcagcta 1740
tgagataatt gtactggagg tccttaaacg tggatgagag taacacttcc accccaagcc 1800
ttgtacttta cttttactgg cccttcagct tagcaccatt tgcatacata gcaatctgcg 1860
ccacagcctg atgggaggga ctgaggttgc atgcagagtt ctgatgacat ggactaggac 1920
cttattccat gccatttaat tacataaatg tccaaagtac tttatccctg aactttgcaa 1980
cacggtgatc acacagcctt tgagcatgta tttcaatagc agaatacaca agaaaatgac 2040
aactataagt gcaaataata atctaaatat cgcatccaca ctgttgtaat tgccattagg 2100
tttaaattct ccatacatgc agccacaaac tgtcagtaat agtacaagtt ttccaagcat 2160
gcagggagca acaacaagca ataatagaaa gtactcaggc agttcacata ctatatataa 2220
cctaaaggac tactaggtgt tcaaggggcc aaccaaacat tcaaatgccc ctgtttaata 2280
tgaggagcgg gttgccagtt tccaaaatat agaccacttc ccaaaacacg tggttttctg 2340
tagaggtaaa aggctggtac aggaaagaat atacctggct ttctgaagag gtagtctgcc 2400
cttgagtttt ttttttcttg tagttgatac taggatagat gttgctctcc tagtaaaaag 2460
aacataggtt gtttctactt tgtagatgaa aaggaaaaaa aaaatccaat aaggccatat 2520
aatcatcaaa tatcacatgt acttttcaaa tgtcaagtgt ttgttcactg tattaatttc 2580
cggtcacaaa cttacattat gactttactt tttttgaagc tcggttggag gcaatgaggt 2640
tttcgaatcc cacaaattgt gtcattcgca gtaatggaac ttgcatgtca catgttcatt 2700
gcaacatgct gcaaatttta tcattggagt tggctaaaat tacactggat ggtggttcag 2760
tagagttgta tggatacata gctgtgcggg atgatctaga tccgttgctt aattatattg 2820
tcaactgtag cagggatgat cccatcattg tggagcaggt acacatccga cttatctaga 2880
aatatcattg tgtattttga tttggaaaat tcatacttca tgagttttgg caaaaatcgt 2940
caaattattg gtactcgaat tacttttaag atgttaattt tattgcaatt ggtgatatat 3000
tgatagagaa attaaaggtc aaaattctac ttttcaagaa tttctccttc caaaacgcac 3060
cttacatagg gagtgtactc tatattatga aatgatgatt tactatgaga acaggtttaa 3120
attatgaaac taaggaacac atgtattcca aagaaaaatc atgttaaata gttttggaca 3180
ctttgttgtt gcttagtacc ctacataatt tttttttctt ttgtttgata catgatgaag 3240
atcttggtag ttgtaaaaag agtaaaatac accaccggtc cttaaagttg gagcgtggtg 3300
tcacttaggt ccatgatctt gtaaaatcga tattaaggtc catgaacttg tttaagtgaa 3360
tcatagcagt acaaaacacg tctgactggg ttgaccgtcc tacgtggcag tccagcgtgg 3420
ctccatattt gcaattaggc cctccacgcc cgatccacgg ccttcacggt gtcggagatg 3480
tggttcttgc cgatgaccga cgtaacggcc tcccgcacct tagcgagcac ctatgcgagt 3540
gcctcccgga tcttcatcat cgtttcgccc ggcaccgctg ccgccaccgc cggcacgcgc 3600
tgtgccacga cctccttccg ccactgcact atgccgaaga tcgcctcgct gagcacgcgg 3660
tcctcatcgc cccgacggag catgtcggcg atttagccgg tgaccgtcgc ccccttgtcc 3720
tgttgctgcc cggtcgctgg ctcgccggag gcaagggtgg tggaggcgtc cgagtcctgc 3780
gcggtaccct gtgactatga ggtgccgctg atgcctgaga tcacggtgcc agcggactgc 3840
gtcacttgct gcaccttgcc agccacgagt ccacgacggt cccgactccg gcgaccttct 3900
cgtacattgt ggtggctagc ttcttgctgt actctccgtg gtgcatgtcg ctgccaactt 3960
gatcttgtcg gtgtacgtca cgccggacac gacaggcggc agcgctgcct tcaggcattg 4020
tgtacgtggc cgcatccttc cactcgaaag agtcgacgac aggcgtcgtg ccgatgtcct 4080
cgccttcccg cagcacacgc atcgtggagt gtggtgccgc cgagacgtcc aagacggggc 4140
cgccgaggtc accgagccga caccttgaca cgttgcgccg tcgccctcca ctgctccatc 4200
tcctgcaccg ctagggtcct tgccatgtca aacctgacac cgtcagcggc ggcacacgca 4260
aacaaccaaa aaagtttcaa atctaacacc gtcagcggcg gcacatgcaa agctagagat 4320
caacggagca agagcttact cggcgcgata tgaacctcag gatcggaatc catggcgatg 4380
gttttgtcct cgatgtcctc ttggtacctg cgctagtcca catcacccat cctctgcgcc 4440
gccacatcgc gttcatcctc ctcgctgctg ttgctgttgt tgctcacgcc agcgcggtcg 4500
ccgctgtttc tccctgccac ctccgccgtc attgttcccg ctgtggtcgc cgccggcgat 4560
ggtgttcttg agcaccggct tgtgttgctt ctccttcccc agtgcatctg cccctgtccc 4620
ccctccgccg ctgctgctgc aacaaacacc caccgaaggc ggcaacggcg ccgggcaaca 4680
tgatggcgaa ggtcgggagg cgctcacgca ggtgctcacc aaggcgcggg aggccgtcat 4740
gtcgctcatc ggcaagaacc gcgtctccaa caccatgaag gctgtggatc gggcgtggag 4800
gggcctaatt gcaaacatgt agccacgcta gactgccacg taggacggtc aacccggtca 4860
gacgtgtttt tggactgcaa tgattcactt aaacaagttc atggatctta atgttgattt 4920
tacaagatcg tggacctaag tgacaccacg ctccaacttt aaggaccttt caagtaaatg 4980
ctgttacaag tgaaacaaca taaggaagca tccaccttta gatatttctt acttttataa 5040
gaagagcaac taaatataat aattttgtag ggttcgctca tcaacatgga aggccctaac 5100
cgaggaatag acatgatgga ctatgctcta attgaatatg acatgaggat caagacaggt 5160
gaacaagaaa aagatgacct acagctgatt gatggtgcat caatgatagg ctctggaggc 5220
ctatggaatc ggccagaaac aatttgcatt cctggcgatt acggtgcagt tgacataact 5280
ttatcacgtt ttaattgttc agctgaggcc accgtagaga ttcttatatc agaagtgcaa 5340
agcagtttca atttgttgct cggttgttta accagtgact tggataagga aatccgtctc 5400
tttgatggtg tcatcagtga gtcacgtgat ttaaagaggt cggtggttgc tgtaacgagg 5460
gattctttca tagatttgaa gttcgaagtg ggcgcgtttc catccagttt cgaccagcat 5520
tatgtttcct tcaaggagaa aatccatggc tatgatactc aagaaataaa gactgatttt 5580
gcgttaatct cagtaaaggt gacttggtca gctttgcttt ctggacgagt gatacctctg 5640
tttctgtaac agagtgggcc atgcaacatc acatttacac acccatgaat atggccctaa 5700
cacacgctca aagagataaa aatcaacggc acatctttga tctcactaga tctataatgt 5760
taactttatt atacttatta tttagaatgt atatttcgca tatgaaatta tgtatccaag 5820
tttattacag caaatgcttg aataacggca ttgcacttac ctaacctatt ttcagactta 5880
tgagggagaa tctagcgttc aaatttgtgt cttgtggact ttgaatagtc aaaatcgatc 5940
ttcttttatg gct 5953
<210> 8
<211> 496
<212> PRT
<213>Dianjingyou No.1 (Dianjingyou1)
<400> 8
Met Met Thr Glu Ile Pro His Ala Ala Thr Ala Arg Leu Phe Pro Leu
1 5 10 15
Thr Pro Ala Ala Ala Gln Met Arg Ile Leu Arg Arg Phe Pro Arg Leu
20 25 30
Leu Arg Arg Ser Asn Ala Ala Ala Arg Ser Pro Ala Pro Met His Arg
35 40 45
Leu Ile Ser Ser Pro Ser Leu Met Ala Ser Ala Ala Ala Ser Trp Cys
50 55 60
Trp Trp Ser Pro Leu Leu Ala Arg Gly Gly Pro Val Val Arg Arg Val
65 70 75 80
Ser Arg Phe Pro Trp Glu Pro Arg Asn Met Thr Thr Ile Ser Arg Val
85 90 95
Lys Gly Asp Glu Ser Tyr Arg Arg Leu Pro Ser Gln Glu Lys Lys His
100 105 110
Thr Ala Ile Thr Gln Gly Met Lys Thr Ile Asp Thr Arg Gly Thr Ile
115 120 125
Leu Glu Ala Arg Ala Gly Asp Glu Lys Ser Asn Arg Asp Ala Ala Ser
130 135 140
Ser Glu Val Ser Tyr Ile Lys Tyr Asp Val Leu Gly Gln Ser Ala Lys
145 150 155 160
Gln Asp Gly Cys Asp Glu Asp Asp Arg Arg Ser Glu Thr Glu Glu His
165 170 175
Val Glu Glu Asp Glu Val Leu Asp Pro Glu Glu Tyr Thr Val Asn Asn
180 185 190
Ile Leu Pro Lys Ser Arg His Arg Asp Gly Ser Ile Tyr Arg Asp Ile
195 200 205
Met Asp Thr Pro Trp Lys Arg Glu Phe His Ile Ala Asp Arg Asn Glu
210 215 220
Thr Arg Leu Glu Ala Met Arg Phe Ser Asn Pro Thr Asn Cys Val Ile
225 230 235 240
Arg Ser Asn Gly Thr Cys Met Ser His Val His Cys Asn Met Leu Gln
245 250 255
Ile Leu Ser Leu Glu Leu Ala Lys Ile Thr Leu Asp Gly Gly Ser Val
260 265 270
Glu Leu Tyr Gly Tyr Ile Ala Val Arg Asp Asp Leu Asp Pro Leu Leu
275 280 285
Asn Tyr Ile Val Asn Cys Ser Arg Asp Asp Pro Ile Ile Val Glu Gln
290 295 300
Gly Ser Leu Ile Asn Met Glu Gly Pro Asn Arg Gly Ile Asp Met Met
305 310 315 320
Asp Tyr Ala Leu Ile Glu Tyr Asp Met Arg Ile Lys Thr Gly Glu Gln
325 330 335
Glu Lys Asp Asp Leu Gln Leu Ile Asp Gly Ala Ser Met Ile Gly Ser
340 345 350
Gly Gly Leu Trp Asn Arg Pro Glu Thr Ile Cys Ile Pro Gly Asp Tyr
355 360 365
Gly Ala Val Asp Ile Thr Leu Ser Arg Phe Asn Cys Ser Ala Glu Ala
370 375 380
Thr Val Glu Ile Leu Ile Ser Glu Val Gln Ser Ser Phe Asn Leu Leu
385 390 395 400
Leu Gly Cys Leu Thr Ser Asp Leu Asp Lys Glu Ile Arg Leu Phe Asp
405 410 415
Gly Val Ile Ser Glu Ser Arg Asp Leu Lys Arg Ser Val Val Ala Val
420 425 430
Thr Arg Asp Ser Phe Ile Asp Leu Lys Phe Glu Val Gly Ala Phe Pro
435 440 445
Ser Ser Phe Asp Gln His Tyr Val Ser Phe Lys Glu Lys Ile His Gly
450 455 460
Tyr Asp Thr Gln Glu Ile Lys Thr Asp Phe Ala Leu Ile Ser Val Lys
465 470 475 480
Val Thr Trp Ser Ala Leu Leu Ser Gly Arg Val Ile Pro Leu Phe Leu
485 490 495
<210> 9
<211> 6189
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
atcgctttct tgttcgaggt cggcgaggcg cgcgggcggc ggcgatcggc tagggctcga 60
tgagcggcgg caggtctccg gcggacggcc ggggatcacc gccgcttggc accaggctcc 120
ggccgccggt gcaacgggta ttctcatcct cgttctctcc aatcccattc ccccctctta 180
aaacccacct ccactgggtt tcaatcgctg ggatttatcc aattttctcc tctactaatc 240
cctccccaat acccacctcc actgggtttc aatcgctggg atttatccaa ttttctcctc 300
tactaatccc tccccaattg ggttcagaaa ccagttcatg ccgccattcc cgggtggcat 360
ttcgattccc gacatccaaa cgggaatcga ctcgccgttg ctgtgctcgg ttcagcgaac 420
cgccttctcc actgcgcgcg catagcgcta tataaaccct cctcctcctc ctcctcctcc 480
tcctcccgag aattaggaga gggacaccaa caagcgaaat ccacagcccg atcgaattgc 540
catccgcggc ggaatccatt tcgttagcaa gcaagcaagc cggtgcgcgc gagaggcgtc 600
gcggcattag catcagcgcc gcttcgtcgc cttcgtctcc cttctcccct gctcccctcc 660
actgctcggt gtcgcacggt ggtgcgcttc ctggacgaca atgtatgtac tagtaaattg 720
gggagctagc gcggcgttgc atttgatctt ttctgtcgtt tgcttgattc ttgtgcgttc 780
ttgaggtggt ttgtggagca tctggtacaa tcaagagcgg ttttggttga attccgggga 840
cgggtgggtt cttggctaga acgatccttc gcttcttgtc tactctttac gcgggtgaat 900
tcttgtaacg gtttgtggat tatctggtac aatcttgatg gttctagttg aactctggat 960
actgattctt ggccgggacg atgcctttta ctcttgtgat tctttgcggg ttcagctctt 1020
ctaggggttc gtggattatc gagtacaatc ttggcggttt tagttgcact ctggatactg 1080
attcttggcc agaacgatgc tttgtactct tgtgattctt tgcggggtga gctcttctag 1140
gggttcgtgg agtatctagt acaatctgag tggtattggt ttaattccga gattatgttc 1200
ttggctggaa tggttctcgt ttgtagatat acaacttctc ttttcttctt ttcgtgtgtt 1260
cttgtggagg ctccggttct atggcattac aggaggagta ggtttcggtt agttttggtt 1320
ggattctgag aagggttatt ggaaagaaca gttcttgctc attgggttcg ttctcttact 1380
atgatgattt tggctgggtt ggtgggtata gagttcctgt tttgcatcaa tgtggaaaaa 1440
cacgagttgg tgcaaatgtt tcctcttttg tgggtgcaaa cagagctaga tgcaacatgc 1500
aaggcttctg gttttgcttg cataattttc tctactgcca cattttggtt taattgttat 1560
ccttgtaatc ttttagaaat aactgccgat ttttctaatc agaaacattg gtttgcagtg 1620
ggtttttata ttttgtccct tgtgttgcag gaacggggag catatgctcc aatgtcaact 1680
ggttttgcgg cacaaaatcg agaagttgga gccatcatgt gcaaatgcta ctgttcagta 1740
cgccaacata gcaaagccaa gttggatcag ttggtatgca ttttcagctc cggatgaggc 1800
aatacaagcc ctgatgtgag gcgaagtcat actacatgag gctcccccca atacaacacc 1860
tccagcagtt acccttactg cagtcacctt caacgcggta tgattatgaa tccccatcgc 1920
tctatttgga gcctcagttt caggtccttt tctgatcttg atttatttgg ccggcaaaag 1980
atcaatccct cgcatccaag gacttgcaca aaatcttcca taagtacttt cttgaggatt 2040
ttaaaactag ttattagttg aagatatgtt tgatcttgta ctcttaaagt tagtttctgg 2100
ttattatgtt ttcatcaaga catatttgat tgatggatgg atgtaatgct taggatttca 2160
tcagataaaa ttacagggta gaaatttgca ttatatatat ttaattgcaa tgtatatatc 2220
ataggaacaa taaatttcta cagcttgaga tgtacaaatg agcaaaagat acaatgcagt 2280
tattcttatt caagaactgc agtcgttact gttttgcaag tttaactttt ggcattccat 2340
tttatatttc tttgtttctg ctgagggttc agctttattt ctccgagata ttaagttagt 2400
tctgctgctc agacagcttg caatggataa taatgctgat gtctccacac caacattgtt 2460
gtcaatatca ggtgattttt ttgtcgattt attattcggt gatgatatag aatttaccat 2520
atataatata tgattgatag agtttgacct ttggcattcc attttataat atctgatcga 2580
tagagttgct aatatgctat gggaccatga tagtcaaata gtgtacatac tgccacatca 2640
cctattgact cgtgatagaa actttactaa tcaaggctaa aaaatcacac aactgttgaa 2700
catgttatta taggaagagc tcatatttag tgtcaatgca tgcttaaaag tagttaaatt 2760
tttaccctga aatctgtctc aaatacaatt atttcctgag ttagtgtggt cctaggatgg 2820
tagagtagaa tctgaaagtt tgtcatagat taataataga atccaatagt gccgcagtac 2880
tctagtattg tatagttaca taaaacattc aatagagatt taacatgaaa tttggtgaat 2940
ccagtaactt gtactgctaa aatgccatat attgatttta tctttcatgt cagcaatcga 3000
atccttttta ggctcagctg taatatgtta ctaacatcta aaagtatgtt ctgccaatta 3060
tttcaatcaa catgttaatt tctttgcatg tgggcagctc tggttggcga tgttactaat 3120
ttaagtgccg aggaatcgag aagaaggcag caacgtgaaa taaacaattc tttgaaagtg 3180
gaagcatgga atgaatacac atttcttgga tgtgctaata cagctgggtc aggtaatgcc 3240
cctatttttt cacacacgat gtaaattaca aattcactgt tgctctattt tgaagttaat 3300
tagcgattct ttgtttcaac aggaagtgta actcgccaac ccgtgatcac acctagacgc 3360
ctcacgcctc tcatttagaa tttacatcca gtccaagtta attgcaaatc tttgttaatc 3420
tttgataact tacaacccga cactactgtt tatatgttct atacttgtct ttatacatct 3480
gtatgacatg ttaatcgatt gaatggttaa caacgtgcta aatatttctc aaactatttg 3540
acagtgctgt ctcttgtcca attaaaactg caatgagaaa ttctgtaaaa ttattaaatc 3600
caagatattt tatttccaaa aatgtggcat gagtttggaa aaatgacatt cattagtcat 3660
tcaattatta catctacccc tttgggtgtg cctgcacatt ggagcatagg aatcaggact 3720
gtgatctgat aattgcaaca cttgcagctt gcaagaaaag agtcaaagct tcatcacttg 3780
ataatgtaaa agcacaatgc catatgatac ttgaagataa acgaatagag ctgaaggagt 3840
acttgaatga tctgtgtcac gacaagcaca aggtattatg tttctataat ttgcagtact 3900
attattaatt ttgtaacact atggtatctc agttacgaat gaactttgca ggttattgat 3960
aatatctgta agaaatatga actagaaaat atagaaatca ctaatgccaa aaaacaaaag 4020
gtaagctaag tttctttttt cttttgaaaa gtatttaagc taggtatttg gattgctggt 4080
gttattctaa tgctatattt tttctgaatg ttggaaaatt caggcagaaa aactctctag 4140
ggaaatgaaa aacaaatgta ataaaaagat gcccaagtca caaggagcaa aggtaagttg 4200
aactagtttg atttcttcat ttgaaacaaa tgaatgttac ttttttgtga tgcatgtgcc 4260
attggaatgc tgcaaaagtt gtttgtgtaa tagttgaata aagtaagcta agcatttcag 4320
ctactgatag ttttctttaa tgatgctcat ttctttcact actatgaaac tgaaaactga 4380
ccatatgctt gagtcatggg gggttttgta ctaatgttta atgaaagttg tataaaaatg 4440
aaaaatacta atagatcctt gagtcacgaa gggcaatatt cttttcaggt gttgaacacc 4500
atgaggttct tccatacaac tccttctaag gagaaatcaa aaacaaaaaa ggtatggtga 4560
ttgagggatt tttaagatcg ttcatgctat atttagtcta ttttggtttt tgttgtctcc 4620
ttatctcaag gaaatccaac aagggaatat tttcttgttt ttatattatg cagttcagag 4680
atccaaagga tggttatcca ggaaattcaa aggatggaag ttatccaggg aatacaatca 4740
caatggatat ggataaagac aacctgcctg catttaggcg tagttttaaa agggcaatta 4800
aaaaaggccg agcatggtgc caggcaaaca gcaattcggt tgacatatca ggactctttg 4860
gtcccggagc cgaagtttat acaacccccg cagccggaac tttgcatgtg aagcttagga 4920
acaaagggcg tgaacttaca ctcttcttcc gtggtagaga cttatacctg aaagggtgga 4980
gaagtgatag gtttggtctg tttgctgccc accctgatag gtttgataag aagaattgct 5040
tcatacaaga caaagcttgc aaacacctga acatcgagga taattatcat cagcttgttc 5100
caggaggaag aatcgggaaa gtcagagtgg gaccccttgc aatgctagac tattttgaag 5160
tccttcacaa atgcaatgga atagtgacaa cagatgttct gggggctgtg gctggatttg 5220
ctgttaactt cgcagaacca atacgccagg aagatgtctt ggaggatatc ttagagtcgt 5280
ttgttcattt tgatgtggct atgctggata gcagaagggc actatccttg gacgtaagga 5340
aatacgacca ctactcaagg gagtttctaa ctggtgttga ttgcttattg cacggtagac 5400
caatgccaga gattttgaag cgtgaggaag ttacagtcaa gtcactccat gagttgtggt 5460
gcagaatcaa agttccgctg agagactctt ataatgatgg tgcattttat catgatgata 5520
aagttggcat acccgtctgg tctcccccct accctgatgg gaataattgg gaggaggagg 5580
aagatgaaga ggaagaagag gaagagggag ataaagagga agaggctgag gaagaagagg 5640
aagaggaaga agaggaagag gctgaggaag atgcaaacca ccgtgatcta aaattcacaa 5700
gccaacagga cttcttttca gttgggatga aggctaatga aatcaacacc tcttgtctct 5760
gtcgtccttt ctctgcagtt gcctcaggtg ggatgaggcc ccttgttgtc cctccaagtc 5820
agggtgggga agtccagagc cggtttctga gcaggaggcc acagtggttc tccagattca 5880
ttaatggacc aagggctgcg tgttttttga ggaggctact aaaatagcga ccacggctgg 5940
tggagcgggc ttcttgattc ttttgtgtct gtctgaaatt ttgatatgtc tgaaatgtat 6000
ctcttttgct ttgtttagtt gcttcctgct tacaaacatg taaaatttct ctaaaggaga 6060
agttgtccag aagtttcatt tgcatcatgc tcttttctgc cttccaaaca tgagcaaact 6120
ccattaggat acttggcttt gtcttgagta catcatggat catgaagcac atttatgcta 6180
agtgagatt 6189
<210> 10
<211> 5552
<212> DNA
<213>Dianjingyou No.1 (Dianjingyou1)
<400> 10
atgatgacag aaatccccca cgcagccaca gcacggctat tccccctaac ccccgccgcc 60
gcccagatgc gaattctccg ccgctttccg cgtctgctcc gacgctctaa cgccgccgcc 120
cgatctcctg ccccgatgca ccgcctcatc tcttctccct ctctcatggc atctgcagcg 180
gctagctggt gctggtggtc accattgctt gctcgaggag gacctgtcgt ccgtcgtgtt 240
tcccggtgtg ttttcttgtg ctgatcgatg ctaaagtctg cgcctttact tggttattac 300
tacagttttg gcatgatttt catagacaga ttttttgggc atgtgttttt tttccttgtt 360
ctgatgctaa agtttgcgtc ttttgccaca gtttttggat ctgcgatcaa ctttgggttt 420
tgttttcctc gcaaaaaaaa aaaaactttg ggttttgttt tcatttgttt gaaggtagtt 480
gtggaaaata agtttcttta aactaattcg aaacaaagac aaaggagatc gagaaaaaaa 540
atttagaaat cgattatcga tttcagggtt agatgatctc aatcctgact gatggtaccg 600
tcttatttat tttagttgtt gatattggtt tttcattctc ttaattaatg atagatttcc 660
ttgggaacct cggaacatga ccaccatcag tcgagtaaaa ggcgacgagt catacaggcg 720
acttccatcc caggaaaaga agcatactgc gatcactcaa ggtatgaaaa ccattgacac 780
caggggcaca atcttggagg ctagagctgg agatgagaaa agtaatagag atgcggcgtc 840
ctcagaggtt tcatacatca aatacgatgt actggggcaa agtgcgaagc aggatggctg 900
tgatgaggat gatcgaagga gtgaaacgga ggaacatgtt gaggaggacg aagttcttga 960
tcctgaagaa tatactgtga acaacatact tccaaaaagt agacaccgtg atggctctat 1020
atatagggac atcatggaca caccgtggaa aagggagttt catattgcag accgtaatga 1080
gagtaagcta tcttttctct atctttattt gctatattat tttttattag agataatttg 1140
tttccttgaa cataacgaat ctctttccat atctataaat attttattgc gatcctagag 1200
atcattgtat atgtggtgct atgcagcact gccataattt tacccgcctt acactctttt 1260
cagctatgag ataattgtac tggaggtcct taaacgtgga tgagagtaac acttccaccc 1320
caagccttgt actttacttt tactggccct tcagcttagc accatttgca tacatagcaa 1380
tctgcgccac agcctgatgg gagggactga ggttgcatgc agagttctga tgacatggac 1440
taggacctta ttccatgcca tttaattaca taaatgtcca aagtacttta tccctgaact 1500
ttgcaacacg gtgatcacac agcctttgag catgtatttc aatagcagaa tacacaagaa 1560
aatgacaact ataagtgcaa ataataatct aaatatggca tccacactgt tgtaattgcc 1620
attaggttta aattctccat acatgcagcc acaaactgtc agtaatagta caagttttcc 1680
aagcatgcag ggagcaacaa caagcaataa tagaaagtac tcaggcagtt cacatactat 1740
atataaccta aaggactact aggtgttcaa ggggccaacc aaacattcaa atgcccctgt 1800
ttaatatgag gagcgggttg ccagtttcca aaatatagac cacttcccaa aacacgtggt 1860
tttctgtaga ggtaaaaggc tggtacagga aagaatatac ctggctttct gaagaggtag 1920
tctgcccttg agtttttttt ttcttgtagt tgatactagg atagatgttg ctctcctagt 1980
aaaaagaaca taggttgttt ctactttgta gatgaaaagg aaaaaaaaat ccaataaggc 2040
catataatca tcaaatatca catgtacttt tcaaatgtca agtgtttgtt cactgtatta 2100
atttccggtc acaaacttac attatgactt tacttttttt gaagctcggt tggaggcaat 2160
gaggttttcg aatcccacaa attgtgtcat tcgcagtaat ggaacttgca tgtcacatgt 2220
tcattgccac atgctgcaaa ttttatcatt ggagttggct aaaattacac tggatggtgg 2280
ttcagtagag ttgtatggat acatagctgt gcgggatgat ctggatccgt tgcttaatta 2340
tattgtcaac tgtagcaggg atgatcccat cattgtggag caggtacaca tccgacttat 2400
ctagaaatat cattgtgtat tttgatttgg aaaattcata cttcatgagt tttggcaaaa 2460
atcgtcaaat tattggtact cgaattactt ttaagatgtt aattttattg caattggtga 2520
tatattgata gagaaattaa aggtcaaaat tctacttttc aagaatttct ccttccaaaa 2580
cgcaccttac atagggagtg tactctatat tatgaaatga tgatttacta tgagaacagg 2640
tttaaattat gaaactaagg aacacatgta ttccaaagaa aaatcatgtt aaatagtttt 2700
ggacactttg ttgttgctta gtaccctaca taattttttt tttcttttgt ttgatacatg 2760
atgaagatct tggtagttgt aaaaagagta aaatacacca ccggtcctta aagttggagc 2820
gtgctgtcac ttaggtccat gatcttgtaa aatcgatatt aaggtccatg aacttgttta 2880
agtgaatcat agcagtacaa aacacgtctg actgggttga ccgtcctacg tggcagtcca 2940
gcgtggctcc atatttgcaa ttaggccctc cacgcccgat ccacggcctt cacggtgtcg 3000
gagatgtggt tcttgccgat gaccgacgta acggcctccc gcaccttagc gagcacctat 3060
gcgagtgcct cccggatctt catcatcgtt tcgtccggca ccgctgccgc caccgccggc 3120
acgcgctgtg ccacgacctc cttccgccac tgcaccatgc cgaagatcgc ctcgctgagc 3180
acgcggtcct catcgccccg acggagcatg tcggcgattt agccggtgac cgtcgccccc 3240
ttgtcctgct gctgcccggt cgctggctcg ccggaggcaa gggtggtgga ggcgtccgag 3300
tcctgcgcgg taccctgtga ctacgaggtg ccgctgatgc ctgagatcac ggtgccagcg 3360
gactgcgtca cttgctgcac cttgccagcc acgagtccac gacggtcccg actccggcga 3420
ccttctcgta cattgtggtg gctagcttct tgctgtactc tccgtggtgc atgtcgctgc 3480
caacttgatc ttgtcggtgt acgtcacgcc ggacacgaca ggcggcagcg ctgccttcag 3540
gcattgtgta cgtggccgca tccttccact cgaaagagtc gacgacaggc gtcgtgccga 3600
tgtcctcgcc ttcccgcagc acacgcatcg tggagtgtgg tgccgccgag acgtccaaga 3660
cggggccgcc gaggtcaccg agccgacacc ttgacacgtt gcgccgtcgc cctccactgc 3720
tccatctcct gcaccgctag ggtccttgcc atgtcaaacc tgacaccgtc agcggcggca 3780
cacgcaaaca accaaaaaag tttcaaatct aacaccgtca gcggcggcac atgcaaagct 3840
agagatcaac ggagcaagag cttactcggc gcgatatgaa cctcaggatc ggaatccatg 3900
gcgatggttt tgtcctcgat gtcctcttgg tacctgcgct agtccacatc acccatcctc 3960
tgcgccgcca catcgcgttc atcctcctcg ctgctgttgc tgttgttgct cacgccagcg 4020
cggtcgccgc tgtttctccc tgccacctcc gccgtcattg ttcccgctgt ggtcgccgcc 4080
ggcgatggtg ttcttgagca ccggcttgtg ttgcttctcc ttccctagtg catctgcccc 4140
tgtcccccct cctccgccgc tgctgctgca acaaacaccc accgaaggcg gcaacggcgc 4200
cgggcaacat gatggcgaag gtcgggaggc gctcacgcag gtgctcacca aggcgcggga 4260
ggccgtcatg tcgctcatcg gcaagaaccg cgtctccaac accatgaagg ctgtggatcg 4320
ggcgtggagg ggcctaattg caaacatgta gccacgctag actgccacgt aggacggtca 4380
acccggtcag acgtgttttt ggactgcaat gattcactta aacaagttca tggatcttaa 4440
tgttgatttt acaagatcgt ggacctaagt gacaccacgc tccaacttta aggacctttc 4500
aagtaaatgc tgttacaagt gaaacaacat aaggaagcat ccacctttag atatttctta 4560
cttttataag aagagcaact aaatataata attttgtagg gttcgctcat caacatggaa 4620
ggccctaacc gaggaataga catgatggac tatgctctaa ttgaatatga catgaggatc 4680
aagacaggtg aacaagaaaa agatgaccta cagctgattg atggtgcatc aatgataggc 4740
cctggaggcc tatggaatcg gccagaaaca atttgcattc ctggcgatta cggtgcagtt 4800
gacataactt tatcacgttt taattgttca gctgaggcca ccgtagagat tcttatatca 4860
gaagtgcaaa gcagtttcaa tttgttgctc ggttgtttaa ccagtgactt ggataaggaa 4920
atccgtctct ttgatggtgt catcagtgag tcacgtgatt taaagaggtc ggtggttgct 4980
gtaatgaggg attctttcat agatttgaag ttcaaagtgg gtgcgtttcc atccagtttc 5040
gaccagcatt atgtttcctt caaggagaaa atccatggct atgatactca agaaataaag 5100
actgattttg cgttaatctc agtaaatgtg acttggtcga ctttgcctgc cggactaaag 5160
tgattactct tctgttttat cgagtcggcc aagagtgact aaaaacctgt ggcttactaa 5220
acctaggtac ggcaaacttg gatagtaaag tattgtaata aatctgtcat tgtaattaag 5280
ccctttgtcc ctaaaaaaag tacttttagt tactagtagc agggccgtgc taacgctacg 5340
gcgatattta gtaagcatgc ataaaaatat ttatatatgt caacatccat gttcatttta 5400
ttattattat aactgtcaca aacttgggta gcttttagtt gtgtagttca attctcgatc 5460
aagagggagt aatttctgta ccttgttgat gtgaatactt tgtaagatgg ttcttatttt 5520
tctacatgca taaacaaaca tcacttaatg tt 5552
<210> 11
<211> 5523
<212> DNA
<213>Southern wild rice (O. meridionalis, Mer)
<400> 11
atgatgacag aaatccccca cgcagccaca gcacggctat tccccctaac ccccgccgcc 60
gcccagatgc gaattctccg ccgctttccg cgtctgctcc gacgctctaa cgccgccgcc 120
cgatctcctg ccccgatgca ccgcctcatc tcttctccct ctctcatggc atctgcagcg 180
gctagctggt gctggtggtc accattgctt gctcgaggag gacctgtcgt ccgtcgtgtt 240
tcccggtgtg ttttcttgtg ctgatcgatg ctaaagtctg cgcctttact tggttattac 300
tacagttttg gcatgatttt catagacaga ttttttgggc atgtgttttt tttccttgtt 360
ctgatgctaa agtttgcgtc ttttgccaca gtttttggat ctgcgatcaa ctttgggttt 420
tgttttcatt tgtttgaagg tagttgtgga aaataagttt ctttaaacta attcgaaaca 480
aagacaaagg agatcgagaa aaaaatttag aaatcgatta tcgatttcag ggttagatga 540
tctcaatcct gactgatggt accgtcttat ttattttagt tgttgatatt ggtttttcat 600
tctcttaatt aatgatagat ttccttggga acctcggaac atgaccacca tcagtcgagt 660
aaaaggcgac gagtcataca ggcgacttcc atcccaggaa aagaagcata ctgcgatcac 720
tcaaggtatg aaaaccattg acaccagggg cacaatcttg gaggctagag ctggagatga 780
gaaaagtaat agagatgcgg cgtcctcaga ggtttcatac atcaaatacg atgtactggg 840
gcaaagtgcg aagcaggatg gctgtgatga ggatgatcga aggagtgaaa cggaggaaca 900
tgttgaggag gacgaagttc ttgatcctga agaatatact gtgaacaaca tacttccaaa 960
aagtagacac cgtgatggct ctatatatag ggacatcatg gacacaccgt ggaaaaggga 1020
gtttcatatt gcagaccgta atgagagtaa gctatctttt ctctatcttt atttgctata 1080
ttatttttta ttagagataa tttgtttcct tgaacataac gaatctcttt ccatatcttg 1140
taactataca tattttattg tgatccttga gatcattgta tatgtgatgc tatgcagcac 1200
tgccaaaatt ttacccgcct tacactcttt tcagctatga gataattgta ctggaggtcc 1260
ttaaacgtgg atgagagtaa cacttccacc ccaagccttg tactttactt ttactggccc 1320
ttcagcttag caccatttgc atacatagca atctgcgcca cagcctgatg ggagggactg 1380
aggttgcatg cagagttctg atgacatgga ctaggacctt attccatgcc atttaattac 1440
ataaatgtcc aaagtacttt atccctgaac tttgcaacac ggtgatcaca cagcctttga 1500
gcatgtattt caatagcaga atacacaaga aaatgacaac tataagtgca aataataatc 1560
taaatatcgc atccacactg ttgtaattgc cattaggttt aaattctcca tacatgcagc 1620
cacaaactgt cagtaatagt acaagttttc caagcatgca gggagcaaca acaagcaata 1680
atagaaagta ctcaggcagt tcacatacta tatataacct aaaggactac taggtgttca 1740
aggggccaac caaacattca aatgcccctg tttaatatga ggagcgggtt gccagtttcc 1800
aaaatataga ccacttccca aaacacgtgg ttttctgtag aggtaaaagg ctggtacagg 1860
aaagaatata cctggctttc tgaagaggta gtctgccctt gagttttttt tttcttgtag 1920
ttgatactag gatagatgtt gctctcctag taaaaagaac ataggttgtt tctactttgt 1980
agatgaaaag gaaaaaaaaa tccaataagg ccatataatc atcaaatatc acatgtactt 2040
ttcaaatgtc aagtgtttgt tcactgtatt aatttccggt cacaaactta cattatgact 2100
ttactttttt tgaagctcgg ttggaggcaa tgaggttttc gaatcccaca aattgtgtca 2160
ttcgcagtaa tggaacttgc atgtcacatg ttcattgcaa catgctgcaa attttatcat 2220
tggagttggc taaaattaca ctggatggtg gttcagtaga gttgtatgga tacatagctg 2280
tgcgggatga tctagatccg ttgcttaatt atattgtcaa ctgtagcagg gatgatccca 2340
tcattgtgga gcaggtacac atccgactta tctagaaata tcattgtgta ttttgatttg 2400
gaaaattcat acttcatgag ttttggcaaa aatcgtcaaa ttattggtac tcgaattact 2460
tttaagatgt taattttatt gcaattggtg atatattgat agagaaatta aaggtcaaaa 2520
ttctactttt caagaatttc tccttccaaa acgcacctta catagggagt gtactctata 2580
ttatgaaatg atgatttact atgagaacag gtttaaatta tgaaactaag gaacacatgt 2640
attccaaaga aaaatcatgt taaatagttt tggacacttt gttgttgctt agtaccctac 2700
ataatttttt ttttcttttg tttgatacat gatgaagatc ttggtagttg taaaaagagt 2760
aaaatacacc accggtcctt aaagttggag cgtggtgtca cttaggtcca tgatcttgta 2820
aaatcgatat taaggtccat gaacttgttt aagtgaatca tagcagtaca aaacacgtct 2880
gactgggttg accgtcctac gtggcagtcc agcgtggctc catatttgca attaggccct 2940
ccacgcccga tccacggcct tcacggtgtc ggagatgtgg ttcttgccga tgaccgacgt 3000
aacggcctcc cgcaccttag cgagcaccta tgcgagtgcc tcccggatct tcatcatcgt 3060
ttcgcccggc accgctgccg gcaccgccgg cacgcgctgt gccacgacct ccttccgcca 3120
ctgcaccatg ccgaagatcg cctcgctgag cacgcggtcc tcatcgcccc gacggagcat 3180
gtcggcgatt tagccggtga ccgtcgcccc cttgtcctgc tgctgcccgg tcgctggctc 3240
gccggaggca agggtggtgg aggcgtccga gtcctgcgcg gtaccctgtg actacgaggt 3300
gccgctgatg cctgagatca cggtgccagc ggactgcgtc acttgctgca ccttgccagc 3360
cacgagtcca cgacggtccc gactccggcg accttctcgt acattgtggt ggctagcttc 3420
ttgctgtact ctccgtggtg catgtcgctg ccaacttgat cttgtcggtg tacgtcacgc 3480
cggacacgac aggcggcagc gctgccttca ggcattgtgt acgtggccgc atccttccac 3540
tcgaaagagt cgacgacagg cgtcgtgccg atgtcctcgc cttcccgcag cacacgcatc 3600
gtggagtgtg gtgccgccga gacgtccaag acggggccgc cgaggtcacc gagccgacac 3660
cttgacacgt tgcgccgtcg ccctccactg ctccatctcc tgcaccgcta gggtccttgc 3720
catgtcaaac ctgacaccgt cagcggcggc acacgcaaac aaccaaaaaa gtttcaaatc 3780
taacaccgtc agcggcggca catgcaaagc tagagatcaa cggagcaaga gcttactcgg 3840
cgcgatatga acctcaggat cggaatccat ggcgatggtt ttgtcctcga tgtcctcttg 3900
gtacctgcgc tagtccacat cacccatcct ctgcgccgcc acatcgcgtt catcctcctc 3960
gctgctgttg ctgttgttgc tcacgccagc gcggtcgccg ctgtttctcc ctgccacctc 4020
cgccgtcatt gttcccactg tggtcgccgc cggcgatggt gttcttgagc accggcttgt 4080
gttgcttctc cttccccagt gcatctgccc ctgtcccccc tcctccgccg ctgctgctgc 4140
aacaaacacc caccgaaggc ggcaacggcg ccgggcaaca tgatggcgaa ggtcgggagg 4200
cgctcacgca ggtgctcacc aaggcgcggg aggccgtcat gtcgctcatc ggcaagaacc 4260
gcgtctccaa caccatgaag gctgtggatc gggcgtggag gggcctaatt gcaaacatgt 4320
agccacgcta gactgccacg taggacggtc aacccggtca gacgtgtttt tggactgcaa 4380
tgattcactt aaacaagttc atggatctta atgttgattt tacaagatcg tggacataag 4440
tgacaccacg ctccaacttt aaggaccttt caagtaaatg ctgttacaag tgaaacaaca 4500
taaggaagca tccaccttta gatatttctt acttttataa gaagagcaac taaatataat 4560
aattttgtag ggttcgctca tcaacatgga aggccctaac cgaggaatag acatgatgga 4620
ctatgctcta attgaatatg acatgaggat caagacaggt gaacaagaaa aagatgacct 4680
acagctgatt gatggtgcat caatgatagg ccctggaggc ctatggaatc ggccagaaac 4740
aatttgcatt cctggcgatt acggtgcagt tgacataact ttatcacgtt ttaattgttc 4800
agctgaggcc accgtagaga ttcttatatc agaagtgcaa agcagtttca atttgttgct 4860
cggttgttta accagtgact tggataagga aatccgtctc tttgatggtg tcatcagtga 4920
gtcacgtgat ttaaagaggt cggtggttgc tgtaacgagg gattctttca tagatttgaa 4980
gttcgaagtg ggcgcgtttc catccagttt tgaccagcat tatgtttcct tcaaggagaa 5040
aatccatggc tatgatactc aagaaataaa gactgatttt gcgttaatct cagtaaatgt 5100
gacttggtcg actttgcctg ccggactaaa gtgattactc ttctgtttta tcgagtcggc 5160
caagagtgac taaaaacctg tggcttacta aacctaggta cggcaaactt ggatagtaaa 5220
gtattgtaat aaatctgtca ttgtaattaa gccctttgtc cctaaaaaaa gtacttttag 5280
ttactagtag cagggccgtg ctaacgctac ggcgatattt agtaagcatg cataaaaata 5340
tttatatatg tcaacatcca tgttcatttt attattatta taactgtcac aaacttgggt 5400
agcttttagt tgtgtagttc aattctcgat caagagggag taatttctgt accttgttga 5460
tgtgaatact ttgtaagatg gttcttattt ttctacatgc ataaacaaac atcacttaat 5520
gtt 5523
<210> 12
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 12
agatccctca tcttgtcgtc g 21
<210> 13
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 13
gaaagcaacg atagatccgc ta 22
<210> 14
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 14
ggaaggtaat gggaaagaga gac 23
<210> 15
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 15
gcgaggataa agttggtata gcc 23
<210> 16
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 16
ccagggaata caatcacaat g 21
<210> 17
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 17
aagcaggaag caactaaaca a 21

Claims (10)

1. rice interspecific hybrid pollen fertility gene seat qHMS7, which is characterized in that be located on the 7th chromosome long arm, finely positioning In the sections 31.6kb that molecular labeling D17 and YU-33 are flanking marker,
The sequence of wherein molecular labeling D17 is:
D17F AGATCCCTCATCTTGTCGTCG (such as sequence SEQ ID NO:Shown in 12)
D17R GAAAGCAACGATAGATCCGCTA (such as sequence SEQ ID NO:Shown in 13);
The sequence of molecular labeling YU-33 is:
YU-33F GGAAGGTAATGGGAAAGAGAGAC (such as sequence SEQ ID NO:Shown in 14)
YU-33R GCGAGGATAAAGTTGGTATAGCC (such as sequence SEQ ID NO:Shown in 15).
2. the gene in locus qHMS7 described in claim 1, it is characterised in that comprising in gene ORF1, ORF2 or ORF3 One or more close linkages;The allelic form of gene ORF1 includes ORF1DAnd ORF1M, the allele shape of gene ORF2 Formula includes ORF2DWith ORF2MAnd ORF2N;Wherein:
Gene ORF1D, sequence such as SEQ ID NO:Shown in 10;
Gene ORF1M, sequence such as SEQ ID NO:Shown in 11;
Gene ORF2D, sequence such as SEQ ID NO:Shown in 1;
Gene ORF2M, sequence such as SEQ ID NO:Shown in 3;
Gene ORF2N, sequence such as SEQ ID NO:Shown in 5;
Gene ORF3, sequence such as SEQ ID NO:Shown in 7.
3. the albumen of gene code described in claim 2, it is characterised in that gene ORF2DEncoded protein sequence such as SEQ ID NO:Shown in 2;Gene ORF2MEncoded protein sequence such as SEQ ID NO:Shown in 4;Gene ORF2NEncoded albumen Matter sequence such as SEQ ID NO:Shown in 6;The encoded protein sequences of gene ORF3 such as SEQ ID NO:Shown in 8.
4. the gene ORF2 described in locus qHMS7 described in claim 1, claim 2DOr gene ORF3 or gene ORF2N, application of the albumen in paddy rice cross breeding breeding described in claim 3.
5. application according to claim 4, it is characterised in that by destroying gene ORF2DFunction or knock out gene ORF2D, improve rice hybrid pollen fertility;Or it by transgenic approach transgene ORF3, improves rice hybrid pollen and educates Property.
6. gene ORF2 described in claim 2DArtificial mutation allele ORF2D-CR, sequence such as SEQ ID NO:Shown in 9.
7. gene ORF2 described in claim 6D-CRApplication in paddy rice cross breeding breeding.
8. a kind of method for cultivating wide affine type rice strain, which is characterized in that pass through artificial mutation ORF2D- ORF3 combines base Because of such as SEQ ID NO in type rice:Gene ORF2 shown in 1DFor SEQ ID NO:Gene ORF2 shown in 9D-CR, selection mutation " ORF2 afterwardsD-CR- ORF3 " genotypic rices are wide affine type rice strain.
9. a kind of molecular labeling D7-3 for identifying paddy rice hybrid fertility gene type, it is characterised in that sequence is as follows:
D7-3F:CCAGGGAATACAATCACAATG (such as sequence SEQ ID NO:Shown in 16);
D7-3R:AAGCAGGAAGCAACTAAACAA (such as sequence SEQ ID NO:Shown in 17).
10. applications of the molecular labeling D7-3 in paddy rice cross breeding breeding described in claim 9, specifically can be used for transgenosis or Filial generation detects, it can also be used to molecular marker assisted selection breeding.
CN201810164610.3A 2018-02-27 2018-02-27 Rice interspecific hybrid pollen fertility gene and its application Active CN108690848B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810164610.3A CN108690848B (en) 2018-02-27 2018-02-27 Rice interspecific hybrid pollen fertility gene and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810164610.3A CN108690848B (en) 2018-02-27 2018-02-27 Rice interspecific hybrid pollen fertility gene and its application

Publications (2)

Publication Number Publication Date
CN108690848A true CN108690848A (en) 2018-10-23
CN108690848B CN108690848B (en) 2019-03-12

Family

ID=63844219

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810164610.3A Active CN108690848B (en) 2018-02-27 2018-02-27 Rice interspecific hybrid pollen fertility gene and its application

Country Status (1)

Country Link
CN (1) CN108690848B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109554372A (en) * 2018-12-06 2019-04-02 华南农业大学 A kind of paddy rice hybrid sterile gene seat S23 and application with photo-thermal reaction interaction
CN115851759A (en) * 2022-08-30 2023-03-28 南京农业大学 Rice reproductive isolation locus RHS12 gene DUYAO and JIEYAO and breeding utilization thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1869232A (en) * 2006-05-24 2006-11-29 华南农业大学 Paddy rice hybrid fertility gene and its application
CN101492682A (en) * 2008-01-23 2009-07-29 华南农业大学 Rice hybrid pollen fertility gene and uses thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1869232A (en) * 2006-05-24 2006-11-29 华南农业大学 Paddy rice hybrid fertility gene and its application
CN101492682A (en) * 2008-01-23 2009-07-29 华南农业大学 Rice hybrid pollen fertility gene and uses thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JIYING ZHAO等: "A new gene controlling hybrid sterility between Oryza sativa and Oryza longistaminata", 《EUPHYTICA》 *
YANG YU等: "Hybrid Sterility in Rice (Oryza sativa L.) Involves the Tetratricopeptide Repeat Domain Containing Protein", 《GENETICS》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109554372A (en) * 2018-12-06 2019-04-02 华南农业大学 A kind of paddy rice hybrid sterile gene seat S23 and application with photo-thermal reaction interaction
CN115851759A (en) * 2022-08-30 2023-03-28 南京农业大学 Rice reproductive isolation locus RHS12 gene DUYAO and JIEYAO and breeding utilization thereof
CN115851759B (en) * 2022-08-30 2023-08-04 南京农业大学 Rice reproduction isolated gene locus RHS12 genes DUYAO and JIEYAO and breeding utilization thereof

Also Published As

Publication number Publication date
CN108690848B (en) 2019-03-12

Similar Documents

Publication Publication Date Title
Hasan et al. Recent advancements in molecular marker-assisted selection and applications in plant breeding programmes
CN110028567A (en) A kind of relevant protein of Rice Flowering and its encoding gene LHD3 and application
CN108690848B (en) Rice interspecific hybrid pollen fertility gene and its application
CN109112146A (en) Control clone and the Breeding Application of the gene qSLWA9 of cabbage type rape silique length and grain principal characteristic shape
CN101492682B (en) Rice hybrid pollen fertility gene and uses thereof
Wu et al. Functional characterization of powdery mildew resistance gene MlIW172, a new Pm60 allele and its allelic variation in wild emmer wheat
Chen et al. Cloning of a resistance gene analog from wheat and development of a codominant PCR marker for Pm21
CN113061171B (en) Rice blast resistant protein and gene, isolated nucleic acid and application thereof
CN108570474A (en) Rice flower development gene EH1 and its application
CN109134633A (en) Blast resisting albumen and gene, the nucleic acid of separation and its application
CN111926102A (en) Molecular marker of rice photo-thermo-sensitive male sterility gene pms3 and application thereof
CN115873867B (en) Rice blast resistance gene Pi69, and encoding protein and application thereof
Hu et al. Fine mapping of a major quantitative trait locus, qgnp7 (t), controlling grain number per panicle in African rice (Oryza glaberrima S.)
Liu et al. Introgression of sharp eyespot resistance from Dasypyrum villosum chromosome 2VL into bread wheat
CN109912706B (en) Gene, protein and molecular marker related to rice weakness and premature senility and application
CN105821058B (en) Rice yellow-green leaf character gene ygl8 and application thereof in rice breeding
CN112662800B (en) Molecular marker primer of rice cold-resistant major QTL CTS12 as well as marking method and application thereof
CN111304219B (en) GL1 gene separated from rice WZ1 and application thereof in increasing rice grain length
CN114350687A (en) Rice bacterial leaf blight resistant gene, protein and application thereof
CN100457905C (en) Paddy rice hybrid fertility gene and its application
CN109456984B (en) Rice glume development gene AH1 and application thereof
CN113462696A (en) Rice low-temperature sensitive leaf-shaped gene SRNL9 and application thereof
CN108440658B (en) Rice chloroplast ribosomal protein coding gene OsWGL2 and application thereof
CN106381299B (en) A kind of rice paddy seed dormant gene OsQSOXL1 and its coding protein and application
CN112226442A (en) Wheat grain size character related gene TaSRK, and coding protein and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant