CN112680505A - Functional marker development method based on wheat potassium transport protein gene - Google Patents
Functional marker development method based on wheat potassium transport protein gene Download PDFInfo
- Publication number
- CN112680505A CN112680505A CN202110016384.6A CN202110016384A CN112680505A CN 112680505 A CN112680505 A CN 112680505A CN 202110016384 A CN202110016384 A CN 202110016384A CN 112680505 A CN112680505 A CN 112680505A
- Authority
- CN
- China
- Prior art keywords
- wheat
- pcr amplification
- hak1
- transport protein
- potassium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a functional marker development method based on a wheat potassium transporter gene, which comprises the following operation steps: firstly, extracting wheat genome DNA from wheat seeds; then carrying out enzyme digestion on the wheat genome DNA by using restriction enzyme to obtain a wheat potassium transport protein gene HAK1 sequence; then, the 5' end of the wheat potassium transport protein gene HAK1 is processed, a PCR amplification primer pair is subjected to dyeing marking, and then the wheat potassium transport protein gene HAK1 is subjected to PCR amplification to obtain a PCR amplification product; and finally, carrying out agarose gel electrophoresis on the PCR amplification product, and observing the wheat potassium transporter gene HAK1 under ultraviolet rays after dyeing. The invention is convenient for the in-depth research of the function of the wheat potassium transport protein gene HAK1, has new knowledge on the quality improvement of wheat, and is convenient for improving the yield of wheat.
Description
Technical Field
The invention relates to the technical field of biological products, in particular to a functional marker development method based on a wheat potassium transporter gene.
Background
The wheat grain powder is white with yellow-brown bran. The main characteristics are as follows: the starch grains are mainly flat round, oval or round triangular, the diameter is 30-40 mu m, the side view is double-lens-shaped and shell-shaped, the width is 11-19 mu m, the two ends are slightly sharp or blunt, the umbilical point is crack-shaped, and the number of compound grains is 2-4 or more. The transverse cells are flaky, slender and cylindrical, 38-232 mu m long, 6-21 mu m in diameter and bead-shaped in wall for thickening. The epidermal cells of the pericarp are rectangular or polygonal, the length is 64-216 mu m, the diameter is 16-42 mu m, and the pericarp is thickened like beads. The pericarp has slender or irregular shape of mesocyte, and the pericarp can be thickened like beads. Non-glandular hair single cells, 43-950 μm long, 11-29 μm diameter, 5-11 μm wall thickness. The stalks are upright and clustered, have 6-7 nodes, are 60-100 cm high and 5-7 mm in diameter. The leaf sheath loosens phimosis, the lower part is longer than the upper part and shorter than the internode; the tongue lamina is approximately 1 mm long; the leaves are long in the shape of needles. The spike-shaped inflorescence is upright, the length is 5-10 cm (except for awns), and the width is 1-1.5 cm; the spikelets contain 3-9 florets, and the upper part of the spikelets does not develop; the spine is oval and 6-8 mm long, the main vein is provided with a ridge at the upper part of the back surface, the top end of the main vein extends to form teeth with the length of about 1 mm, and the ridge and the top teeth of the side vein are not obvious; the lemma is long and round and is in a shape of a needle, the length of the lemma is 8-10 mm, and the top end of the lemma is provided with awns or has no awns; the palea is several equal lengths to the lemma.
The wheat glumes are one of staple food of human beings, and can be ground into flour to make bread, steamed bread, cookies, noodles, etc., and fermented to make beer, alcohol, Chinese liquor (such as vodka), or biomass fuel. Wheat is one of the three major grains, is almost all eaten, and only about one sixth of the wheat is used as feed. The two river basin is the area where wheat is cultivated firstly in the world, and China is one of the countries where wheat is cultivated earlier in the world. Wheat is one of three food crops in China, occupies 1/4 of the food crops in China, provides a large amount of heat for human beings, and is one of the main sources of food protein. Statistically, the total amount of wheat protein worldwide is about equal to the sum of meat, egg and milk proteins.
Potassium ions are one of the essential nutrient elements for the growth of plants and microorganisms, are widely distributed in organisms and participate in various important physiological processes. In 1994, a potassium ion transporter, HAK1, was first cloned from wheat and the HKI family of plants was identified. In 1997, another family of plant K transporters, HAK or KUP/HAK/KT, was identified simultaneously by three different cloning strategies, PCR, gene database analysis and yeast functional complementation. At the same time, the KC0 channel was identified by searching gene databases for new plant counterparts of animal potassium channels. Other potassium and cation transporters presumed to play a role in potassium transport have also been identified; however, for the majority of these systems, little information is available, essentially from sequence and evolutionary relationship analysis. Therefore, the deep research on the function of the wheat potassium transport protein gene has new understanding on the quality improvement of wheat and is convenient for improving the yield of wheat.
Disclosure of Invention
The invention mainly aims to provide a functional marker development method based on a wheat potassium transporter gene, which can effectively solve the problems in the background technology.
In order to achieve the purpose, the invention adopts the technical scheme that:
a functional marker development method based on a wheat potassium transporter gene comprises the following operation steps:
s1, extracting wheat genome DNA;
s2, carrying out enzyme digestion on the wheat genome DNA by using restriction enzyme to obtain a wheat potassium transport protein gene HAK1 sequence,
pair of HAK1 sequences: winding: TTGGATCCAGAAGGGGTGAAC the flow of the air in the air conditioner,
and (3) chain descending: ACAAGATAGGTCGCATACTGG, respectively;
s3, the 5' end of the wheat potassium transport protein gene HAK1 is processed, the PCR amplification primer pair is dyed and marked, then the wheat potassium transport protein gene HAK1 is PCR amplified to obtain PCR amplification product,
PCR amplification primer pair: winding: TGGAAGCGGAACGGATGAGGA the flow of the air in the air conditioner,
and (3) chain descending: CTGCGGGAACGAGGGAGTGTC, respectively;
and S4, carrying out agarose gel electrophoresis on the PCR amplification product, and observing the wheat potassium transporter gene HAK1 under ultraviolet rays after dyeing.
As a preferable aspect of the present invention, the present invention is characterized in that: the step S1 includes the following operation steps:
a. weighing 0.1-0.3g of wheat grains in a precooled mortar, adding 2-3 times of volume (W/V, about 300-;
b. adding about 300 μ L of extraction buffer solution, adding 20% SDS to a final concentration of 2%, about 60-70 μ L, mixing gently, placing in 60-70 deg.C water bath for 10-15min, adding 1/10 volume of 5mol/L potassium acetate (about 60-70 μ L), reacting in water bath for 20-40min, centrifuging (10-20 krpm,10-20min,3-5 deg.C);
c. transferring the upper phase into a new EP tube, extracting once (shaking up and down for several times) with equal volume of phenol/chloroform/isoamyl alcohol (25: 24: 1), centrifuging (10-20 krpm,10-20min,15-25 deg.C);
d. transferring the upper phase into a new EP tube, adding equal volume of isopropanol, reacting at room temperature for 5-10min, inverting the tube at least 5-7 times, and centrifuging (10-20 krpm,10-20min,3-5 deg.C);
e. the supernatant was discarded, the precipitate was washed with 70% ethanol, dried under vacuum or blow-dried, and finally dissolved in 1 XTE (about 40-60. mu.l) to extract the wheat genomic DNA.
As a preferred technical scheme of the invention, the concentration of the agarose gel electrophoresis is 0.5-2%, the electric field intensity during the electrophoresis is 5-20V/cm, the electrophoresis temperature is 20-40 ℃, and the nucleic acid staining agent adopted by the agarose gel electrophoresis is ethidium bromide.
As a preferred technical scheme of the invention, the temperature of PCR amplification deformation is 93-95 ℃ for 1-3min, the temperature of PCR amplification annealing is 50-65 ℃ for 20-40s, and the temperature of PCR amplification extension is 70-80 ℃ for 20-40 s.
Compared with the prior art, the invention has the beneficial effects that:
1. grinding wheat seeds, extracting wheat genome DNA, and performing enzyme digestion on the wheat genome DNA by using endonuclease so as to conveniently and quickly obtain a wheat potassium transporter gene HAK1 sequence;
2. the PCR amplification primer pair is subjected to dyeing marking, and then the wheat potassium transport protein gene HAK1 sequence is subjected to PCR amplification, so that a marked PCR amplification product can be conveniently obtained;
3. the PCR amplification product is subjected to electrophoresis by an agarose gel electrophoresis technology, and then the wheat potassium transporter gene HAK1 is observed under ultraviolet rays, so that the function of the wheat potassium transporter gene HAK1 can be conveniently and deeply researched, new knowledge can be provided for improving the quality of wheat, and the yield of wheat can be conveniently improved.
Drawings
FIG. 1 is a schematic view of the observation and record of the wheat potassium transporter gene HAK1 in the PCR amplification product of the method for developing a functional marker based on the wheat potassium transporter gene of the present invention.
Detailed Description
In order to make the technical means, the creation characteristics, the achievement purposes and the effects of the invention easy to understand, the invention is further described with the specific embodiments.
Example 1
A functional marker development method based on a wheat potassium transporter gene comprises the following operation steps:
s1, extracting wheat genome DNA;
s2, carrying out enzyme digestion on the wheat genome DNA by using restriction enzyme to obtain a wheat potassium transport protein gene HAK1 sequence,
pair of HAK1 sequences: winding: TTGGATCCAGAAGGGGTGAAC the flow of the air in the air conditioner,
and (3) chain descending: ACAAGATAGGTCGCATACTGG, respectively;
s3, the 5' end of the wheat potassium transport protein gene HAK1 is processed, the PCR amplification primer pair is dyed and marked, then the wheat potassium transport protein gene HAK1 is PCR amplified to obtain PCR amplification product,
PCR amplification primer pair: winding: TGGAAGCGGAACGGATGAGGA the flow of the air in the air conditioner,
and (3) chain descending: CTGCGGGAACGAGGGAGTGTC, respectively;
and S4, carrying out agarose gel electrophoresis on the PCR amplification product, and observing the 5' end of the wheat potassium transporter gene HAK1 under ultraviolet rays after dyeing.
In this embodiment, preferably, the step S1 includes the following steps:
a. weighing 0.1-0.3g of wheat grains in a precooled mortar, adding 2-3 times of volume (W/V, about 300-;
b. adding about 300 μ L of extraction buffer solution, adding 20% SDS to a final concentration of 2%, about 60-70 μ L, mixing gently, placing in 60-70 deg.C water bath for 10-15min, adding 1/10 volume of 5mol/L potassium acetate (about 60-70 μ L), reacting in water bath for 20-40min, centrifuging (10-20 krpm,10-20min,3-5 deg.C);
c. transferring the upper phase into a new EP tube, extracting once (shaking up and down for several times) with equal volume of phenol/chloroform/isoamyl alcohol (25: 24: 1), centrifuging (10-20 krpm,10-20min,15-25 deg.C);
d. transferring the upper phase into a new EP tube, adding equal volume of isopropanol, reacting at room temperature for 5-10min, inverting the tube at least 5-7 times, and centrifuging (10-20 krpm,10-20min,3-5 deg.C);
e. the supernatant was discarded, the precipitate was washed with 70% ethanol, dried under vacuum or blow-dried, and finally dissolved in 1 XTE (about 40-60. mu.l) to extract the wheat genomic DNA.
In this embodiment, preferably, the concentration of the agarose gel electrophoresis is 0.5-2%, the electric field intensity during electrophoresis is 5-20V/cm, the electrophoresis temperature is 20-40 ℃, and the nucleic acid staining agent used for the agarose gel electrophoresis is ethidium bromide.
In this embodiment, preferably, the temperature of the PCR amplification deformation is 93-95 ℃ for 1-3min, the temperature of the PCR amplification annealing is 50-65 ℃ for 20-40s, and the temperature of the PCR amplification extension is 70-80 ℃ for 20-40 s.
Example 2
A functional marker development method based on a wheat potassium transporter gene comprises the following operation steps:
s1, extracting wheat genome DNA;
s2, carrying out enzyme digestion on the wheat genome DNA by using restriction enzyme to obtain a wheat potassium transport protein gene HAK1 sequence,
pair of HAK1 sequences: winding: TTGGATCCAGAAGGGGTGAAC the flow of the air in the air conditioner,
and (3) chain descending: ACAAGATAGGTCGCATACTGG, respectively;
s3, the 5' end of the wheat potassium transport protein gene HAK1 is processed, the PCR amplification primer pair is dyed and marked, then the wheat potassium transport protein gene HAK1 is PCR amplified to obtain PCR amplification product,
PCR amplification primer pair: winding: TGGAAGCGGAACGGATGAGGA the flow of the air in the air conditioner,
and (3) chain descending: CTGCGGGAACGAGGGAGTGTC, respectively;
and S4, carrying out agarose gel electrophoresis on the PCR amplification product, and observing the wheat potassium transporter gene HAK1 under ultraviolet rays after dyeing.
In this embodiment, preferably, the step S1 includes the following steps:
a. weighing 0.1g of wheat grains in a precooled mortar, adding 3 times of volume (W/V, about 300 mu l) of extraction buffer solution, grinding on an ice tray, and transferring into an EP tube after grinding;
b. adding about 300. mu.l of extraction buffer, adding 20% SDS to a final concentration of 2% and about 66. mu.l, mixing gently, placing in a 65 ℃ water bath for 10min, adding 1/10 volume of 5mol/L potassium acetate (about 66. mu.l), reacting in the water bath for 30min, and centrifuging (15 krpm,15min,4 ℃);
c. transferring the upper phase into a new EP tube, extracting once (shaking up and down for several times) with equal volume of phenol/chloroform/isoamyl alcohol (25: 24: 1), centrifuging (15 krpm,15min,20 ℃);
d. transferring the upper phase into a new EP tube, adding equal volume of isopropanol, reacting at room temperature for 10min, inverting the tube at least for 5min, and centrifuging (15 krpm,15min,4 deg.C);
e. the supernatant was discarded, and the precipitate was washed with 70% ethanol, vacuum-dried or blow-dried, and finally dissolved in 1 XTE (about 66. mu.l) to extract the wheat genomic DNA.
In this embodiment, preferably, the concentration of the agarose gel electrophoresis is 0.5-2%, the electric field intensity during electrophoresis is 5-20V/cm, the electrophoresis temperature is 20-40 ℃, and the nucleic acid staining agent used for the agarose gel electrophoresis is ethidium bromide.
In this embodiment, preferably, the temperature of the PCR amplification deformation is 93-95 ℃ for 1-3min, the temperature of the PCR amplification annealing is 50-65 ℃ for 20-40s, and the temperature of the PCR amplification extension is 70-80 ℃ for 20-40 s.
Example 3
A functional marker development method based on a wheat potassium transporter gene comprises the following operation steps:
s1, extracting wheat genome DNA;
s2, carrying out enzyme digestion on the wheat genome DNA by using restriction enzyme to obtain a wheat potassium transport protein gene HAK1 sequence,
pair of HAK1 sequences: winding: TTGGATCCAGAAGGGGTGAAC the flow of the air in the air conditioner,
and (3) chain descending: ACAAGATAGGTCGCATACTGG, respectively;
s3, the 5' end of the wheat potassium transport protein gene HAK1 is processed, the PCR amplification primer pair is dyed and marked, then the wheat potassium transport protein gene HAK1 is PCR amplified to obtain PCR amplification product,
PCR amplification primer pair: winding: TGGAAGCGGAACGGATGAGGA the flow of the air in the air conditioner,
and (3) chain descending: CTGCGGGAACGAGGGAGTGTC, respectively;
and S4, carrying out agarose gel electrophoresis on the PCR amplification product, and observing the wheat potassium transporter gene HAK1 under ultraviolet rays after dyeing.
In this embodiment, preferably, the step S1 includes the following steps:
a. weighing 0.1g of wheat grains in a precooled mortar, adding 3 times of volume (W/V, about 300 mu l) of extraction buffer solution, grinding on an ice tray, and transferring into an EP tube after grinding;
b. adding about 300. mu.l of extraction buffer, adding 20% SDS to a final concentration of 2% and about 66. mu.l, mixing gently, placing in a 65 ℃ water bath for 10min, adding 1/10 volume of 5mol/L potassium acetate (about 66. mu.l), reacting in the water bath for 30min, and centrifuging (15 krpm,15min,4 ℃);
c. transferring the upper phase into a new EP tube, extracting once (shaking up and down for several times) with equal volume of phenol/chloroform/isoamyl alcohol (25: 24: 1), centrifuging (15 krpm,15min,20 ℃);
d. transferring the upper phase into a new EP tube, adding equal volume of isopropanol, reacting at room temperature for 10min, inverting the tube at least for 5min, and centrifuging (15 krpm,15min,4 deg.C);
e. the supernatant was discarded, and the precipitate was washed with 70% ethanol, vacuum-dried or blow-dried, and finally dissolved in 1 XTE (about 66. mu.l) to extract the wheat genomic DNA.
In this embodiment, preferably, the concentration of the agarose gel electrophoresis is 2%, the electric field strength during electrophoresis is 20V/cm, the electrophoresis temperature is 30 ℃, and the nucleic acid staining agent used for the agarose gel electrophoresis is ethidium bromide.
In this embodiment, preferably, the temperature of the PCR amplification deformation is 93-95 ℃ for 1-3min, the temperature of the PCR amplification annealing is 50-65 ℃ for 20-40s, and the temperature of the PCR amplification extension is 70-80 ℃ for 20-40 s.
Example 4
A functional marker development method based on a wheat potassium transporter gene comprises the following operation steps:
s1, extracting wheat genome DNA;
s2, carrying out enzyme digestion on the wheat genome DNA by using restriction enzyme to obtain a wheat potassium transport protein gene HAK1 sequence,
pair of HAK1 sequences: winding: TTGGATCCAGAAGGGGTGAAC the flow of the air in the air conditioner,
and (3) chain descending: ACAAGATAGGTCGCATACTGG, respectively;
s3, the 5' end of the wheat potassium transport protein gene HAK1 is processed, the PCR amplification primer pair is dyed and marked, then the wheat potassium transport protein gene HAK1 is PCR amplified to obtain PCR amplification product,
PCR amplification primer pair: winding: TGGAAGCGGAACGGATGAGGA the flow of the air in the air conditioner,
and (3) chain descending: CTGCGGGAACGAGGGAGTGTC, respectively;
and S4, carrying out agarose gel electrophoresis on the PCR amplification product, and observing the wheat potassium transporter gene HAK1 under ultraviolet rays after dyeing.
In this embodiment, preferably, the step S1 includes the following steps:
a. weighing 0.1g of wheat grains in a precooled mortar, adding 3 times of volume (W/V, about 300 mu l) of extraction buffer solution, grinding on an ice tray, and transferring into an EP tube after grinding;
b. adding about 300. mu.l of extraction buffer, adding 20% SDS to a final concentration of 2% and about 66. mu.l, mixing gently, placing in a 65 ℃ water bath for 10min, adding 1/10 volume of 5mol/L potassium acetate (about 66. mu.l), reacting in the water bath for 30min, and centrifuging (15 krpm,15min,4 ℃);
c. transferring the upper phase into a new EP tube, extracting once (shaking up and down for several times) with equal volume of phenol/chloroform/isoamyl alcohol (25: 24: 1), centrifuging (15 krpm,15min,20 ℃);
d. transferring the upper phase into a new EP tube, adding equal volume of isopropanol, reacting at room temperature for 10min, inverting the tube at least for 5min, and centrifuging (15 krpm,15min,4 deg.C);
e. the supernatant was discarded, and the precipitate was washed with 70% ethanol, vacuum-dried or blow-dried, and finally dissolved in 1 XTE (about 66. mu.l) to extract the wheat genomic DNA.
In this embodiment, preferably, the concentration of the agarose gel electrophoresis is 2%, the electric field strength during electrophoresis is 20V/cm, the electrophoresis temperature is 30 ℃, and the nucleic acid staining agent used for the agarose gel electrophoresis is ethidium bromide.
In this embodiment, preferably, the temperature of the PCR amplification deformation is 95 ℃ for 3min, the temperature of the PCR amplification annealing is 60 ℃ for 30s, and the temperature of the PCR amplification extension is 75 ℃ for 25 s.
The wheat seeds are ground, then the wheat genome DNA is extracted, and then the wheat genome DNA is subjected to enzyme digestion by using endonuclease, so that the sequence of the wheat potassium transporter gene HAK1 can be conveniently and rapidly obtained; the PCR amplification primer pair is subjected to dyeing marking, and then the wheat potassium transport protein gene HAK1 sequence is subjected to PCR amplification, so that a marked PCR amplification product can be conveniently obtained; the PCR amplification product is subjected to electrophoresis by an agarose gel electrophoresis technology, and then the wheat potassium transporter gene HAK1 is observed under ultraviolet rays, so that the function of the wheat potassium transporter gene HAK1 can be conveniently and deeply researched, new knowledge can be provided for improving the quality of wheat, and the yield of wheat can be conveniently improved.
The foregoing shows and describes the general principles and broad features of the present invention and advantages thereof. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.
Claims (4)
1. A functional marker development method based on wheat potassium transport protein genes is characterized in that: the method comprises the following operation steps:
s1, extracting wheat genome DNA;
s2, carrying out enzyme digestion on the wheat genome DNA by using restriction enzyme to obtain a wheat potassium transport protein gene HAK1 sequence,
pair of HAK1 sequences: winding: TTGGATCCAGAAGGGGTGAAC the flow of the air in the air conditioner,
and (3) chain descending: ACAAGATAGGTCGCATACTGG, respectively;
s3, the 5' end of the wheat potassium transport protein gene HAK1 is processed, the PCR amplification primer pair is dyed and marked, then the wheat potassium transport protein gene HAK1 is PCR amplified to obtain PCR amplification product,
PCR amplification primer pair: winding: TGGAAGCGGAACGGATGAGGA the flow of the air in the air conditioner,
and (3) chain descending: CTGCGGGAACGAGGGAGTGTC, respectively;
and S4, carrying out agarose gel electrophoresis on the PCR amplification product, and observing the wheat potassium transporter gene HAK1 under ultraviolet rays after dyeing.
2. The method for developing a functional marker based on a wheat potassium transporter gene according to claim 1, wherein the method comprises the following steps: the step S1 includes the following operation steps:
a. weighing 0.1-0.3g of wheat grains in a precooled mortar, adding 2-3 times of volume (W/V, about 300-;
b. adding about 300 μ L of extraction buffer solution, adding 20% SDS to a final concentration of 2%, about 60-70 μ L, mixing gently, placing in 60-70 deg.C water bath for 10-15min, adding 1/10 volume of 5mol/L potassium acetate (about 60-70 μ L), reacting in water bath for 20-40min, centrifuging (10-20 krpm,10-20min,3-5 deg.C);
c. transferring the upper phase into a new EP tube, extracting once (shaking up and down for several times) with equal volume of phenol/chloroform/isoamyl alcohol (25: 24: 1), centrifuging (10-20 krpm,10-20min,15-25 deg.C);
d. transferring the upper phase into a new EP tube, adding equal volume of isopropanol, reacting at room temperature for 5-10min, inverting the tube at least 5-7 times, and centrifuging (10-20 krpm,10-20min,3-5 deg.C);
e. the supernatant was discarded, the precipitate was washed with 70% ethanol, dried under vacuum or blow-dried, and finally dissolved in 1 XTE (about 40-60. mu.l) to extract the wheat genomic DNA.
3. The method for developing a functional marker based on a wheat potassium transporter gene according to claim 1, wherein the method comprises the following steps: the concentration of the agarose gel electrophoresis is 0.5-2%, the electric field intensity during electrophoresis is 5-20V/cm, the electrophoresis temperature is 20-40 ℃, and the nucleic acid staining agent adopted by the agarose gel electrophoresis is ethidium bromide.
4. The method for developing a functional marker based on a wheat potassium transporter gene according to claim 1, wherein the method comprises the following steps: the temperature of PCR amplification deformation is 93-95 ℃ and lasts for 1-3min, the temperature of PCR amplification annealing is 50-65 ℃ and lasts for 20-40s, and the temperature of PCR amplification extension is 70-80 ℃ and lasts for 20-40 s.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110016384.6A CN112680505A (en) | 2021-01-07 | 2021-01-07 | Functional marker development method based on wheat potassium transport protein gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110016384.6A CN112680505A (en) | 2021-01-07 | 2021-01-07 | Functional marker development method based on wheat potassium transport protein gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112680505A true CN112680505A (en) | 2021-04-20 |
Family
ID=75456032
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110016384.6A Pending CN112680505A (en) | 2021-01-07 | 2021-01-07 | Functional marker development method based on wheat potassium transport protein gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112680505A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789575A (en) * | 2015-04-27 | 2015-07-22 | 安徽农业大学 | Major gene TaTGW-2D for controlling wheat thousand seed weight and marking method thereof |
-
2021
- 2021-01-07 CN CN202110016384.6A patent/CN112680505A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789575A (en) * | 2015-04-27 | 2015-07-22 | 安徽农业大学 | Major gene TaTGW-2D for controlling wheat thousand seed weight and marking method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 秦余香等: "小麦耐盐相关基因TaHAK1的克隆与表达分析", 《麦类作物学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107557369B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Nacono | |
| CN108330163B (en) | Characteristic sequence, primer and identification method of apocarya variety Nacono and Sumner | |
| US20220369648A1 (en) | Endophytic falciphora oryzae fo-r20 and its application | |
| CN113151553B (en) | Molecular marker coseparated with watermelon plant few lateral branch gene Clbl and application | |
| CN106172129A (en) | A kind of fish growth and the comprehensive selection-breeding of multiple anti-adversity and verification method | |
| CN106282231A (en) | The construction method of mucopolysaccharidosis II type animal model and application | |
| CN111837766B (en) | Method for controlling pathogen of seedling phlobacterium phlogistii by composite microorganism treatment and application | |
| CN113637794A (en) | SSR molecular marker of new variety of mulberry, namely Guangdong mulberry 201, and core primer group, kit and application thereof | |
| CN110894470A (en) | Shiitake mushroom strain nongxiang No. 5 suitable for industrial cultivation and molecular identification method thereof | |
| CN110468150B (en) | Application of RGS1 gene as negative regulatory factor in improving tomato bacterial leaf spot resistance in low-irradiation environment | |
| CN114292925B (en) | SSR molecular marker primer related to procambarus clarkia growth traits and application thereof in auxiliary selection | |
| CN108660140A (en) | Application of the SlSL4 genes in regulating and controlling Fruit Ripening of Tomato | |
| CN114657264A (en) | Clarias fuscus gender-specific molecular marker primer and application thereof | |
| CN116103331B (en) | Application of SlGATA22 gene in improving cold resistance and disease resistance of tomato plants | |
| CN112680505A (en) | Functional marker development method based on wheat potassium transport protein gene | |
| CN110453007A (en) | It is a kind of for the SSR primer sets of red clover analysis of genetic diversity and its application | |
| CN114591984B (en) | Application of OsAP79 gene in inducing rice to resist brown planthoppers | |
| CN113981103B (en) | Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellite, detection kit and identification method | |
| CN110331223A (en) | It is a kind of for identifying molecular labeling, primer pair, kit and the method for different wild rice stem types | |
| CN109913480B (en) | Locust uridine diphosphate glucuronosyltransferase gene and application thereof | |
| CN108707554B (en) | Composition of a pair of maize smut bacteria and application thereof | |
| CN108641967B (en) | Maize smut haploid strain UM02 and application thereof | |
| CN101696420B (en) | Method for improving resistance to wheat sharp eyespot | |
| CN108690811B (en) | Maize smut haploid strain UM01 and application thereof | |
| Praveen et al. | Molecular characterization and phenotypic study of new Pleurotus djamor isolate KKM |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210420 |