CN104745586B

CN104745586B - Cocaine aptamer, detection kit and application thereof

Info

Publication number: CN104745586B
Application number: CN201310743132.9A
Authority: CN
Inventors: 曾立波; 张玉荣; 陈连康; 胡小龙
Original assignee: SHANGHAI INSTITUTE OF CRIMINAL SCIENCE AND TECHNOLOGY
Current assignee: SHANGHAI INSTITUTE OF CRIMINAL SCIENCE AND TECHNOLOGY
Priority date: 2013-12-27
Filing date: 2013-12-27
Publication date: 2020-02-04
Anticipated expiration: 2033-12-27
Also published as: CN104745586A

Abstract

The invention provides a cocaine aptamer, a detection kit and application thereof. Specifically, the inventors successfully screened aptamers with high affinity and specificity to cocaine based on ssDNA libraries of specific structures by SELEX technology. The aptamer can be applied to on-site rapid and sensitive detection of cocaine.

Description

Cocaine aptamer, detection kit and application thereof

Technical Field

The invention relates to the technical field of biology and criminal identification. In particular, the invention relates to a cocaine aptamer, a detection kit and application thereof, in particular to application in poison detection.

Background

The extensive abuse of cocaine has become one of the most serious social problems endangering human beings, which is one of the most extensive drugs of abuse today, and the excitement effect on the central nervous system of the human body is an important reason for the abuse. Small doses of cocaine can slow heart rate; after the dosage is increased, the heart rate is increased, the breath is fast, and the phenomena of vomit, tremor, spasm, convulsion and the like can occur. Cocaine poses a great threat to the human body and poses a great threat to peace, stability and human safety worldwide. Therefore, the research on the novel and sensitive cocaine checking method has very important research and practical significance and application value for drug abstinence, drug rehabilitation, poison detection, criminal identification, evidence collection and the like.

The traditional cocaine detection methods reported at present include a chemical analysis method, a high-efficiency capillary electrophoresis method, a nuclear magnetic resonance spectrometry, an electrochemiluminescence method, a colorimetric method and the like. The conventional detection method has the disadvantages of being not sensitive enough, complex in operation, time-consuming and the like, so that the requirements of research analysis and clinical detection cannot be met frequently.

In recent years, the method for rapidly detecting drugs on site is based on monoclonal antibodies, and has good effect. However, the detection of monoclonal antibodies still has certain limitations:

first, monoclonal antibodies are derived from animals, and thus, certain limitations arise in the preparation of monoclonal antibodies; for example, some drugs, poisons are intolerable to animals, and some small molecules with poor immunity bring difficulties to the preparation of monoclonal antibodies.

Secondly, the preparation of hybridomas is limited to mice and rabbits, which greatly limits the application of antibodies. Antibodies from different sources are used in the assay and non-specific binding may occur resulting in false positive results.

Thirdly, the preparation of monoclonal antibodies is carried out with a large amount of work, and a large amount of clones need to be screened for some rare antibodies, which is expensive.

Fourth, the antibody preparation has self-defects, and the cell strain must be stored in a frozen state, and if the cell strain is not stored in the frozen state, accidental cell death is easy to happen.

Fifth, monoclonal antibodies are typically amplified by injecting hybridoma cells into the abdominal cavity of a mouse to produce ascites fluid, and purifying the antibodies from the ascites fluid. However, some hybridoma cells have difficulty producing ascites fluid, limiting antibody production.

Sixthly, the antibodies produced in each batch have different performances, and the new antibodies in each batch of the immunodetection reagent need to be debugged again.

Seventh, antibody recognition is performed under physiological conditions, and the kinetic parameters of antibody binding to antigen cannot be changed as required.

In conclusion, there is no satisfactory method for detecting cocaine with high sensitivity and applicability to on-site detection, so there is an urgent need to develop a detection technique for cocaine with the advantages of sensitivity, rapidness, reliability, and good specificity.

Disclosure of Invention

The invention aims to provide a cocaine technology with the advantages of sensitivity, rapidness, reliability, good specificity and the like.

In a first aspect of the invention, there is provided a nucleic acid aptamer that specifically binds to cocaine.

In another preferred embodiment, the specific binding refers to the binding of the aptamer to cocaine but not to any of the following: methamphetamine, amphetamine, MDMA, MDA, morphine, codeine, heroin, ferlcodine, monoacetylmorphine, dihydrocodeine, dihydroetorphine, ramitinin, meperidine, fentanyl, tramadol, dextropropoxyphene, naloxone, naltrexone, nalorphine, clonidine, rofecoxitin, scopolamine, yian oral liquid, nortonine, paracetamol, aspirin, ibuprofen, amitriptyline, imipramine, chlorpromazine, promethazine, chloral hydrate, diazepam, triazolam, alprazol, phenobarbital, tacrolimus, amobarbital, caffeine, norfloxacin, pionee IV, berberine, lactose, procaine, kangfuxin capsule, chloral hydrate, olfloxacin, phenacetin, desquamate, ketamine, methadone, methacetin, dextroephedrine, levoephedrine, ephedrine, thebaikaline, naltretin, dextromethorphan, hydramine, doxycycline, dextromethorphan, heroin, palmitin, dextromethorphan, naltretinone, naldehyde, naltretinoin, nal, Tetrahydrocannabinol, lidocaine, narcotine, buprenorphine, phenylpropanolamine and phenethylamine.

In another preferred embodiment, the aptamer is a single-stranded nucleic acid molecule screened from a ssDNA library by SELEX technology.

In another preferred embodiment, the aptamer comprises a DNA, RNA, or DNA/RNA hybrid molecule.

In another preferred embodiment, the aptamer has a length of 30-100 bases.

In another preferred embodiment, the aptamer is single-stranded or double-stranded.

In another preferred embodiment, the aptamer is provided with a detectable label.

In another preferred embodiment, the aptamer is isolated or purified.

In another preferred embodiment, the purity of the aptamer is greater than or equal to 90%, preferably greater than or equal to 95%, and more preferably greater than or equal to 99%.

In another preferred embodiment, the sequence of the aptamer is shown in SEQ ID NO. 1, 2, 3 or 4.

In a second aspect of the present invention, there is provided a conjugate comprising a nucleic acid aptamer according to the first aspect of the present invention and a detectable label linked to the nucleic acid aptamer.

In another preferred embodiment, the detectable label comprises biotin, a chemiluminescent group, a fluorescent protein, an enzyme, colloidal gold, a radioisotope, a latex particle, an antibody, a ligand, an antigen, a receptor, or a combination thereof.

In a third aspect of the present invention, there is provided a complex of (a) the nucleic acid aptamer of the first aspect of the present invention or the conjugate of the second aspect of the present invention and (b) cocaine.

In a fourth aspect of the present invention, there is provided a detection article comprising a nucleic acid aptamer according to the first aspect of the present invention or a conjugate according to the second aspect of the present invention.

In another preferred embodiment, the detection article comprises: detection reagent, lateral flow sheet, chip, test strip and detection plate.

In another preferred embodiment, the detection article is used for detecting cocaine.

In a fifth aspect of the present invention, there is provided a detection kit comprising a nucleic acid aptamer according to the first aspect of the present invention, a conjugate according to the second aspect of the present invention and/or a detection article according to the fourth aspect of the present invention.

In a sixth aspect of the invention there is provided the use of a nucleic acid aptamer according to the first aspect of the invention or a conjugate according to the second aspect of the invention in the manufacture of a detection article or kit for the detection of cocaine.

In a seventh aspect of the present invention, there is provided a method of detecting cocaine, comprising the steps of:

(a) providing a sample to be detected;

(b) mixing the sample with the nucleic acid aptamer according to the first aspect of the invention or the conjugate according to the second aspect of the invention to form a mixture;

(c) detecting the presence or absence of a "cocaine-nucleic acid aptamer complex" in the mixture, wherein the presence of the complex, if present, indicates the presence of cocaine in the sample; if the complex is not present, it indicates that cocaine is not present in the sample.

In another preferred embodiment, the detection comprises qualitative detection and quantitative detection.

In another preferred embodiment, step (c) comprises comparing with a standard or standard curve to determine the presence and/or amount of the complex in the mixture.

In another preferred embodiment, the method is used for drug detection, drug detection or food safety detection, and more preferably, the method is used for drug detection.

In the eighth aspect of the invention, a nucleic acid sequence is provided, wherein the nucleic acid sequence is an antisense sequence of the sequence shown in SEQ ID NO. 1-4.

In a ninth aspect of the invention, there is provided a composition comprising (i) a carrier and (ii) a nucleic acid aptamer according to the first aspect of the invention, a conjugate according to the second aspect of the invention.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows a schematic diagram of the structure of the aptamer screening library of the present invention.

FIG. 2 shows a preparation process of cocaine complete antigen.

FIG. 3 shows the pattern of 2% agarose gel electrophoresis of the PCR products from rounds 1-10. Wherein lanes are as follows: lane M: molecular weight standards at 50bp intervals; lanes 1-10 PCR products from rounds 1-10.

FIG. 4 shows two Aptamers (APT) of the invention^R) And (APT)^S) (SEQ ID NO:1 and 2) can specifically bind to cocaine.

FIG. 5 shows the structure of a chromatographic lateral flow strip (or strip) of the present invention.

FIG. 6 shows a schematic view of the detection of a chromatographic test strip in one embodiment of the present invention.

FIG. 7 shows the detection sensitivity of cocaine aptamers of the present invention (compared to a commercially available cocaine antibody detection kit).

Detailed Description

The present inventors have made extensive and intensive studies and, for the first time, have developed a nucleic acid aptamer specific for cocaine. The inventor successfully screens and obtains the aptamer with high affinity and high specificity to cocaine by adopting SELEX technology and based on a ssDNA library with a special structure. The aptamer can be applied to on-site rapid and sensitive detection of cocaine. The present invention has been completed based on this finding.

Specifically, the inventor firstly constructs a ssDNA library with a total length of 76bp in vitro, and carries out SELEX screening; and the binding affinity of each round of ssDNA library and cocaine was determined by SPR, and the aptamers were subjected to secondary structure prediction and binding site analysis by MFOLD analysis software. Through multiple experiments, the inventor obtains a library in which specific aptamers are gradually enriched. Through further sequencing, analysis and validation, the present inventors determined that there are a number of stem-loop structured nucleic acid aptamers that bind effectively to cocaine.

Experiments show that the cocaine aptamer can be specifically bound to cocaine and used for detecting cocaine, does not have any cross reaction with other medicines and drugs, and confirms that the nucleic acid aptamer has high specificity. Has great use value in the aspect of identifying different drugs and analogues. In terms of sensitivity, the results of the invention show that the detection of cocaine based on aptamer is 5 times more sensitive than the detection method of monoclonal antibody.

The aptamer is a single-stranded DNA or RNA, can resist high temperature, has a pH value which is worthy of change, has higher stability than an antibody, and is easy to store for a long time. The aptamer also has the characteristics of in vitro artificial chemical synthesis, high accuracy, good repeatability, no batch-to-batch difference and the like, and has wide prospect in the detection of drugs and toxicants.

Term(s) for

As used herein, the term "comprising" or "includes" may be open or closed, i.e., includes "consisting of … …".

SPR

SPR (Surface Plasmon Resonance) is an instrument for analyzing interactions between biomolecules using a physical optical phenomenon caused by total reflection coupling of light at a metal film/liquid Surface interface.

SELEX screening

The SELEX (Systematic Evolution of Ligands by Exponential Enrichment of Ligands System Evolution) technology refers to a new combinatorial chemistry technology developed and researched by Tuerk and Gold, et al. It applies large capacity random oligonucleotide library, combines with in vitro PCR amplification technology, enriches oligonucleotides combined with target molecule specificity by exponential order, and obtains oligonucleotide aptamer (aptamer) with high affinity and strong specificity through multiple rounds of screening.

SELEX screening has the advantages of large library capacity, wide target molecule range, etc.

In the invention, based on a ssDNA library specially constructed by the inventor, a plurality of aptamers specific to cocaine are successfully obtained through SELEX technology and multiple times and rounds of screening.

In the ssDNA library used in the present invention, the total length of ssDNA is 76bp, and the middle is a random nucleotide sequence of 40bp, which is randomly combined by A, G, C, T codons. Thus, in theory, 440 sequence combinations, i.e., 1015 theoretical library capacities, could be provided, and thus the requirement for aptamer selection could be well met.

In a preferred embodiment of the present invention, the SELEX screening method comprises the steps of:

establishment of DNA aptamer library

The first step is to chemically synthesize a pool of aptamers with random sequences, typically 40 base pairs of random single-stranded nucleotide sequences, including PCR primer sequences at both ends, such a pool of aptamers will contain 10¹⁴-10¹⁵There are different possible sequences.

2. Screening method for establishing specific DNA aptamer

The method of binding the DNA aptamer to the target molecule may be selected from: 1) affinity chromatography column methods; 2) nanoparticle coupling; 3) nitrocellulose membrane bonding methods, or combinations thereof.

One screening was performed with 2nmol RND40 single stranded DNA in 50. mu.l reaction buffer 94^℃Denaturation for 10min, 20. mu.l of small antigen, 37^℃Incubate for 30min, remove unbound DNA by centrifugation at 13000rpm15 min, and wash twice with 250. mu.l reaction buffer. The final single-stranded DNA and antigen complex was dissolved in 50. mu.l of water for the next round of screening.

Separation of DNA aptamers from bound target molecules

In the present invention, suitable separation techniques include (but are not limited to): capillary electrophoresis combined with liquid phase separation, magnetic bead separation technology, chromatographic separation technology, centrifugal separation technology and the like are used.

4. Multi-cycle amplification screening

And carrying out Polymerase Chain Reaction (PCR) amplification on the screened DNA aptamer sequence to generate a secondary library for next screening, and after several rounds of repeated in-vitro screening and amplification, carrying out monoclonal and sequencing on the library which achieves high affinity, thereby obtaining the aptamer for specifically recognizing the target molecule.

Mu.l of the complex was amplified by PCR for 10 cycles in a total volume of 100. mu.l with magnesium ion 2.5mM MgCl2, and primers F3(5'GCG GAT GAA GAC TGG TGT3') (SEQ ID NO.:6), R3(5'GTT GCT CGT ATT TAGGGC3') (SEQ ID NO.: 7).

The PCR product was precipitated with ethanol and single stranded DNA and protein were separated during the first step of PCR denaturation at 95 ℃. To obtain high affinity aptamers, the stringency of the SELEX screen was increased by reducing the amount of duplex DNA from 0.5nmol to 0.25nmol in the second, three rounds of screening.

The entire screening step may generally include 10 or more rounds of screening under the same conditions, thereby screening for aptamers of high specificity and high affinity.

Aptamers

As used herein, "aptamer," "aptamer," and "aptamer" are used interchangeably to refer to a nucleic acid sequence capable of binding to a particular target molecule (e.g., cocaine), including DNA aptamers, RNA aptamers, aptamers of a hybrid type, or other types of aptamers. In addition, in the present invention, aptamers also include single-stranded and double-stranded forms, particularly single-stranded forms of aptamers.

As used herein, "nucleic acid aptamer" and "oligonucleotide aptamer" may be used interchangeably. The aptamer is a kind of oligonucleotide molecules obtained by SELEX screening, and can be combined with target molecules with strong specificity and high affinity. Typically, a nucleic acid aptamer is a small (typically about 40-100 base pairs) synthetic oligonucleotide.

As used herein, the terms "aptamer of the invention", "nucleic acid aptamer of the invention" are used interchangeably and refer to a nucleic acid aptamer capable of binding specifically and with high affinity to cocaine.

In the present invention, a preferred class of aptamers are those obtained by SELEX screening, having the sequence shown in SEQ ID NO. 1-5.

The aptamer of the invention has small molecular mass and low immunogenicity, and can be chemically synthesized, modified and labeled.

As used herein, the term "specific" refers to aptamers of the invention that bind to cocaine, preferably those that bind to cocaine but do not recognize and bind to other poisons.

The aptamer of the present invention can be prepared by a conventional method such as artificial total synthesis or PCR method.

The Aptamer (Aptamer) of the invention is a short single-stranded oligonucleotide sequence, namely single-stranded dna (ssdna) or RNA, that can be folded into a three-dimensional structure and that binds to a target molecule by spatial conformation complementation.

In addition, the aptamer can be synthesized in vitro by artificial chemistry, and has the advantages of high accuracy, good repeatability, no batch difference, reversible denaturation and renaturation, good stability, easy long-term storage and the like.

In addition, in the present invention, multifunctional molecules or detectable markers can also be accurately and efficiently linked to aptamer specific sites, thereby making aptamers more suitable for detection of target molecules.

Research shows that the molecular recognition function between the aptamer and the target molecule is very similar to that of an antibody, but the aptamer has extremely high specificity and affinity to the target molecule (cocaine) and is easy to functionally modify, so that the aptamer is very suitable for preparing sensitive, rapid and reliable field detection preparations and test pieces.

The aptamer is screened from a random sequence library, and has wide applicability and high efficiency.

The invention also provides a sensor based on the high-affinity and specific aptamer. Colloidal Gold Nanoparticles (GNPs) have unique electronic, optoelectronic and catalytic characteristics, making their use quite attractive. In previous studies, nucleic acid aptamer biosensors were developed using colloidal gold, which is generally used as an important chromogenic substance because colloidal gold particles have a strong visible color characteristic.

In the present invention, the target molecule (cocaine) can be detected by the principle that a colloidal gold-crosslinked nucleic acid aptamer hybridizes to a complementary sequence.

Detection article

The invention also provides a detection article useful for detecting cocaine.

In the present invention, representative detection articles include (but are not limited to): detection reagent, lateral flow sheet, chip, test strip and detection plate.

In the present invention, the form of the detection reagent is not particularly limited, and may be a solid or liquid, or may be in the form of microspheres, colloids, or the like.

One particularly useful class of detection reagents are conjugates of the aptamers of the invention with a detectable label.

In the present invention, the kind of detectable label is not particularly limited, and representative detectable labels include (but are not limited to): biotin, chemiluminescent groups, fluorescent proteins, enzymes, colloidal gold, radioisotopes, latex particles, antibodies, ligands, antigens, receptors, or combinations thereof.

In another preferred embodiment, the enzyme comprises horseradish peroxidase, alkaline phosphatase, or a combination thereof.

In another preferred embodiment, the chemiluminescent group comprises Eva Green, rhodamine, FITC, TRITC, or a combination thereof.

In another preferred embodiment, the radioisotope comprises³²P、¹²⁵I、³⁶S and the like.

In another preferred embodiment, the chemiluminescent group comprises luminol and the like.

One particularly preferred class of detection articles in the present invention are nucleic acid chips. On the nucleic acid chip, a plurality of probes are usually specified, wherein the chip comprises the aptamer specific to cocaine, and the existence and the content of cocaine in a sample can be detected by utilizing the principle that the aptamer and cocaine can form an aptamer-cocaine binary complex.

A preferred cocaine detection chip comprises a solid phase carrier and oligonucleotides orderly fixed on the solid phase carrier, wherein the sequence of the oligonucleotides is shown as SEQ ID NO 1-4. The solid phase carrier is not particularly limited, and various materials commonly used in the field of gene chips can be used, and representative solid phase carriers include, but are not limited to: nylon membrane, glass or silicon slice modified by active group (such as aldehyde group, amino group, etc.), unmodified glass slice, plastic slice, etc.

Chromatographic lateral flow sheet

One preferred assay product that facilitates rapid in-situ detection is a chromatographic lateral flow strip prepared using the aptamers of the invention.

In the present invention, a preferred detection reagent is a chromatographic lateral flow sheet (plate) or a chromatographic test strip using the lateral flow principle.

The structure of a chromatographic lateral flow sheet (or test strip) of the present invention is shown in fig. 5, which comprises: 1 sample pad, 2 aptamer release pad, 3 test line, 4 reaction membrane, 5 control line, 6 absorbent pad, and 7 backing.

In the present invention, each constituent element (or assembly) of the side flow sheet may be made of a material known in the art.

In order to facilitate understanding of the present invention, the detection principle of the chromatographic lateral flow sheet of the present invention is given. It is to be understood that the scope of the invention is not affected or limited by this principle.

If cocaine is contained in the sample to be tested, cocaine will combine with the aptamer of the invention to form an aptamer-cocaine complex, and the complex flows forwards along the nitrocellulose membrane together, and when reaching the position of the detection line, the complex is captured by the capture agent immobilized on the membrane (for example, the aptamer can be provided with a biotin marker, and the detection line is provided with avidin), and a colored strip is formed, so that the strip is positive, and the strip is negative. In addition, a control line (or quality control line) is used to indicate that the detection system is working properly.

Of course, other means may be employed to detect the presence, absence and/or amount of the aptamer-cocaine complex.

The detection plate has simple structure, portability, easy carrying, field detection and no need of expensive equipment. The detection plate of the invention is used for detecting cocaine, the whole test can be completed within 3-5 minutes, the detection sensitivity can reach about 5-10ng (such as 5ng/ml), and no cross reaction is caused with other common medicines and drugs.

During detection, the detection plate can be horizontally placed, a sample is dropped on the sample filtering paper, a proper amount of sample (usually about 120 mu l) is added, and the chromatography result is observed within 3-5 min. The result is judged according to the position of the appearing stripe,

negative: the quality control area and the detection area both have obvious colored bands and are shown as negative;

positive: a clear color band appears only in the quality control area, and no color band appears in the detection area, which is shown as positive;

and (4) invalidation: the quality control area and the detection area have no color band or no color band appears in the quality control area and a color band appears in the detection area, which indicates that the detection method is wrong or the detection plate is deteriorated or invalid, and the detection plate is required to be replaced for detection.

If the detection line is shallower than the quality control line, the result shows that the tested person has taken the drug but has metabolized to the end or has a smaller dosage, so the quality control line is also the standard for judging drug taking condition of the detection plate.

Detection kit

The invention also provides a detection kit for detecting cocaine.

In the present invention, the detection kit may contain the aptamer, conjugate, complex (as a control), detection reagent, and/or detection chip of the present invention.

The kit can be used for detecting the aptamer-cocaine complex of the invention, and thus can be used for detecting small molecular poisons such as cocaine.

In addition, the kit may also include optional other reagents for detection, such as various reagents required for color development and the like, including but not limited to: enzyme, contrast solution, color developing solution, etc.

The kit may also include instructions for use. Preferably, information such as standard curves can be included in the specification.

The main advantages of the invention include:

1. the sensitivity is high, reaches nanogram level and is 5 times higher than that of a detection method of a monoclonal antibody.

2. The specificity is strong, and cross experiments are carried out on more than 40 common drugs and medicines in a certain concentration range in a specificity test, so that the test result has no cross reaction.

3. Simple and rapid, and the one-time scanning detection time is only 3-5 minutes.

4. The quality is stable and reliable, and the effective period of the product is as long as two years or more.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the laboratory Manual (New York: Cold Spring harbor laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.

General experimental methods:

materials and instruments

1 Material

In vitro design and synthesis of a 76bp random ssDNA library: 5'-GCG GAT GAA GAC TGG TCT-N40-GCCCTA AAT ACG AGC AAC-3' (SEQ ID NO: 5),

an upstream primer F: 5'-FAM-GCGGATGAAGACTGGTCT-3' (SEQ ID NO: 6),

a downstream primer R: 5'-Biotin-GTTGCTCGTATTTAGGGC-3' (SEQ ID NO: 7).

Wherein N40 represents a random sequence.

The library and the primers are synthesized by Shanghai Yingjun biotechnology limited; gel purification kit, streptavidin magnetic beads, cyanogen bromide activated agarose, N-hydroxysuccinimide (NHS), N-ethyl-N- (dimethylaminopropyl) carbodiimide (EDC) used in the reagent were purchased from Sigma; 2 × PCR mix purchased from Tiangen; cocaine complete antigen was purchased from hangzhou rongyi biotechnology, ltd.

2 apparatus

PCR Apparatus (AB), fully automated gel imaging analyzer (Syngene), electrophoresis apparatus (Tanon), incubator (ShelLab), BI-300 type surface plasmon resonance apparatus (Biosensor Instrument).

The general method comprises the following steps:

and (3) PCR reaction: and (3) PCR reaction system: ssDNA template 23. mu.l, forward primer 1. mu.l, reverse primer 1. mu.l, 10 XPCR buffer 25. mu.l. And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 3min, 25 cycles of denaturation at 95 ℃ for 30s, renaturation at 55 ℃ for 30s, extension at 72 ℃ for 30s, and final extension at 72 ℃ for 3 min.

Example 1

Preparation of cocaine complete antigen:

the procedure shown in FIG. 2 was followed, using commercially available reagents, to synthesize a cocaine complete antigen conjugated to BSA.

Example 2

SELEX screening

2.1 creation of DNA aptamer libraries

By selecting a random single-stranded nucleotide sequence of 40 base pairs, including PCR primer sequences at both ends, such an aptamer library would contain 1014-1015 different possible sequences. The random aptamer library designed in the invention comprises: (1) the middle 40 nucleotide random sequence (RND40) and the 18 nucleotide primers at the two ends of (2) have the structures shown in figure 1 and SEQ ID NO. 5:

5-GCGGATGAAGACTGGTCT-40N-GCCCTAAATACGAGCAAC-3'(SEQ ID NO.:5)。

2.2, a screening method:

affinity chromatography column method is used to screen for nucleic acid aptamers that bind to cocaine.

2.3 cloning and sequencing of aptamers

In a multi-cycle amplification screen, PCR amplification is performed for each round, and the final PCR product is cloned and DNA sequenced.

The PCR product was electrophoresed on a 2% agarose gel to reveal a clear 76bp band, and the DNA fragment was recovered from the agarose gel and ligated and cloned using a commercially available TA clone kit.

Selecting clone growing on ampicillin culture medium, amplifying in LB culture medium, extracting plasmid DNA, and making DNA sequence determination of purified plasmid.

2.4 results

The PCR amplification results for each round of screening are shown in figure 3.

Through multiple rounds of screening, a plurality of aptamers capable of being specifically combined with cocaine are obtained through screening, and the sequencing results are as follows:

AGTTGAATAGGGTTGGAGAAAGGACGTGGTATGATTATGT(SEQ ID NO.:1)

TTATTTAGGGTTGGAGGGTAGTTGGAGATGATCGGTGTAG(SEQ ID NO.:2)

TAATGAAGGGCAAGGGAATAGTGGACTGGGGAGGCTGCAG(SEQ ID NO.:3)

GCAGAACAGAGGGTAGGGAATTTGCGTGTGAATTGACCTT(SEQ ID NO.:4)

example 3

Synthesis and identification of specific DNA aptamers:

based on the results of DNA sequencing, cocaine DNA aptamer sequences (SEQ ID NO.:1, 2, 3 and 4) were synthesized and identified by SPR (Surface Plasmon Resonance) analysis. The method comprises the following steps:

(a) coating of gold film: 2mM Cys (mercaptoethylamine) was added dropwise to the gold membrane surface and incubated for 12 h.

(b) 15mM NHS, 75mM EDC, 1ml CM-dextran mixture was incubated on the surface of gold membrane for 3 h.

(c) Cocaine complete antigen (example 1), EA and buffer were injected, followed by different concentrations of aptamer (

concentrations

4, 6, 8, 10, 12 μ M).

(d) The binding rate of the aptamer to the complete antigen is tested.

The results are shown in FIG. 4. The results showed that all 4 aptamers of the invention (SEQ ID NO:1 to 4) were able to specifically bind to cocaine (COC). Wherein, the combination of SEQ ID NO. 3 and 4 is similar to the two aptamers APTR and APTS shown in SEQ ID NO. 1 and 2.

Example 4

Establishment of DNA aptamer probe detection drug technical platform

4.1 preparation of colloidal gold

40nm colloidal gold particles were prepared by reducing chloroauric acid (HAuC14) with trisodium citrate. HAuC14 is prepared into 0.01% aqueous solution, 100mL is heated to boil, 1.0mL of 1% trisodium citrate aqueous solution is added accurately under stirring, and heating and boiling are continued for 15 min. At this point, a pale yellow aqueous solution of chloroauric acid was observed to turn gray rapidly after the addition of sodium citrate, to turn black and then gradually stabilize to red. After cooling to room temperature, the volume was returned to the original volume with distilled water.

4.2. Preparation of colloidal gold COC-BSA conjugate complexes

Preparation of colloidal gold-labeled cocaine complete antigen (COC-BSA): taking 100.0mL of prepared colloidal gold and using 0.1mol/L K₂CO₃Adjusting the pH value of the colloidal gold solution to 9.0, rapidly adding 1.0-2.0 mg of cocaine-BSA under magnetic rapid stirring, stirring for 10min, adding 1.0mL of 10% bovine serum albumin, and continuing to stir for 10 min. Centrifuging at 12000rpm/min at 4 deg.C for 30min, and removing supernatant to obtain precipitate as colloidal gold COC-BSA conjugate. Diluting with 0.01mol/L pH8.2Tris-HCl buffer solution to a certain concentration, soaking on glass fiber membrane, and drying at 37 deg.C.

4.3 preparation of chromatographic test strips

The sample pad membrane, glass fiber (solid phase colloidal gold COC-BSA conjugate), nitrocellulose membrane and sample pad were sequentially attached to a PVC support material. Respectively scribing a detection line and a quality control line on a nitrocellulose membrane by using a film spotting machine, wherein the detection line is cocaine aptamer (SEQ ID NO. 1, 2, 3 or 4, 0.8mg/mL), the quality control line (C line) is mouse anti-BSA monoclonal antibody (1.0mg/mL), and the detection line is sealed for 2 hours by using 1% OVA (ovalbumin) 0.01mol/L PBS (phosphate buffer solution) after being dried; washed 3 times with 0.01mol/L PBS, dried under vacuum and cut into test strips of 0.4cm by 6.0 cm.

4.4 Assembly of the kit

And (3) placing the immunochromatographic test strip in a plastic box, aligning a sample adding hole to the position of a test strip sample pad, compacting, assembling into a cocaine test kit, adding a drying agent, and sealing for storage.

4.5 detection principle of detection box

As shown in FIG. 6, the present embodiment mainly employs aptamer and laminar flow detection techniques. Namely, cocaine in the urine sample and colloidal gold labeled (COC-BSA) are competitively combined with cocaine aptamer immobilized on the nitrocellulose membrane, and the detection result is judged by the condition that no purple red band is arranged at the detection zone (T) of the observation window. Colloidal gold labeled (COC-BSA) binds to the control region anti-BSA antibody to form a C-line regardless of the presence or absence of the cocaine component in the sample.

4.6 determination of the results

The kit was removed from the sealed bag, 3 drops of the sample (about 120. mu.l of urine, saliva, blood, etc.) were dropped vertically into the well using a plastic pipette, and the test results were read over a period of 5 minutes (see FIG. 6).

Positive (+): only one purple-red band appears in the quality control area (C), and no purple-red band appears in the detection area T, which indicates that cocaine is positive. The positive result shows that: the cocaine concentration in the sample was above the detection threshold.

Negative (-): if a purple-red band appears in the quality control area (C) and a purple-red band appears only in the detection area 'T', the cocaine is negative. Negative results indicate that: cocaine concentrations were all below the detection threshold. The magenta band in the detection region (T) can show a phenomenon of light color, and a negative result should be judged regardless of the light color of the band during a predetermined observation time. Negative results indicate that: cocaine concentrations were all below the detection threshold.

And (4) invalidation: the quality control area (C) of the design has two purposes, namely whether a sample contains a drug component or not, the colloidal gold marked (COC-BSA) can be always combined with the mouse anti-BSA antibody which is immobilized on the nitrocellulose membrane of the quality control area (C) to form a purple-red strip at the position of the quality control area (C), and the strip is an indicator line for the positive or negative of the sample. And the second is the standard for indicating whether the detection process is normal or not and whether the kit is deteriorated or not. If the color band does not appear in the quality control area (C), no matter whether the color band appears in the T line position or not, the detection result is invalid, and the kit is replaced for detection.

Example 5

Specificity of nucleic acid aptamers

The selected cross-reacting substances are methamphetamine, amphetamine, MDMA, MDA, morphine, codeine, heroin, Folcodine, monoacetylmorphine, dihydrocodeine, dihydroetorphine, ramitinin, pethidine, fentanyl, tramadol, dextropropoxyphene, naloxone, naltrexone, nalorphine, clonine, lofexidine, scopolamine, Yian oral liquid, benoxine tablet, paracetamol, aspirin, ibuprofen, amitriptyline, imipramine, chlorpromazine, promethazine, chloral hydrate, diazepam, triazolam, alprazol, phenobarbital, tolperish, amobarbital, caffeine, norfloxacin, pionee IV, berberine, lactose, procaine, synxican capsule, chloral hydrate, oxepin, phenacetin, norgestimate, ketamine, methadone, methamphetamine, levoephedrine, levofloxacin, and chlorpheniramine, Dextro-ephedrine, thebaine, tetrahydrocannabinol, lidocaine, narcotine, buprenorphine, phenylpropanolamine and phenylethylamine, which are 64 kinds of medicines and drugs.

The above-mentioned detection substance was prepared into a solution of a certain concentration, and the detection was carried out using the kit described in example 4.

The results show that: the aptamer detection reagents (SEQ ID NO.: 1-4) only react with cocaine, and have no cross reaction with other substances, and the cocaine aptamer detection kit has strong specificity, accuracy and reliability.

Example 6

Sensitivity of nucleic acid aptamers

And (3) testing the sensitivity: cocaine is added into a blank urine sample, and a series of solutions with gradient concentration (1.0-2000.0 ng/mL) are prepared respectively to test the cocaine kit.

As a result, as shown in FIG. 7, the lowest detection sensitivity of cocaine was 10.0ng/mL or less for each of the aptamers of the present invention. Compared with an immunoassay kit of a colloidal gold labeled cocaine monoclonal antibody, the sensitivity of the immunoassay kit is 5 times higher.

Example 7

Determination of detection threshold

In order to distinguish between the normal dose and the drug-taking dose, the detection threshold of cocaine was adjusted to 300.0ng/mL by adjusting the amount of COC-BSA labeled on the test strip.

Example 8

Accuracy of aptamer detection

The results of comparing the nucleic acid aptamer cocaine kit described in example 4 with the results of GC-MS detection are shown in Table 1. The result shows that the accuracy of the kit reaches 100%.

TABLE 1 test accuracy

Example 9

Stability of the detection kit

The cocaine detection kit marked by the colloidal gold is sealed and then is placed in an oven for destructive test at the temperature of 45 ℃ for one month, and then the cocaine and a negative sample of 300.0ng/mL are used for testing, and the detection result is consistent with that of the unbaked kit. The aptamer cocaine detection kit is proved to have good stability.

The test results show that the invention establishes a screening platform for screening the DNA aptamer with specificity for identifying drugs and toxic small molecules for the first time, and successfully develops the aptamer with very high specificity and affinity to cocaine. The aptamer does not have any cross reaction with other medicines and drugs, and the high specificity of the aptamer is proved. The aptamer and the detection kit provided by the invention have 5 times higher sensitivity than the detection of the monoclonal antibody, and in addition, the invention has obvious technical advantages in the aspects of specificity, stability, rapid detection, field detection and the like.

The invention has the characteristics of good repeatability, no batch-to-batch difference and the like, thereby having wide prospect in the detection of drugs and poisons.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Claims

1. A nucleic acid aptamer, wherein said aptamer specifically binds to cocaine;

and, said specific binding means that said aptamer binds to cocaine but not to any of the following: methamphetamine, amphetamine, MDMA, MDA, morphine, codeine, heroin, ferlcodine, monoacetylmorphine, dihydrocodeine, dihydroetorphine, ramitinin, meperidine, fentanyl, tramadol, dextropropoxyphene, naloxone, naltrexone, nalorphine, clonidine, rofecoxitin, scopolamine, yian oral liquid, nortonine, paracetamol, aspirin, ibuprofen, amitriptyline, imipramine, chlorpromazine, promethazine, chloral hydrate, diazepam, triazolam, alprazol, phenobarbital, tacrolimus, amobarbital, caffeine, norfloxacin, pionee IV, berberine, lactose, procaine, kangfuxin capsule, chloral hydrate, olfloxacin, phenacetin, desquamate, ketamine, methadone, methacetin, dextroephedrine, levoephedrine, ephedrine, thebaikaline, naltretin, dextromethorphan, hydramine, doxycycline, dextromethorphan, heroin, palmitin, dextromethorphan, naltretinone, naldehyde, naltretinoin, nal, Tetrahydrocannabinol, lidocaine, narcotine, buprenorphine, phenylpropanolamine and phenethylamine,

the sequence of the aptamer is shown in SEQ ID No. 1, 2, 3 or 4.

2. The nucleic acid aptamer of claim 1, wherein the aptamer is provided with a detectable label.

3. The nucleic acid aptamer of claim 1, wherein the aptamer is isolated or purified.

4. A conjugate comprising the nucleic acid aptamer of claim 1 and a detectable label linked to the nucleic acid aptamer.

5. The conjugate of claim 4, wherein the detectable label comprises biotin, a chemiluminescent group, a fluorescent protein, an enzyme, colloidal gold, a radioisotope, a latex particle, an antibody, a ligand, an antigen, a receptor, or a combination thereof.

6. A complex of (a) the nucleic acid aptamer of claim 1 or the conjugate of claim 4 and (b) cocaine.

7. A detection product comprising the nucleic acid aptamer of claim 1 or the conjugate of claim 4.

8. The detection article of claim 7, wherein the detection article comprises: detection reagent, lateral flow sheet, chip, test strip and detection plate.

9. A detection kit comprising the nucleic acid aptamer of claim 1, the conjugate of claim 4 and/or the detection article of claim 7.

10. Use of the aptamer of claim 1 or the conjugate of claim 4 for the preparation of a detection article or kit for the detection of cocaine.

11. The use of claim 10, wherein the detection article comprises: detection reagent, lateral flow sheet, chip, test strip and detection plate.

12. A method of detecting cocaine comprising the steps of:

(a) providing a sample to be detected;

(b) mixing the sample with the nucleic acid aptamer of claim 1 or the conjugate of claim 4 to form a mixture;

13. The method of claim 12, wherein said detecting comprises qualitative detection and quantitative detection.

14. The method of claim 12, wherein in step (c) comprises comparing to a standard or standard curve to determine the presence and/or amount of the complex in the mixture.

15. The method of claim 12, wherein the method is used for drug testing, or food safety testing.

16. A nucleic acid sequence, which is an antisense sequence of a sequence shown in SEQ ID NO. 1-4.

17. A composition comprising (i) a carrier and (ii) the nucleic acid aptamer of claim 1, the conjugate of claim 4.