CN104745586A - Cocaine aptamer, detection kit and application thereof - Google Patents
Cocaine aptamer, detection kit and application thereof Download PDFInfo
- Publication number
- CN104745586A CN104745586A CN201310743132.9A CN201310743132A CN104745586A CN 104745586 A CN104745586 A CN 104745586A CN 201310743132 A CN201310743132 A CN 201310743132A CN 104745586 A CN104745586 A CN 104745586A
- Authority
- CN
- China
- Prior art keywords
- cocaine
- aptamer
- detection
- present
- mixture
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention provides a cocaine aptamer, a detection kit and application thereof. In particular, based on a special structure ssDNA library, the inventor uses the SELEX (systematic evolution of ligands by exponential enrichment) technology and successfully screens the aptamer with high affinity and specificity on cocaine. The aptamer provided by the invention is suitable for on-site rapid and sensitive detection of cocaine.
Description
Technical field
The present invention relates to biological technical field and criminal identification technical field.Particularly, the present invention relates to Cocaine aptamer, detection kit and application thereof, the application especially in detecting at poisonous substance.
Background technology
The extensive abuse of Cocaine has become one of the most serious social concern of harm humans, and it is the most a kind of in current Drug abuse, and its excitation produced the central nervous system of human body is the major reason causing abusing.Low dose of Cocaine can make the rhythm of the heart slow; Dosage after increasing then the rhythm of the heart speed, be short of breath, can occur vomitting, tremble, the phenomenon such as spasm, convulsions.Cocaine has very large threat to human body, constitutes grave danger to the peace in the whole world, stable and human security.Therefore, study novel, sensitive Cocaine inspection method for the prohibition of drug, drug rehabilitation, poisonous substance detection, criminal identification and evidence obtaining etc., there is very important research and practice meaning and using value.
The traditional Cocaine detection method reported at present has: chemical analysis, high performance capillary electrophoresis, nuclear magnetic resonance spectrometry, Electrochemiluminescince, colorimetry etc.And traditional detection method also exists and such as detects sensitive not, complicated operation and the shortcoming such as consuming time, the requirement researched and analysed with clinical detection thus usually can not be met.
In recent years, the method for field quick detection drugs is based on monoclonal antibody, achieves good effect.But the detection of monoclonal antibody still has some limitations:
One, monoclonal antibody derives from animal, therefore, there will be some restriction when preparing monoclonal antibody; As, the toxicity of some drugs, poisonous substance is that animal cannot be stood, and also has the very poor small molecules of some immunity all can bring difficulty to preparing monoclonal antibody.
Two, the preparation of hybridoma is only limitted to large mouse and rabbit, greatly limit the application of antibody.The antibody of different sources is applied to detection, non-specific combination may occur and produce false positive results.
Three, the preparation work amount of monoclonal antibody is comparatively large, and the antibody rare to some needs to screen a large amount of clones, and cost costly.
Four, antibody prepares the defect having self, the necessary cold storage of cell strain, the necrocytosis that very easily meets accident as bad in cold storage.
Five, amplification monoclonal antibody produces ascites, antibody purification from ascites by being expelled in mouse peritoneal by hybridoma usually.But some hybridoma is difficult to produce ascites, limits the generation of antibody.
Six, the performance of every series-produced antibody is all different, and the every a collection of new antibodies of immunologic function test reagent all will be debugged again.
Seven, antibody recognition is all carry out in physiological conditions, and the binding kinetics parameter of antibody and antigen cannot change as required.
To sum up, this area still lacks the detection method of the Cocaine of gratifying highly sensitive, applicable Site Detection, therefore in the urgent need to developing the detection technique of the Cocaine with the advantage such as sensitive, quick, reliable, specificity is good.
Summary of the invention
The object of this invention is to provide a kind of technology of Cocaine of sensitive, quick, reliable, the advantage such as specificity is good.
In a first aspect of the present invention, provide a kind of aptamer, described fit specific binding is in Cocaine.
In another preference, described specific binding refers to describedly fitly be incorporated into Cocaine but be not incorporated into following any one material: methyl amphetamine, amphetamine, MDMA, MDA, morphine, morphine monomethyl ether, heroine, pholcodine, monoacetylmorphine, paracodin, dihydroetorphine, thunder rice is for fourth, Pethidine, fentanyl, U-26225A, Propoxyphene, naloxone, TREXUPONT, nalorphine, clonidine, Lofexidine, Scopolamine, Yi'an oral liquor, just logical peaceful sheet, Paracetamol, Asprin, Ibuprofen BP/EP, amitriptyline, imipramine, chlorpromazine, promethazine, Chloral Hydrate, stable, triazolam, alprazolam, phenylethyl barbituric acid, Somatarax, Amobarbital, caffeine, Norxin, pioneer IV, berberine, lactose, PROCAINE HCL, PHARMA GRADE, rehabilitation new capsule, Chloral Hydrate, Ofloxacin, Phenacetin, somedon, ketamine, demethyl ketamine, methadone, pethidine, racephedrine, Sanedrine, dextrorotation racephedrine, thebaine, tetrahydrocannabinol, lignocaine, Noscapine, buprenorphine, Phenylpropanolamine and phenylethylamine.
In another preference, described fit be by SELEX technology, from ssDNA library, screen the single stranded nucleic acid molecule obtained.
In another preference, described fitly comprise DNA, RNA or DNA/RNA hybrid molecule.
In another preference, described fit length is 30-100 base.
In another preference, described fit be strand or double-strand.
In another preference, described is fit with detectable.
In another preference, described fit be to be separated or purifying.
In another preference, described fit purity >=90%, preferably >=95%, more preferably >=99%.
In another preference, described fit sequence is as shown in SEQ ID NO.:1,2,3 or 4.
In a second aspect of the present invention, provide a kind of conjugate, the detectable that described conjugate comprises the aptamer described in first aspect present invention and is connected with described aptamer.
In another preference, described detectable comprises vitamin H, chemiluminescent groups, chemiluminescence group, fluorescin, enzyme, Radioactive colloidal gold, radio isotope, latex particle, antibody, part, antigen, acceptor or its combination.
In a third aspect of the present invention, provide a kind of mixture, described mixture is the mixture that the aptamer described in (a) first aspect present invention or the conjugate described in second aspect present invention are formed with (b) Cocaine.
In a fourth aspect of the present invention, provide a kind of detection goods, described detection goods contain the aptamer described in first aspect present invention or the conjugate described in second aspect present invention.
In another preference, described detection goods comprise: detection reagent, effluent sheet, chip, test strip, check-out console.
In another preference, described detection goods are for detecting Cocaine.
In a fifth aspect of the present invention, provide a kind of detection kit, described detection kit comprises the aptamer described in first aspect present invention, the conjugate described in second aspect present invention and/or the detection goods described in fourth aspect present invention.
In a sixth aspect of the present invention, provide the purposes of conjugate described in aptamer as described in the first aspect of the invention or second aspect present invention, they are used to prepare the detection goods or test kit that detect Cocaine.
In another preference, described detection goods comprise: detection reagent, effluent sheet, chip, test strip, check-out console.
In a seventh aspect of the present invention, provide a kind of method detecting Cocaine, comprise the following steps:
A () provides sample to be detected;
B this sample mixes with the aptamer described in first aspect present invention or the conjugate described in second aspect present invention by (), form mixture;
Whether c () detect the existence of " Cocaine-aptamer mixture " in described mixture, if wherein there is described mixture, then shows to there is Cocaine in described sample; If there is no described mixture, then show to there is not Cocaine in described sample.
In another preference, described detection comprises qualitative detection and detection by quantitative.
In another preference, in step (c), comprise and comparing with standard substance or typical curve, thus determine whether there is mixture in described mixture, and/or the quantity of described mixture.
In another preference, described method is used for illicit drugs inspection, drug testing or food safety detection, preferred, and described method is used for illicit drugs inspection.
In eighth aspect present invention, provide a kind of nucleotide sequence, described nucleotide sequence is the antisense sequences of sequence sequence as shown in SEQ ID NO.:1-4.
In ninth aspect present invention, provide a kind of composition, described composition contains (i) carrier and the aptamer described in (ii) first aspect present invention, conjugate described in second aspect present invention.
Should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the present invention and can combining mutually between specifically described each technical characteristic in below (eg embodiment), thus form new or preferred technical scheme.As space is limited, tiredly no longer one by one to state at this.
Accompanying drawing explanation
Fig. 1 shows the structural representation in aptamer of the present invention screening library.
Fig. 2 shows the preparation flow of Cocaine complete antigen.
Fig. 3 shows 2% agarose gel electrophoretogram that 1-10 takes turns PCR primer.Wherein each swimming lane is as follows: swimming lane M: the molecular weight standard being spaced apart 50bp; The PCR primer that swimming lane 1-10: the 1-10 takes turns.
Fig. 4 shows the present invention two kinds of aptamer (APT
r) and (APT
s) (SEQ ID NO.:1 and 2) can specific binding in Cocaine.
Fig. 5 shows the structure of a kind of chromatography effluent sheet (or test strip) of the present invention.
Fig. 6 shows the detection schematic diagram of the chromatography detection lug in one embodiment of the invention.
Fig. 7 shows the detection sensitivity (comparing with commercially available Cocaine antibody assay kit) of Cocaine aptamer of the present invention.
Embodiment
The present inventor, through extensive and deep research, develops the aptamer of specificity for Cocaine first.The present inventor adopts SELEX technology, and based on the ssDNA library of special construction, successfully screening obtains aptamer Cocaine being had to high-affinity and high specific.Cocaine is detected rapidly and sensitively in the fit scene that can be applicable to of the present invention.Complete the present invention on this basis.
Particularly, the present inventor first constructs the ssDNA library that total length is 76bp in vitro, carries out SELEX screening; And utilize SPR to measure the binding affinity of often taking turns ssDNA library and Cocaine, carry out secondary structure prediction and binding site analysis by MFOLD analysis software to fit.By test of many times, the present inventor obtains the library that SPECIFIC APTAMER obtains progressively enrichment.Through further order-checking, analysis & verification, the present inventor determine multiple have stem-ring structure, there is effective aptamer combined with Cocaine.
Test shows, Cocaine aptamer of the present invention can specific binding in Cocaine and for detecting Cocaine, there is not any cross reaction with other medicines, drugs, confirm aptamer of the present invention have height specificity.In the different drugs of discriminating and analogue, there is great use value.In sensitivity, result display of the present invention, the Cocaine based on aptamer detects and will exceed 5 times than the detection method sensitivity of monoclonal antibody.
Aptamer of the present invention itself is one section of single stranded DNA or RNA, can withstand high temperatures, and pH value must change, and has higher stability than antibody, is easy to long-term preservation.Aptamer also have can external artificial chemosynthesis, accuracy high, reproducible, without batch between the feature such as difference, have broad prospects in the context of detection of drugs, poisonous substance.
Term
As used herein, term " contains " or " comprising " can be open or enclosed, namely include " by ... form ".
SPR
SPR (surface plasma resonance, Surface Plasmon Resonance) is utilize the total reflection of metallic membrane/liquid level interface light to connect instrument that a kind of physical optics phenomenon caused carrys out analysing biomolecules interphase interaction.
SELEX screens
SELEX (Systematic Evolution of Ligands by Exponential Enrichment, index concentration Fas lignand system evolution technology) technology, refers to by a kind of new combinatorial chemistry technique of people's development researches such as Tuerk and Gold.It applies jumbo random oligonucleotide library, and the outer pcr amplification technology of combination, with the oligonucleotide of exponential enrichment and target molecule specific combination, through multi-turns screen, the oligonucleotide aptamers (aptamer) of high-affinity, high specificity can be obtained.
SELEX screening has the advantages such as storage capacity is large, target molecule scope is wide.
In the present invention, based on a ssDNA library of the special structure of the present inventor, by SELEX technology, and through repeatedly and multi-turns screen, have successfully been obtained the aptamer of multiple specificity for Cocaine.
In the ssDNA library that the present invention is used, the total length 76bp of ssDNA, centre is the random nucleotides of 40bp, by A, G, C, T codon random combine.Like this, in theory, can provide 440 combined sequence, namely theoretical library capacity is 1015, therefore can meet the demand that screening is fit well.
In a preferred embodiment of the invention, SELEX screening method comprises the following steps:
The foundation in 1.DNA is fit storehouse
The first step is the aptamer storehouse that chemosynthesis has stochastic sequence, and usually select the random single chain nucleotide sequence of 40 base pairs, comprise the PCR primer sequence at two ends, such aptamer storehouse will comprise 10 simultaneously
14-10
15plant different possible sequences.
2. set up the screening method of specific DNA aptamer
The method that DNA aptamer is combined with target molecule can be selected: 1) affinity chromatography column method; 2) nano particle coupling method; 3) nitrocellulose membrane combining method or its combination.
A kind of screening is with 2nmol RND40 single stranded DNA, in 50 μ l reaction buffers 94
dEG Csex change 10 minutes, adds 20 μ l small molecule antigens, 37
dEG Chatch 30 minutes, remove unconjugated DNA by centrifugal 13000rpm15 minute, and wash twice with 250 μ l reaction buffers.Final single stranded DNA and the mixture of antigen are dissolved in 50 μ l water, carry out next round screening.
3.DNA is fit and being separated of target molecule combined
In the present invention, the isolation technique be suitable for includes, but is not limited to: use capillary electrophoresis in conjunction with liquid phase separation, Beads enrichment technology, chromatographic separation technology and centrifugal separation technique etc.
4. multicycle amplification screening
Polymerase chain reaction (PCR) amplification is carried out to the DNA aptamer sequence screened and generates secondary library, screen for lower whorl. after number wheel in-vitro screening repeatedly, amplification, mono-clonal and order-checking are carried out to the library reaching high-affinity, thus obtains the aptamers of specific recognition target molecule.
The mixture of 1 μ l amplifies 10 circulations with PCR under 100 μ l cumulative volumes, wherein magnesium ion is 2.5mM MgCl2, primer is F3 (5'GCG GAT GAA GAC TGG TGT3') (SEQ ID NO.:6), R3 (5'GTT GCT CGT ATT TAG GGC3') (SEQ ID NO.:7).
PCR primer alcohol settling, single stranded DNA is separated in the denaturation process of the first step 95 DEG C of PCR with albumen.In order to obtain the aptamer of high-affinity, by the screening taken turns at second and third, the amount of doubly-linked DNA is down to 0.25nmol from 0.5nmol, to increase the rigor of SELEX screening.
Whole screening step usually can comprise 10 of similarity condition and take turns or more wheel screening, thus filters out the aptamer of high specific and high-affinity.
Fit
As used herein, " fit ", " aptamers ", " aptamer " and " aptamer " can exchange use, the nucleotide sequence that finger can combine with specific target molecule (as Cocaine), comprise DNA aptamer, RNA be fit, the fit or other types of hybrid type fit.In addition, in the present invention, fitly also comprise strand and double chain form, especially single stranded form is fit.
As used herein, " aptamer " and " oligonucleotide aptamers " can exchange use.Aptamer is the class oligonucleotide molecule obtained by SELEX technology screening, can with target molecule by force special, combine high-affinity.Usually, aptamer is the synthetic oligonucleotide of a kind of little (usually about 40-100 base pair).
As used herein, term " of the present invention fit ", " aptamer of the present invention " are used interchangeably, refer to can specifically with the aptamer that is combined with Cocaine of high-affinity ground.
In the present invention, a class is preferably fit to be obtained by SELEX screening, the aptamer of sequence as shown in SEQ ID NO.:1-5.
The molecular mass of aptamer of the present invention is little, immunogenicity is low, and can carry out chemosynthesis, transformation and mark.
As used herein, term " specificity " refers to and of the present inventionly fitly can be incorporated into Cocaine, preferably, refers to that those can be combined with Cocaine but nonrecognition and be incorporated into the fit of other poisonous substance.
Of the present inventionly fitly can be prepared by ordinary method, such as artificial complete synthesis or PCR method.
Aptamer of the present invention (Aptamer) is the single strand oligonucleotide acid sequence of a section short that can be folded into three-dimensional structure, be combined with target molecule by sterie configuration complementation, i.e. single stranded DNA (ssDNA) or RNA.
In addition, the present invention is fit can external artificial chemosynthesis, have accuracy high, reproducible, without batch between reversible, the good stability of difference, Denaturation and Renaturation be easy to the advantages such as long-term preservation.
In addition, in the present invention, also multi-functional molecule or detectable can be connected to aptamers specific site accurately and efficiently, thus fit being more suitable for is detected target molecule.
Research shows, fit very similar to antibody to molecular recognition function between target molecule, but the present invention is fit has high specificity and avidity to target molecule (Cocaine), and be easy to carry out functional modification, therefore be very applicable to sensitive, quick, the reliable Site Detection preparation of preparation and testing plate.
Aptamer of the present invention screens from random sequence library, has suitability and high-level efficiency widely.
Present invention also offers based on high-affinity of the present invention and the fit sensor of specific nucleic acid.Au colloidal nanoparticles (GNPs) has unique electronics, photoelectricity and catalytic characteristics, makes its application very noticeable.In research in the past, develop aptamer biosensor with Radioactive colloidal gold, Radioactive colloidal gold is commonly used to as important substance that show color, because colloid gold particle has very strong perceived color feature.
In the present invention, the aptamer be cross-linked by Radioactive colloidal gold and the principle of complementary sequence hybridization, detect target molecule (Cocaine).
Detect goods
Present invention also offers the detection goods that can be used for detecting Cocaine.
In the present invention, representational detection goods comprise (but being not limited to): detection reagent, effluent sheet, chip, test strip, check-out console.
In the present invention, the form of detection reagent is not particularly limited, and can be solid-state or liquid, also can be the form such as microballoon, colloid.
The useful especially detection reagent of one class is the fit conjugate formed with detectable of the present invention.
In the present invention, the kind of detectable is not particularly limited, and representational detectable comprises (but being not limited to): vitamin H, chemiluminescent groups, chemiluminescence group, fluorescin, enzyme, Radioactive colloidal gold, radio isotope, latex particle, antibody, part, antigen, acceptor or its combination.
In another preference, described enzyme comprises horseradish peroxidase, alkaline phosphatase or its combination.
In another preference, described chemiluminescence group comprises Eva Green, rhodamine, FITC, TRITC or its combination.
In another preference, radio isotope comprises
32p,
125i,
36s etc.
In another preference, described chemiluminescent groups comprises luminol,3-aminophthalic acid cyclic hydrazide etc.
In the present invention, the particularly preferred detection goods of a class are nucleic acid chips.On described nucleic acid chip, usually specific have multiple probe, wherein, described chip comprises the aptamer of specificity of the present invention for Cocaine, utilize the fit principle that can form " fit-Cocaine " binary complex with Cocaine of the present invention, whether and content the existence that can to detect in sample contained Cocaine.
The oligonucleotide that the chip of preferred detection Cocaine comprises solid phase carrier and is fixed in order on described solid phase carrier, the sequence shown in sequence SEQ ID NO:1-4 of described oligonucleotide.Wherein, described solid phase carrier is not particularly limited, can adopt the various common used materials in gene chip field, representational solid phase carrier includes but not limited to: nylon membrane, the slide, plastic sheet etc. of the slide modified through active group (as aldehyde radical, amino etc.) or silicon chip, unmodified.
Chromatography effluent sheet
A kind of detection goods being preferably convenient to field quick detection utilize the fit prepared chromatography effluent sheet of the present invention.
In the present invention, a kind of preferred detection reagent is the chromatography effluent sheet (plate) or the chromatograph test strip that utilize effluent principle.
The structure of a kind of chromatography effluent sheet (or test strip) of the present invention as shown in Figure 5, comprising 1 sample pad, 2 fit releases pads, 3 detection lines, 4 reaction films, 5 control lines, 6 absorption pads, and 7 backings.
In the present invention, each element (or assembly) of described effluent sheet can select the existing material in this area to make.
For the ease of understanding the present invention, provide the Cleaning Principle of chromatography effluent sheet of the present invention.Should be understood that protection scope of the present invention not by impact or the restriction of this principle.
If containing Cocaine in testing sample, then Cocaine will be combined with aptamer of the present invention and form " aptamer-Cocaine " mixture, together along nitrocellulose membrane flow forward, when arriving detection line position, the trapping agent be fixed on film is caught (such as can by fit with biotinylated derivative, and detection line is with avidin), form coloured band, be then positive, otherwise, be then negative.In addition, control line (or nature controlling line) is working properly for illustration of detection system.
Certainly, whether and/or quantity the formation that also can adopt other modes to detect " aptamer-Cocaine " mixture.
Check-out console structure of the present invention is simple, light, is easy to carry about with one, can Site Detection, and does not need expensive equipment.Use check-out console of the present invention to detect Cocaine, whole test can complete in 3-5 minute, and the sensitivity of detection can reach about 5-10ng (such as 5ng/ml), does not have cross reaction with other Common drugs, drugs.
During detection, can keep flat check-out console, dropped in by sample on filter sample paper, appropriate sample (usually about 120 μ l), observes tomographic results in 3 ~ 5min.Fringe position according to occurring carrys out judged result,
Negative: obvious colour band all appears in quality control region, detection zone, shows for feminine gender;
Positive: only to occur obvious colour band in quality control region, and in detection zone without colour band, show for the positive;
Invalid: quality control region, detection zone is without any colour band or do not occur colour band in quality control region and occur colour band in detection zone, show detection method mistake or check-out console rotten or lost efficacy, again should exchange check-out console for and detect.
If detection line be comparatively shallower than nature controlling line illustrate measured sucked these drugs but metabolism to end or consumption less, so nature controlling line is also the standard of check-out console differentiation drug abuse situation.
Detection kit
Present invention also offers the detection kit that can be used for detecting Cocaine.
In the present invention, aptamer of the present invention, conjugate, mixture (in contrast product), detection reagent and/or detection chip can be contained in detection kit.
Described test kit can be used for detecting aptamer of the present invention-Cocaine mixture, thus for detecting this micromolecular poisonous substance of Cocaine.
In addition, in described test kit, also can comprising optional other reagent for detecting, such as, for the required all ingredients such as to develop the color, including but not limited to: enzyme, contrast liquid, nitrite ion etc.
Also working instructions can be comprised in described test kit.Preferably, the information such as typical curve can be comprised in described specification sheets.
Major advantage of the present invention comprises:
1. highly sensitive, reach nanogram(ng) level, 5 times will be exceeded than the detection method sensitivity of monoclonal antibody.
2. high specificity, in specificity test, to more than the 40 kinds common drugs provided and medicine, carries out cross-over experiment, test result no cross reaction in certain concentration range.
3. fast easy, one-off scanning is only 3-5 minute detection time.
4. steady quality is reliable, and keeping life reaches 2 years or more.
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition, the people such as such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise per-cent and number are weight percent and parts by weight.
General Experimental Procedures:
Material and instrument
1 material
The ssDNA pool of external design and synthesis 76bp: 5'-GCG GAT GAA GAC TGGTCT-N40-GCC CTA AAT ACG AGC AAC-3'(SEQ ID NO.:5),
Upstream primer F:5'-FAM-GCGGATGAAGACTGGTCT-3'(SEQ ID NO.:6),
Downstream primer R:5'-Biotin-GTTGCTCGTATTTAGGGC-3'(SEQ ID NO.:7).
Wherein, N40 represents stochastic sequence.
Library and primer all have Shanghai Ying Jun Bioisystech Co., Ltd to synthesize; In reagent, gel purification kit used, Streptavidin MagneSphere, cyanogen bromide-activated agarose, N-hydroxy-succinamide (NHS), N-ethyl-N-(dimethylamino-propyl) carbodiimide (EDC) are all purchased from Sigma company; 2 × PCR mix is purchased from Yu Tiangen; Cocaine complete antigen is purchased from Hangzhou Long Ji Bioisystech Co., Ltd.
2 instruments
PCR instrument (AB), full automatic gel imaging analysis instrument (Syngene), electrophoresis apparatus (Tanon), incubator (Shel Lab), BI-300 type surface plasma body resonant vibration instrument (Biosensor Instrument).
Universal method:
PCR reacts: PCR reaction system: ssDNA template 23 μ l, upstream primer 1 μ l, downstream primer 1 μ l, 10 × PCR damping fluid 25 μ l.PCR reaction conditions: 95 DEG C of denaturation 3min, 95 DEG C of sex change 30s of 25 circulations, 55 DEG C of renaturation 30s, 72 DEG C extend 30s, and last 72 DEG C extend 3min.
Embodiment 1
The preparation of Cocaine complete antigen:
Adopt the flow process shown in Fig. 2, adopt commercially available reagent, synthesis obtains the Cocaine complete antigen with BSA coupling.
Embodiment 2
SELEX screens
2.1 set up DNA aptamer storehouse
Select the random single chain nucleotide sequence of 40 base pairs, comprise the PCR primer sequence at two ends, such aptamer storehouse will comprise the different possible sequence of 1014-1015 kind simultaneously.The random aptamer storehouse designed in the present invention comprises: the primer of 40 Nucleotide stochastic sequences (RND40) in the middle of (1) and 18 Nucleotide at (2) two ends, and structure is as shown in Fig. 1 and SEQ ID NO.:5:
5-GCGGATGAAGACTGGTCT-40N-GCCCTAAATACGAGCAAC-3'(SEQ ID NO.:5)。
2.2, screening method:
Affinity chromatography column method is adopted to screen the aptamer be combined with Cocaine.
2.3, fit Cloning and sequencing
In multicycle amplification screening, often wheel carries out pcr amplification, and clones and determined dna sequence final PCR primer.
PCR primer 2% agarose gel electrophoresis, 76bp band clearly as seen, reclaims DNA fragmentation, utilizes commercially available TA clone test kit to carry out connecting and cloning from sepharose.
The clone that picking ampicillin medium grows, increases in LB substratum, and extract plasmid DNA, the plasmid of purifying carries out determined dna sequence.
2.4 result
Often take turns the pcr amplification result of screening as shown in Figure 3.
Through multi-turns screen, screening obtain multiple can with the aptamer of Cocaine specific binding, its sequencing result is as follows:
AGTTGAATAGGGTTGGAGAAAGGACGTGGTATGATTATGT(SEQ ID NO.:1)
TTATTTAGGGTTGGAGGGTAGTTGGAGATGATCGGTGTAG(SEQ ID NO.:2)
TAATGAAGGGCAAGGGAATAGTGGACTGGGGAGGCTGCAG(SEQ ID NO.:3)
GCAGAACAGAGGGTAGGGAATTTGCGTGTGAATTGACCTT(SEQ ID NO.:4)
Embodiment 3
The synthesis that specific DNA is fit and qualification:
According to the result of DNA sequencing, synthesis Cocaine DNA aptamer sequence (SEQ ID NO.:1,2,3 and 4), identifies with SPR (surface plasma resonance Surface Plasmon Resonance).Concrete grammar comprises the following steps:
The bag quilt of (a) golden film: 2mM Cys (mercaptoethylamine) is dropped in golden film surface and hatches 12h.
B 15mM NHS, 75mM EDC, 6mg/ml CM-dextran mixed solution 1ml is dropped in golden film surface and hatches 3h by ().
C () is injected Cocaine complete antigen (embodiment 1), is injected EA and damping fluid, then add the aptamer (concentration is 4,6,8,10,12 μMs) of different concns.
D () tests combination rate that is fit and complete antigen.
Result as shown in Figure 4.Result shows, 4 kinds of aptamers of the present invention (SEQ ID NO.:1 to 4) all with Cocaine (COC), specific binding can occur.Wherein, SEQ ID NO.:3 with 4 similar with kind of aptamer APTR with APTS of two shown in 2 to SEQ ID NO.:1 in conjunction with situation.
Embodiment 4
The foundation of DNA aptamer probe in detecting drugs technology platform
The preparation of 4.1 Radioactive colloidal golds
Adopt trisodium citrate reduction hydrochloro-auric acid (HAuC14) legal system for 40nm colloid gold particle.HAuC14 is first mixed with the aqueous solution of 0.01%, gets 100mL and be heated to boiling, under stirring, accurately add 1% trisodium citrate aqueous solution of 1.0mL, continue heated and boiled 15min.Now can be observed flaxen aqueous solution of chloraurate to gray very soon after Trisodium Citrate adds, continue and change into black, being stable into redness gradually subsequently.Original volume is returned to distilled water after being cooled to room temperature.
4.2. the preparation of Radioactive colloidal gold COC-BSA binding substances mixture
The preparation of colloid gold label Cocaine complete antigen (COC-BSA): get the Radioactive colloidal gold 100.0mL prepared, use 0.1mol/L K
2cO
3colloidal gold solution is adjusted to pH9.0, under magnetic force rapid stirring, adds rapidly 1.0 ~ 2.0mg Cocaine-BSA, after stirring 10min, add the bovine serum albumin of 10% of 1.0mL, then continue to stir 10min.With high speed freezing centrifuge in 4 DEG C, centrifugal 30min under 12000rpm/min, suck supernatant liquor, precipitation is Radioactive colloidal gold COC-BSA binding substances.After being diluted to finite concentration with 0.01mol/L, pH8.2Tris-HCl damping fluid, be immersed in uniformly on glass fibre membrane, 37 DEG C of drying for standby.
The preparation of 4.3 chromatographic test strips
Successively sample pad film, glass fibre (the Radioactive colloidal gold COC-BSA binding substances of solid phase), cellulose nitrate film and sample pad are pasted in PVC support material.Nitrocellulose filter draws detection line and nature controlling line respectively with some film machine, detection line is Cocaine aptamer (SEQ ID NO.:1,2,3 or 4,0.8mg/mL), nature controlling line (C line) is mouse-anti BSA monoclonal antibody (1.0mg/mL), closes 2 hours after drying with confining liquid 1%OVA (ovalbumin) 0.01mol/L PBS; Wash 3 times with 0.01mol/L PBS, after vacuum-drying, be cut into the test strip of 0.4cm × 6.0cm.
The assembling of 4.4 test kits
Be placed in plastics casing by above-mentioned immune chromatograph testing strip, well aims at detector bar sample pad location, is assembled into Cocaine detection kit after compression, adds siccative sealing and preserves.
4.5 detect box Cleaning Principle
As shown in Figure 6, the present embodiment mainly adopts aptamer and laminar flow detection technique.Namely the Cocaine in urine sample is combined with (COC-BSA) Cocaine aptamer competitively with solid phase on nitrocellulose membrane of colloid gold label, carries out judgement detected result by viewing window detection zone (T) position with or without red-purple band.No matter in sample with or without Cocaine composition, (COC-BSA) of colloid gold label all can combine with quality control region anti-BSA antibody, forms a C line.
4.6 results judge
From sealing bag, take out test kit, vertically drip 3 samples (the about 120 μ l such as urine sample, saliva, blood sample) with plastic suction pipe and, in well, in 5 minutes, read detected result (see Fig. 6).
Positive (+): only occur a purplish red colour band in quality control region (C), all do not occur purplish red colour band in detection zone " T " position, illustrates that Cocaine is for positive.Positive findings shows: in sample, Cocaine concentration is all on detection threshold.
Negative (-): as there is a purplish red colour band in quality control region (C), only at the purplish red colour band that detection zone " T " occurs, illustrates that Cocaine is for negative.Negative findings shows: Cocaine concentration is all under detection threshold.The purplish red colour band of detection zone (T) can show the phenomenon of shade, and within the observing time of regulation, no matter this colour band shade, should be judged to be negative findings.Negative findings shows: Cocaine concentration is all under detection threshold.
Invalid: the quality control region (C) of the design has two objects, one be no matter in sample whether containing drug ingredient, (COC-BSA) of colloid gold label can with the mouse-anti BSA antibodies of solid phase on quality control region (C) nitrocellulose filter, form a purplish red colour band at quality control region (C) place, this colour band is the indicatrix of sample positive or negative.Two is instruction testing process whether standards of whether going bad of normal and test kit.If quality control region (C) does not occur colour band, no matter whether T line position there is colour band, and detected result is invalid, again should exchange test kit for and detect.
Embodiment 5
The specificity of aptamer
The cross reacting material selected is methyl amphetamine, amphetamine, MDMA, MDA, morphine, morphine monomethyl ether, heroine, pholcodine, monoacetylmorphine, paracodin, dihydroetorphine, thunder rice is for fourth, Pethidine, fentanyl, U-26225A, Propoxyphene, naloxone, TREXUPONT, nalorphine, clonidine, Lofexidine, Scopolamine, Yi'an oral liquor, just logical peaceful sheet, Paracetamol, Asprin, Ibuprofen BP/EP, amitriptyline, imipramine, chlorpromazine, promethazine, Chloral Hydrate, stable, triazolam, alprazolam, phenylethyl barbituric acid, Somatarax, Amobarbital, caffeine, Norxin, pioneer IV, berberine, lactose, PROCAINE HCL, PHARMA GRADE, rehabilitation new capsule, Chloral Hydrate, Ofloxacin, Phenacetin, somedon, ketamine, demethyl ketamine, methadone, pethidine, racephedrine, Sanedrine, dextrorotation racephedrine, thebaine, tetrahydrocannabinol, lignocaine, Noscapine, buprenorphine, Phenylpropanolamine and phenylethylamine be totally 64 kinds of medicines and drugs.
Above-mentioned detection material is mixed with certain density solution, detects with the test kit described in embodiment 4.
Result shows: aptamer detection reagent (SEQ ID NO.:1-4) all only reacts with Cocaine, and do not have cross reaction with other materials, Cocaine aptamer detection kit has high specificity, accurately and reliably performance.
Embodiment 6
The sensitivity of aptamer
Sensitivity test: add Cocaine in blank urine sample, is mixed with the solution of a series of gradient concentration (1.0 ~ 2000.0ng/mL) respectively to test Cocaine test kit.
As shown in Figure 7, the lowest detection sensitivity of the Cocaine of aptamer of the present invention is below 10.0ng/mL to result.Compared with the immunity detection reagent of colloid gold label Cocaine monoclonal antibody, its sensitivity exceeds 5 times.
Embodiment 7
The determination of detection threshold
In order to distinguish normal medical amount and drug abuse amount, by regulating the consumption of the COC-BSA that reagent strip marks, the detection threshold of Cocaine is adjusted to 300.0ng/mL.
Embodiment 8
The accuracy that aptamer detects
By the contrast of the aptamer Cocaine test kit described in embodiment 4 and GC-MS detected result, the results are shown in Table 1.Result shows, the accuracy of test kit of the present invention reaches 100%.
Table 1 detection accuracy
Embodiment 9
The stability of detection kit
The sealing of the Cocaine detection kit of colloid gold label to be placed at baking oven 45 DEG C of temperature destructive test one month, then to test by the Cocaine of 300.0ng/mL and negative sample, consistent with not roasted test kit detected result.Show that this aptamer Cocaine detection kit has satisfactory stability.
Above-mentioned test-results shows, the present invention establishes the Screening Platform that can be used for screening specific recognition drugs, the micromolecular DNA aptamer of poisonous substance first, and successfully develops aptamer Cocaine being had to very high specific and avidity.There is not any cross reaction in aptamer of the present invention and other medicines, drugs, confirms that aptamer has the specificity of height.Aptamer provided by the invention and detection kit will exceed 5 times than the sensitivity of the detection of monoclonal antibody, and in addition, the aspects such as specificity of the present invention, stability, rapid detection and Site Detection, also have significant technological merit.
Due to the present invention have reproducible, without batch between the feature such as difference, therefore have broad prospects in the context of detection of drugs, poisonous substance.
The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. an aptamer, is characterized in that, described fit specific binding is in Cocaine;
Further, described specific binding refers to describedly fitly be incorporated into Cocaine but be not incorporated into following any one material: methyl amphetamine, amphetamine, MDMA, MDA, morphine, morphine monomethyl ether, heroine, pholcodine, monoacetylmorphine, paracodin, dihydroetorphine, thunder rice is for fourth, Pethidine, fentanyl, U-26225A, Propoxyphene, naloxone, TREXUPONT, nalorphine, clonidine, Lofexidine, Scopolamine, Yi'an oral liquor, just logical peaceful sheet, Paracetamol, Asprin, Ibuprofen BP/EP, amitriptyline, imipramine, chlorpromazine, promethazine, Chloral Hydrate, stable, triazolam, alprazolam, phenylethyl barbituric acid, Somatarax, Amobarbital, caffeine, Norxin, pioneer IV, berberine, lactose, PROCAINE HCL, PHARMA GRADE, rehabilitation new capsule, Chloral Hydrate, Ofloxacin, Phenacetin, somedon, ketamine, demethyl ketamine, methadone, pethidine, racephedrine, Sanedrine, dextrorotation racephedrine, thebaine, tetrahydrocannabinol, lignocaine, Noscapine, buprenorphine, Phenylpropanolamine and phenylethylamine.
2. aptamer as claimed in claim 1, it is characterized in that, described fit sequence is as shown in SEQ IDNO.:1,2,3 or 4.
3. a conjugate, is characterized in that, the detectable that described conjugate comprises aptamer according to claim 1 and is connected with described aptamer.
4. conjugate as claimed in claim 3, it is characterized in that, described detectable comprises vitamin H, chemiluminescent groups, chemiluminescence group, fluorescin, enzyme, Radioactive colloidal gold, radio isotope, latex particle, antibody, part, antigen, acceptor or its combination.
5. a mixture, is characterized in that, described mixture is the mixture that (a) aptamer according to claim 1 or conjugate according to claim 3 are formed with (b) Cocaine.
6. detect goods, it is characterized in that, described detection goods contain aptamer according to claim 1 or conjugate according to claim 3.
7. detect goods as claimed in claim 6, it is characterized in that, described detection goods comprise: detection reagent, effluent sheet, chip, test strip, check-out console.
8. a detection kit, is characterized in that, described detection kit comprises aptamer according to claim 1, conjugate according to claim 3 and/or detection goods according to claim 6.
9. the purposes of conjugate described in aptamer as claimed in claim 1 or claim 3, is characterized in that, for the preparation of the detection goods or the test kit that detect Cocaine.
10. detect a method for Cocaine, comprise the following steps:
A () provides sample to be detected;
B this sample mixes with aptamer according to claim 1 or conjugate according to claim 3 by (), form mixture;
Whether c () detect the existence of " Cocaine-aptamer mixture " in described mixture, if wherein there is described mixture, then shows to there is Cocaine in described sample; If there is no described mixture, then show to there is not Cocaine in described sample.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310743132.9A CN104745586B (en) | 2013-12-27 | 2013-12-27 | Cocaine aptamer, detection kit and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310743132.9A CN104745586B (en) | 2013-12-27 | 2013-12-27 | Cocaine aptamer, detection kit and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104745586A true CN104745586A (en) | 2015-07-01 |
CN104745586B CN104745586B (en) | 2020-02-04 |
Family
ID=53585845
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310743132.9A Active CN104745586B (en) | 2013-12-27 | 2013-12-27 | Cocaine aptamer, detection kit and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104745586B (en) |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105784990A (en) * | 2016-05-17 | 2016-07-20 | 中国农业科学院农业质量标准与检测技术研究所 | Test strip for detecting aflatoxin B1 or M1 by utilizing aptamer |
CN105998025A (en) * | 2016-05-20 | 2016-10-12 | 福州冬眠医疗科技有限公司 | Mild-hypothcrmia-inducing medicinal composite preparation and application thereof |
CN106199019A (en) * | 2016-07-24 | 2016-12-07 | 朱继平 | A kind of gene chip for detecting coronary heart disease and test kit thereof |
WO2018160762A1 (en) * | 2017-02-28 | 2018-09-07 | Base Pair Biotechnologies, Inc. | Functional ligands to drug compounds |
CN109142710A (en) * | 2018-09-03 | 2019-01-04 | 山西大学 | A kind of method of rapid sensitive detection tetraodotoxin TTX |
CN109142751A (en) * | 2018-09-03 | 2019-01-04 | 山西大学 | A method of the label-free Sensitive Detection tetraodotoxin TTX of enzyme I is sheared based on nucleic acid |
CN109371031A (en) * | 2018-11-23 | 2019-02-22 | 北京化工大学 | A kind of screening technique specifically binding bovine serum albumin(BSA) aptamer |
CN114113576A (en) * | 2021-09-30 | 2022-03-01 | 中国地质大学(武汉) | Colloidal gold test strip for detecting cocaine, preparation method and method for testing cocaine |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101012483A (en) * | 2007-02-02 | 2007-08-08 | 浙江大学 | Checking reagent containing nucleic acid gamete and method for making same and use |
CN101832935A (en) * | 2009-03-10 | 2010-09-15 | 苏州市长三角系统生物交叉科学研究院有限公司 | Target molecule detection method based on nanometer-gold and nucleic acid structure and kit thereof |
CN103048449A (en) * | 2013-01-14 | 2013-04-17 | 谭蔚泓 | Chromatographic detection kit based on aptamer, as well as preparation method and detection method thereof |
-
2013
- 2013-12-27 CN CN201310743132.9A patent/CN104745586B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101012483A (en) * | 2007-02-02 | 2007-08-08 | 浙江大学 | Checking reagent containing nucleic acid gamete and method for making same and use |
CN101832935A (en) * | 2009-03-10 | 2010-09-15 | 苏州市长三角系统生物交叉科学研究院有限公司 | Target molecule detection method based on nanometer-gold and nucleic acid structure and kit thereof |
CN103048449A (en) * | 2013-01-14 | 2013-04-17 | 谭蔚泓 | Chromatographic detection kit based on aptamer, as well as preparation method and detection method thereof |
Cited By (11)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105784990A (en) * | 2016-05-17 | 2016-07-20 | 中国农业科学院农业质量标准与检测技术研究所 | Test strip for detecting aflatoxin B1 or M1 by utilizing aptamer |
CN105784990B (en) * | 2016-05-17 | 2018-06-01 | 中国农业科学院农业质量标准与检测技术研究所 | It is a kind of to detect aflatoxin B1 or the test strips of M1 using aptamers |
CN105998025A (en) * | 2016-05-20 | 2016-10-12 | 福州冬眠医疗科技有限公司 | Mild-hypothcrmia-inducing medicinal composite preparation and application thereof |
CN106199019A (en) * | 2016-07-24 | 2016-12-07 | 朱继平 | A kind of gene chip for detecting coronary heart disease and test kit thereof |
CN106199019B (en) * | 2016-07-24 | 2017-12-26 | 烟台硕博源生物技术有限公司 | A kind of genetic chip and its kit for being used to detect coronary heart disease |
WO2018160762A1 (en) * | 2017-02-28 | 2018-09-07 | Base Pair Biotechnologies, Inc. | Functional ligands to drug compounds |
CN109142710A (en) * | 2018-09-03 | 2019-01-04 | 山西大学 | A kind of method of rapid sensitive detection tetraodotoxin TTX |
CN109142751A (en) * | 2018-09-03 | 2019-01-04 | 山西大学 | A method of the label-free Sensitive Detection tetraodotoxin TTX of enzyme I is sheared based on nucleic acid |
CN109142751B (en) * | 2018-09-03 | 2021-09-28 | 山西大学 | Method for sensitively detecting tetrodotoxin TTX based on nucleic acid cleavage enzyme I immune marker |
CN109371031A (en) * | 2018-11-23 | 2019-02-22 | 北京化工大学 | A kind of screening technique specifically binding bovine serum albumin(BSA) aptamer |
CN114113576A (en) * | 2021-09-30 | 2022-03-01 | 中国地质大学(武汉) | Colloidal gold test strip for detecting cocaine, preparation method and method for testing cocaine |
Also Published As
Publication number | Publication date |
---|---|
CN104745586B (en) | 2020-02-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104745586A (en) | Cocaine aptamer, detection kit and application thereof | |
CN104745585A (en) | Methamphetamine aptamer, detection kit and application thereof | |
CN103901000B (en) | A kind of based on FRET (fluorescence resonance energy transfer) detection volt horse verticillium toxin B1method | |
WO1998026288A1 (en) | Method and system for analyte determination | |
WO2009158657A2 (en) | Molecularly imprinted polymers for detecting microorganisms | |
CN109991202A (en) | A method of it is detected based on aptamer fluorescent optical sensor for multiple target objects | |
CN105624164B (en) | Ketamine aptamer, detection kit and application thereof | |
CA2428428A1 (en) | Protein chips, method producing it and detection system of the protein chips, and operating method of the detection system | |
CN104360077A (en) | Aptamer nucleic acid probe kit for detecting doxycycline residue as well as preparation method and application thereof | |
CN103852436B (en) | A kind of high specific DNA hydrogel detection method to lead ion | |
JP2000506378A (en) | Polymer films, assays and methods for direct color detection of analytes | |
Lee et al. | Longitudinal monitoring of antibody responses against tumor cells using magneto-nanosensors with a nanoliter of blood | |
Perkmann et al. | Initial SARS-CoV-2 vaccination response can predict booster response for BNT162b2 but not for AZD1222 | |
US10191048B2 (en) | Fluorometric immunoassay for detection of anti-dsDNA antibodies | |
CN106404731B (en) | PCT and CRP double-labeling time-resolved fluorescence immunoassay method for simultaneously detecting bacterial meningitis and viral meningitis | |
Liu et al. | The promise of aggregation-induced emission luminogens for detecting COVID-19 | |
CN105132584A (en) | Kit for genotyping VZV, production method of kit and application of kit | |
CN101672848A (en) | Microsphere surface fluorescence color coding liquid biochip diagnostic kit, method and device for detecting material to be detected by using diagnostic kit and application of diagnostic kit | |
EP3614147B1 (en) | Method of detecting specimen substance using multiphase polymer fine particles | |
CN114350670B (en) | Aptamer capable of specifically recognizing soluble ST2 protein and application thereof | |
CN102409090A (en) | Nucleic acid detection probe, primers and kit for inhibitor of apoptosis protein Survivin gene, and detection method thereof | |
CN102399899A (en) | Liquid phase chip method and kit for detecting polymorphism of cytochrome P450 1A2 (CYP1A2) genes | |
KR101850708B1 (en) | Aptasensor for detecting the female-specific traces of blood | |
CN104634919A (en) | Instant qualitative analysis method for multiple targets | |
Brys et al. | Approaches to allergy detection using aptasensors |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |