CN101012483A - Checking reagent containing nucleic acid gamete and method for making same and use - Google Patents
Checking reagent containing nucleic acid gamete and method for making same and use Download PDFInfo
- Publication number
- CN101012483A CN101012483A CN 200710067163 CN200710067163A CN101012483A CN 101012483 A CN101012483 A CN 101012483A CN 200710067163 CN200710067163 CN 200710067163 CN 200710067163 A CN200710067163 A CN 200710067163A CN 101012483 A CN101012483 A CN 101012483A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- chain nucleic
- adaptive
- chain
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention discloses a detecting, identifying and/or quantifying method and agent box and nucleic acid bonder of target molecule, which comprises the following steps: (a) providing the first nucleic acid with aspotic adapting subsequence corresponding to target molecule and second single-chain nucleic acid with detected mark and 5-50% complementary adapting subsequence; (b) blending the first nucleic acid, second single-chained nucleic acid and detected, identified and/or quantified sample; (c) detecting the mark in connection with the first nucleic acid or in non-connection with the second single-chained nucleic acid.
Description
Technical field
The invention belongs to the field of the detection method that comprises nucleic acid, particularly, the present invention relates to method with adaptive sub-detection, evaluation and/or quantification compound.This method not only can detect, evaluation and/or quantification compound, and can be used in fields such as the screening of medicine and detection, criminal investigation detection, food safety detection.In addition, the invention still further relates to nucleic acid binding substances, detection kit and their preparation method who is used for this method.
Background technology
The beginning of the nineties in last century, Tuerk and Gold have founded index concentration formula aglucon phyletic evolution (SystematicEvolution of Ligands by Exponential Enrichment, abbreviate SELEX as) technology, external selection and amplification by many wheels, can filter out the adaptive son of specificity (aptamer) from the random oligonucleotide library (can be referring to Science, 1990,249 (4968): 505-510).Adaptive son is a single-chain nucleic acid, can be DNA or RNA, and it can combine with specific molecule.A typical SELEX process may filter out adaptive son in several weeks to some months, and uses " SELEX automatically " technology, has not only reduced the interference of human factor, and more can finish a SELEX process in a couple of days.Thereby by the SELEX technology, people screened the adaptive son of each specific specificity of a large amount of molecules such as microorganism adaptive son, biomacromolecule (as, vascular endothelial growth factor, the somatomedin in thrombocyte source, Prostatropin, L-select cytokines such as element, keratinocyte growth factor, IFN-, tumour necrosis factor) adaptive son, micromolecular adaptive son, can the specific combination corresponding microorganism, target molecules such as biomacromolecule, small molecules.They have been that a large amount of existing documents are disclosed, as CN1490054A, CN1550501A, CN1563401A, biotechnology journal, and 20 (4): 627-632, etc.
Adaptive son has high-affinity to the identification of target molecule, and binding target molecule with high specificity.Adaptive son during as antagonist dissociation constant be 50pmol/L～10nmol/L; And adaptive son can make a distinction target molecule and its variant, isomer, even can differentiate the difference of 1 methyl on the target molecule structure or 1 hydroxyl.Therefore, adaptive son can be applicable to the detection to target molecule.Yet, need the certification mark thing is directly connected on the adaptive son in the technology of the adaptive son detection of existing application target molecule, not only influenced the handiness of detection method itself, and owing to of the influence of certification mark thing to adaptive sub-three-dimensional conformation, especially when the certification mark thing is relatively large, can directly cause the identification of adaptive son, the avidity of binding target molecule, specific change, thus accuracy and precision that influence detects.
For this reason, the present inventor is through long-term and arduous research, unexpectedly developed a kind of competitive testing method, provide first nucleic acid that contains adaptive son and with adaptive subsequence part complementary second nucleic acid, wherein with the certification mark substance markers on second nucleic acid, target molecule in second nucleic acid and the sample can be competitively and adaptive sub the combination, by detect combine with adaptive son or unconjugated second nucleic acid on the certification mark thing, detect, evaluation and/or quantifying target molecule.This method not only provides the testing method of the adaptive son of alternative utilization, and can avoid the certification mark thing directly to be connected with adaptive son and to adaptively subly discern, the influence of binding ability.In order to improve the handiness of test, non-adaptive subsequence part complementary the 3rd nucleic acid with first nucleic acid can further be provided on the basis of this method, by fixing the 3rd nucleic acid and utilizing combination between the nucleic acid complementary sequence, also make the win nucleic acid and second dna immobilization.In addition, competitive testing method of the present invention also has advantages such as test duration production cost short, test agent is low, R﹠D cycle weak point, steady quality.。
Summary of the invention
The object of the present invention is to provide a kind of competitive testing method, be used for detection, evaluation and/or quantifying target molecule.And the present invention also provides the test kit that is applied in this method, nucleic acid and its production and application.
Aspect first, the invention provides the method for a kind of detection, evaluation and/or quantifying target molecule, its step comprises:
(a) provide first nucleic acid and second single-chain nucleic acid that has the certification mark thing, wherein said first nucleic acid contains the adaptive subsequence that is specific to target molecule, and the sequence of described second single-chain nucleic acid and adaptive subsequence part are complementary;
(b) mix first nucleic acid, second single-chain nucleic acid and to be detected, evaluation and/or quantified sample;
(c) detect and to combine with first nucleic acid or the certification mark thing of unconjugated second single-chain nucleic acid.
The method of preferred first aspect of the present invention, wherein, first nucleic acid has the immobilization group.
The method of preferred first aspect of the present invention, wherein, first nucleic acid is the single-chain nucleic acid that is connected with the immobilization group.
The method of preferred first aspect of the present invention, wherein, first nucleic acid comprises the 3rd single-chain nucleic acid and has the 4th single-chain nucleic acid of immobilization group that described the 3rd single-chain nucleic acid contains adaptive subsequence and catenation sequence, the sequence of described the 4th single-chain nucleic acid and catenation sequence complementation.
The method of preferred first aspect of the present invention is characterized in that the blended process can be in step (b), makes first nucleic acid and the second single-chain nucleic acid combination earlier, adds sample again; Also can be to add first nucleic acid, second single-chain nucleic acid and sample simultaneously.
The method of preferred first aspect of the present invention, wherein the certification mark thing is one or more combinations in radio isotope, chemiluminescent groups, chemiluminescence group, fluorescin, enzyme, antigen or antibody, part or the acceptor, preferably horseradish peroxidase or alkaline phosphatase.
The method of preferred first aspect of the present invention, wherein the immobilization group comprises antigen or antibody, part or acceptor, preferably vitamin H.
The method of preferred first aspect of the present invention, wherein adaptive son is selected from the adaptive son of microorganism, adaptive son and the micromolecular adaptive son of biomacromolecule, the preferably adaptive son of Cocaine.
Aspect second, the invention provides the test kit of a kind of detection, evaluation and/or quantifying target molecule, second single-chain nucleic acid that it comprises first nucleic acid and has the certification mark thing, wherein said first nucleic acid contains the adaptive subsequence that is specific to target molecule, and the sequence of described second single-chain nucleic acid and adaptive subsequence part are complementary.
The test kit of preferred second aspect of the present invention, wherein, first nucleic acid has the immobilization group.
The test kit of preferred second aspect of the present invention, wherein, first nucleic acid is the single-chain nucleic acid that is connected with the immobilization group.
The test kit of preferred second aspect of the present invention, wherein, first nucleic acid comprises the 3rd single-chain nucleic acid and has the 4th single-chain nucleic acid of immobilization group that described the 3rd single-chain nucleic acid contains adaptive subsequence and catenation sequence, the sequence of described the 4th single-chain nucleic acid and catenation sequence complementation.
The test kit of preferred second aspect of the present invention, wherein first nucleic acid and second single-chain nucleic acid are in conjunction with forming the nucleic acid binding substances.
The test kit of preferred second aspect of the present invention, wherein the certification mark thing is one or more combinations in radio isotope, chemiluminescent groups, chemiluminescence group, fluorescin, enzyme, antigen or antibody, part or the acceptor, preferably horseradish peroxidase or alkaline phosphatase.
The test kit of preferred second aspect of the present invention, wherein the immobilization group comprises antigen or antibody, part or acceptor, preferably vitamin H.
The test kit of preferred second aspect of the present invention, wherein adaptive son is selected from the adaptive son of microorganism, adaptive son and the micromolecular adaptive son of biomacromolecule, the preferably adaptive son of Cocaine.
The test kit of preferred second aspect of the present invention, it also comprises the reagent that can detect the certification mark thing.
Aspect the 3rd, the invention provides a kind of nucleic acid binding substances, it is by first nucleic acid and have second single-chain nucleic acid of certification mark thing in conjunction with forming, wherein said first nucleic acid contains the adaptive subsequence that is specific to target molecule, and the sequence of described second single-chain nucleic acid and adaptive subsequence part are complementary.
The nucleic acid binding substances of preferred third aspect of the present invention, wherein, first nucleic acid has the immobilization group.
The nucleic acid binding substances of preferred third aspect of the present invention, wherein, first nucleic acid is the single-chain nucleic acid that is connected with the immobilization group.
The nucleic acid binding substances of preferred third aspect of the present invention, wherein, first nucleic acid comprises the 3rd single-chain nucleic acid and has the 4th single-chain nucleic acid of immobilization group that described the 3rd single-chain nucleic acid contains adaptive subsequence and catenation sequence, the sequence of described the 4th single-chain nucleic acid and catenation sequence complementation.
The nucleic acid binding substances of preferred third aspect of the present invention, wherein the certification mark thing is one or more combinations in radio isotope, chemiluminescent groups, chemiluminescence group, fluorescin, enzyme, antigen or antibody, part or the acceptor, preferably horseradish peroxidase or alkaline phosphatase.
The nucleic acid binding substances of preferred third aspect of the present invention, wherein the immobilization group comprises antigen or antibody, part or acceptor, preferably vitamin H.
The nucleic acid binding substances of preferred third aspect of the present invention, wherein adaptive son is selected from the adaptive son of microorganism, adaptive son and the micromolecular adaptive son of biomacromolecule, the preferably adaptive son of Cocaine.
Aspect the 4th, the invention provides the preparation method of the described nucleic acid binding substances of third aspect of the present invention, comprise first nucleic acid and the second single-chain nucleic acid bonded process of making.
Aspect the 5th, the invention provides the application in drug screening, drug testing, drugs detection, food safety detection of the described method in first aspect of the present invention, second described test kit in aspect of the present invention or the described nucleic acid binding substances of third aspect of the present invention.
Aspect the 6th, the invention provides the adaptive son of Cocaine, its sequence is GGGAGACAAGGATAAATCCTTCAATGAAGTGGGTCTCCC.
For the present invention, do following concrete statement:
Particularly, aspect first, the invention provides the method for a kind of detection, evaluation and/or quantifying target molecule, its step comprises:
(a) provide first nucleic acid and second single-chain nucleic acid that has the certification mark thing, wherein said first nucleic acid contains the energy specific combination in the adaptive son of target molecule, described second single-chain nucleic acid and described adaptive subdivision complementation;
(b) mix first nucleic acid, second single-chain nucleic acid and to be detected, evaluation and/or quantified sample;
(c) detect and to combine with first nucleic acid or the certification mark thing of unconjugated second single-chain nucleic acid.
In this article, be used to distinguish the label of different nucleic acid, promptly terms such as " first ", " second ", " the 3rd ", " the 4th " only are used to represent different chemical entities, do not limit the constitutional features of a chemical entities.The chemical entities that these terms are distinguished in this article mainly is a nucleic acid, as DNA, RNA or have the certification mark thing and/or DNA, the RNA etc. of immobilization group.For example, above-mentioned first nucleic acid refers to and contains the energy specific combination in the nucleic acid of the adaptive son of target molecule.In first nucleic acid, adaptive subsequence partly is a strand, thereby can combine with second single-chain nucleic acid is complementary.And second single-chain nucleic acid is the adaptive subdivision complementary single-chain nucleic acid in the sequence and first nucleic acid, and described single-chain nucleic acid has the certification mark thing, thereby therefore second single-chain nucleic acid can by with first nucleic acid in the portion paired of adaptive son complementary second single-chain nucleic acid and first nucleic acid are combined, and can be detected by the certification mark thing that second single-chain nucleic acid has.In this article, nucleic acid is represented its sequence with symbol well-known to those skilled in the art, and if no special instructions, what sequence was represented is the sequence order of holding to 3 ' extreme direction from 5 '.
Term herein " part complementary " refers to a part of successive sequence base pairing complementation in the sequence of a part of successive sequence in the sequence of second single-chain nucleic acid and adaptive son, thereby second single-chain nucleic acid can complementaryly be combined with first nucleic acid that contains adaptive son.Usually decide on the sequence length of adaptive son, a part of successive sequence preference in the sequence of above-mentioned adaptive son is the sequence of 5% to 50% in the adaptive son, 10% to 30% in the more preferably adaptive son, more preferably 15% to 20%; The initial base of a part of successive sequence in the sequence of above-mentioned adaptive son can be any one base in the sequence of adaptive son, as long as there are after this base enough continuous sequences to can be used as a part of successive sequence in the sequence of above-mentioned adaptive son, preferably this initial base is first base of holding the adaptive son of counting from 5 '.Correspondingly, a part of successive sequence in the sequence of second single-chain nucleic acid be exactly can with a part of successive sequence base pairing complementary sequence in the sequence of adaptive son.Preferably in a specific embodiment of the present invention, contained adaptive son is the adaptive son of Cocaine in first nucleic acid, its sequence is GGGAGACAAGGATAAATCCTTCAATGAAGTGGGTCTCCC, and the nucleotide sequence of second single-chain nucleic acid is 3,-TAGAGCCCTCTG-5 ', a part of successive sequence (being GGGAGAC) in the adaptive son of Cocaine and a part of successive sequence (i.e. 3 '-CCCTCTG-5 ') the base pairing complementation in second single-chain nucleic acid, thus second single-chain nucleic acid can complementaryly be combined with first nucleic acid.
Term herein " adaptive son " is well-known to those skilled in the art, refer to can with specific target molecule bonded single-chain nucleic acid, comprise DNA or RNA.Can obtain the adaptive son of certain target molecules in a short time by SELEX.At present there has been a large amount of adaptive sons to be disclosed, therefore adaptive son herein can be selected from the adaptive son of microorganism, biomacromolecule is (as protein, nucleic acid) adaptive son and micromolecular adaptive son, preferably micromolecular adaptive son, as the adaptive son of Cocaine, the adaptive son of bile acide (its sequence is GTACCAGCTTATTCAATTACAGATCGAGGGCAGCGATAGCTGGGCTAATAAGGTTA GCCCCATCGGTCCTGGACTTGGGACTAGATAGTATGTTCATCAG), the adaptive son of ATP (its sequence is ACCTGGGGGAGTATTGCGGAGGAAGGT) is more preferably the adaptive son of Cocaine.Because adaptive son has the character that combines specific target molecule similar with antibody, therefore adaptive son can replace the effect of antibody in detection, and the inventor utilizes the base complementrity paired properties of nucleic acids of adaptive son to design second single-chain nucleic acid, obtained the method for first aspect of the present invention, make the target molecule and second single-chain nucleic acid can compete in conjunction with first nucleic acid that contains adaptive son, wash away unconjugated second single-chain nucleic acid then, by detect on the testing plate base combine with first nucleic acid or the amount of unconjugated second single-chain nucleic acid is extrapolated target molecule in elutriant existence whether and the amount that exists, thereby detection, identify and/or the quantifying target molecule.So the present invention measures (Enzyme-LinkedImmunosorbent Assay abbreviates ELISA as) than the enzyme connection immunosorbent of routine and has better detection sensitivity and specificity, but also has following 4 advantages:
1, detection time is short.Mix first nucleic acid, second single-chain nucleic acid and and sample after, usually as long as normal temperature is placed just can be washed in 5 minutes, and common these step needs of ELISA method with antibody are more than 30 minutes.
2, production cost is low.Adaptive son and nucleic acid binding substances thereof are as long as just can obtain by chemosynthesis and modification, and DNA synthetic technology is very ripe at present, and cost is extremely low.And protein antibodies will obtain by animal immune and purifying, and cost is higher.
3, the new-product development cycle is short.By the SELEX technology, can in 1 month, obtain and the adaptive son of target molecule high special bonded.And the research and development time of protein antibodies is minimum more than 6 months.
4, constant product quality.Dna molecular is more stable than protein antibodies, long-time easily the preservation, and this causes the validity period of product to prolong greatly.
Herein, preferred first nucleic acid has the immobilization group.Like this, first nucleic acid just can be combined in the testing plate base (as employed base among the ELISA by the immobilization group, include the micropore of commercial 96 orifice plates) go up and can be by wash-out, can detect thus, identify and/or quantitative and the first nucleic acid complementary pairing bonded, second single-chain nucleic acid, perhaps can detect, identify and/or quantitative eluted unconjugated second single-chain nucleic acid, thereby extrapolate the existence and/or the quantity of target molecule.Wherein, the immobilization group can directly link to each other to form first nucleic acid with the single-chain nucleic acid that contains adaptive son, that is to say, first nucleic acid is the single-chain nucleic acid that is connected with the immobilization group.The immobilization group can be connected 5 ' end of single-chain nucleic acid, also can be connected 3 ' end of single-chain nucleic acid.The present invention more preferably immobilization group links to each other with the single-chain nucleic acid that contains adaptive son by indirect mode, that is to say, first nucleic acid comprises the 3rd single-chain nucleic acid and has the 4th single-chain nucleic acid of immobilization group, described the 3rd single-chain nucleic acid contains adaptive subsequence and catenation sequence, the sequence of described the 4th single-chain nucleic acid and catenation sequence complementation.Thereby utilize the catenation sequence base complementrity pairing of the 4th single-chain nucleic acid and the 3rd single-chain nucleic acid to make the 4th single-chain nucleic acid and the 3rd single-chain nucleic acid be combined together to form first nucleic acid like this, and the 4th single-chain nucleic acid can whole first nucleic acid be fixed on the testing plate base by its immobilization group that has, combine with the base complementrity pairing of second single-chain nucleic acid and the combining of adaptive son and target molecule by the contained adaptive subsequence of the 3rd single-chain nucleic acid, thus the method for acquisition competitive assay of the present invention, evaluation and/or quantifying target molecule.The 4th single-chain nucleic acid and the 3rd single-chain nucleic acid be equimolar amount normally.
In this article, the immobilization group can be the chemical group that those skilled in the art know, and they can be connected first nucleic acid on the testing plate base by covalent linkage.These technology extensively are present among the nucleic acid technique for fixing of nucleic acid microarray, nucleic acid chip.But in order to synthesize first nucleic acid more neatly, the preferred immobilization group of the present invention is can be in conjunction with the material that is coated on the substrate on the testing plate base, preferably antigen or antibody, part or acceptor.For example, when being coated with antigen on the testing plate base, then make first nucleic acid have corresponding antibodies, the combination by Ag-Ab can be fixed on first nucleic acid on the testing plate base; Otherwise, coated antibody, it is also passable to make first nucleic acid have corresponding antigens.The most preferred immobilization group of the present invention is a vitamin H, the bag by on the sheet base of avidin the combination by biotin-avidin make the dna immobilization of winning.The synthetic method that has the nucleic acid of immobilization group is known, as Nucleic Acids Res, and 1985,13:745-761 has just put down in writing the method that connects vitamin H on nucleic acid.In a specific embodiment of the present invention, preferred first nucleic acid comprises the 3rd single-chain nucleic acid and has the 4th single-chain nucleic acid of immobilization group, described the 3rd single-chain nucleic acid contains adaptive subsequence of Cocaine and catenation sequence (catenation sequence is preferably ACTCATCTGTGA), and more preferably the sequence of the 3rd single-chain nucleic acid is ACTCATCTGTGAATCTCGGGAGACAAGGATAAATCCTTCAATGAAGTGGGTCTCCC; The sequence of described the 4th single-chain nucleic acid is 3 '-ATGAGTAGACACT-5 ', and the immobilization group is vitamin H, is marked at 3 ' end of the 4th single-chain nucleic acid.
In this article, the certification mark thing that second single-chain nucleic acid has is the material that can detect, and includes but not limited to one or more combinations in radio isotope, chemiluminescent groups, chemiluminescence group, fluorescin, enzyme, antigen or antibody, part or the acceptor.Radioisotopic suitable example has
32P,
125I,
35S,
3H etc.By ordinary methods such as chemosynthesis, PCR, nick translations, can prepare radiolabeled second single-chain nucleic acid.Chemiluminescent groups has luminol,3-aminophthalic acid cyclic hydrazide etc.; The chemiluminescence group comprises rhodamine, FITC, TRITC etc.By the chemical synthesis process of routine, can be to second single-chain nucleic acid with enzyme labellings such as horseradish peroxidase, alkaline phosphatases.Above-mentioned single-chain nucleic acid that has a certification mark thing and preparation thereof and detection method are known, can be referring to labelled immune analysis and clinical, 1994,1 (2): 111-116, biotechnology progress, 1995,15 (2): summaries such as 18-21, and had a large amount of commercial certification mark thing and reaction kit thereof available, as An Fama West Asia company sell AlkPhos Direct labelling kit and detection system thereof.In the present invention, the certification mark thing that preferred second single-chain nucleic acid has is horseradish peroxidase or alkaline phosphatase, and more preferably the sequence of second single-chain nucleic acid is 3 '-TAGAGCCCTCTG-5 ', and its 5 ' end is connected with horseradish peroxidase.
In the present invention is aspect first, in step (b), mix first nucleic acid, second single-chain nucleic acid and to be detected, evaluation and/or quantified sample, wherein the amount of first nucleic acid and second single-chain nucleic acid is predetermined, preferred first nucleic acid and second single-chain nucleic acid are equimolar amounts, if have the 4th single-chain nucleic acid and the 3rd single-chain nucleic acid, then preferred second single-chain nucleic acid, the 4th single-chain nucleic acid and the 3rd single-chain nucleic acid are equimolar amounts.First nucleic acid (perhaps the 4th single-chain nucleic acid and the 3rd single-chain nucleic acid), second single-chain nucleic acid and sample can add simultaneously, also can add in certain sequence.For example, the blended process can be in step (b), and first nucleic acid (perhaps the 4th single-chain nucleic acid and the 3rd single-chain nucleic acid) and second single-chain nucleic acid are combined, and adds sample again; Also can be to add first nucleic acid, second single-chain nucleic acid and sample simultaneously.In the specific embodiment of the present invention, add earlier the 4th single-chain nucleic acid, the 3rd single-chain nucleic acid and second single-chain nucleic acid simultaneously, form the nucleic acid binding substances, and then add sample.In step (c), detection combines with first nucleic acid or the certification mark thing of unconjugated second single-chain nucleic acid is undertaken by the conventional way that detects the certification mark thing.Usually mix first nucleic acid in step (b), behind second single-chain nucleic acid and the sample, (be generally 10-50 degree centigrade in temperature of reaction, be preferably 15-37 degree centigrade, more preferably 25 degrees centigrade) under leave standstill for some time and (be generally 1-500 minute, be preferably 3-50 minute, more preferably 5-10 minute), wash away unconjugated second single-chain nucleic acid, by conventional way detect on the testing plate base with the first nucleic acid bonded or in elutriant the amount of unconjugated second single-chain nucleic acid, the existence of extrapolating target molecule according to typical curve whether and the amount that exists, thereby final the realization detected, identify and/or the quantifying target molecule.
Aspect second, the invention provides the test kit of a kind of detection, evaluation and/or quantifying target molecule, second single-chain nucleic acid that it comprises first nucleic acid and has the certification mark thing, wherein said first nucleic acid contains the adaptive subsequence that is specific to target molecule, and described second single-chain nucleic acid and adaptive subsequence part are complementary.This test kit can be used for carrying out the method for the present invention at the detection aspect first, evaluation and/or quantifying target molecule.As described in first aspect of the present invention, in the test kit aspect second of the present invention, preferred first nucleic acid has the immobilization group.Wherein, first nucleic acid can be the single-chain nucleic acid that is connected with the immobilization group; First nucleic acid also can comprise the 3rd single-chain nucleic acid and have the 4th single-chain nucleic acid of immobilization group that described the 3rd single-chain nucleic acid contains adaptive subsequence and catenation sequence, the sequence of described the 4th single-chain nucleic acid and catenation sequence complementation.Described immobilization group comprises antigen or antibody, part or acceptor, preferably vitamin H; Described adaptive son is selected from the adaptive son of microorganism, adaptive son and the micromolecular adaptive son of biomacromolecule, the preferably adaptive son of Cocaine.The test kit of especially preferred second aspect of the present invention comprises by first nucleic acid and second single-chain nucleic acid in conjunction with forming the nucleic acid binding substances.First nucleic acid (perhaps the 4th single-chain nucleic acid, the 3rd single-chain nucleic acid) can be loaded on respectively in the different containers with second single-chain nucleic acid, and these containers are included in the test kit; Also can their nucleic acid binding substances be loaded in the container.In the specific embodiment of the present invention, add the 4th single-chain nucleic acid, the 3rd single-chain nucleic acid and second single-chain nucleic acid of equimolar amount simultaneously, make this three form the nucleic acid binding substances, this nucleic acid binding substances can be in the medium-term and long-term preservation of encloses container after lyophilize.
As mentioned before, the certification mark thing that second single-chain nucleic acid has is one or more combinations in radio isotope, chemiluminescent groups, chemiluminescence group, fluorescin, enzyme, antigen or antibody, part or the acceptor, preferably horseradish peroxidase or alkaline phosphatase.These certification mark things can be detected by respective detection reagent, so in aspect second of the present invention, test kit also comprises the reagent that can detect the certification mark thing.Such reagent is well-known to those skilled in the art, has been made into commercial reagent usually, for example, the substrate of enzyme, excites chemiluminescent groups and chemiluminescence group to produce reagent of detectable light etc.Such reagent can be packed into and is not equipped with in the other container of first nucleic acid and second single-chain nucleic acid, and is packaged into test kit with the container that first nucleic acid, second single-chain nucleic acid are housed.
Aspect the 3rd, the invention provides a kind of nucleic acid binding substances, in conjunction with forming, wherein said first nucleic acid contains the adaptive subsequence that is specific to target molecule, described second single-chain nucleic acid and the complementation of adaptive subsequence part by first nucleic acid and second single-chain nucleic acid that has the certification mark thing for it.The base pairing of the adaptive subsequence top continuous sequence in second single-chain nucleic acid and first nucleic acid and second single-chain nucleic acid and first nucleic acid are combined, thus nucleic acid binding substances of the present invention formed.This nucleic acid binding substances can be included in the test kit of second aspect of the present invention, thereby can be used for carrying out the method for the present invention at the detection aspect first, evaluation and/or quantifying target molecule.As described in first aspect of the present invention, in the nucleic acid binding substances of third aspect of the present invention, preferred first nucleic acid has the immobilization group.Wherein, first nucleic acid can be the single-chain nucleic acid that is connected with the immobilization group; First nucleic acid also can comprise the 3rd single-chain nucleic acid and have the 4th single-chain nucleic acid of immobilization group that described the 3rd single-chain nucleic acid contains adaptive subsequence and catenation sequence, the sequence of described the 4th single-chain nucleic acid and catenation sequence complementation.Described immobilization group comprises antigen or antibody, part or acceptor, preferably vitamin H; Described adaptive son is selected from the adaptive son of microorganism, adaptive son and the micromolecular adaptive son of biomacromolecule, the preferably adaptive son of Cocaine.The certification mark thing that second single-chain nucleic acid has is one or more combinations in radio isotope, chemiluminescent groups, chemiluminescence group, fluorescin, enzyme, antigen or antibody, part or the acceptor, preferably horseradish peroxidase or alkaline phosphatase.
Therefore, aspect the 4th, the invention provides the preparation method of the described nucleic acid binding substances of third aspect of the present invention, comprise first nucleic acid and the second single-chain nucleic acid bonded process of making.Mix first nucleic acid and second single-chain nucleic acid,, can be combined into this nucleic acid binding substances by sequence base pairing complementation.In the specific embodiment of the present invention, add the 4th single-chain nucleic acid, the 3rd single-chain nucleic acid and second single-chain nucleic acid of equimolar amount simultaneously, by sequence base pairing complementation, can be combined into the corresponding nucleic acids binding substances.
In addition, aspect the 5th, the invention provides the application in drug screening, drug testing, drugs detection or food safety detection of the described method in first aspect of the present invention, second described test kit in aspect of the present invention or the described nucleic acid binding substances of third aspect of the present invention.Because the present invention can be used for detection, evaluation and/or quantifying target molecule, therefore the present invention is used in drug screening, drug testing, drugs detect or food safety detection in detect, identify and/or quantitatively can with adaptive sub-bonded material, thereby filter out corresponding drug substance, detect corresponding drug substance, detect corresponding drug materials or detect the corresponding material that influences food safety.
Aspect the 6th, the invention provides used nucleic acid in the above-mentioned several aspects of the present invention.For example, the invention provides the adaptive son of Cocaine, its sequence is GGGAGACAAGGATAAATCCTTCAATGAAGTGGGTCTCCC.In addition, the present invention also provides nucleic acid, single-chain nucleic acid especially, and its sequence is selected from TAGAGCCCTCTG, ATGAGTAGACACT, ACTCATCTGTGAATCTCGGGAGACAAGGATAAATCCTTCAATGAAGTGGGTCTCCC and ACTCATCTGTGA.Above-mentioned nucleic acid can be used for concrete, the actual usefulness of performance in the above-mentioned several aspects of the present invention.
Description of drawings
Fig. 1 is not in conjunction with the adaptive sub-mixture of Cocaine molecule;
The adaptive sub-mixture of Fig. 2 after in conjunction with the Cocaine molecule;
Fig. 3 detects the typical curve of Cocaine with the Cocaine ELISA detection kit of the present invention's preparation.
Embodiment
The preparation of embodiment 1 nucleic acid binding substances:
As shown in Figure 1, entrust the method for DNA Sci-tech Co., Ltd. by chemosynthesis, synthesized single-chain nucleic acid (DNA) ACTCATCTGTGAATCTCGGGGAGACAAGGATAAATCCTTCAATGAAGTGGGTCTCC C, as the 3rd single-chain nucleic acid that contains catenation sequence and the adaptive subsequence of Cocaine; Synthetic second single-chain nucleic acid is enzyme connection DNA, and its sequence is 3 '-TAGAGCCCTCTG-5 ', and its 5 ' end is connected with horseradish peroxidase (HRP); Synthetic the 4th single-chain nucleic acid is biotinylation DNA, and its sequence is 3 '-ATGAGTAGACACT-5 ', and the immobilization group is vitamin H, is marked at 3 ' end of the 4th single-chain nucleic acid.
The 3rd single-chain nucleic acid, 1umol/L biotinylation DNA and the 1umol/L enzyme connection DNA three of 1umol/L being contained catenation sequence and the adaptive subsequence of Cocaine respectively get the 1ml mixing under 25 ℃, because three's complementation, can interosculate becomes adaptive sub-mixture.After this mixture lyophilize, standby in 4 ℃ of prolonged preservation.
The detection of embodiment 2 Cocaines:
Earlier with avidin (Streptavidin) the 100ul/ hole of 1ug/ml, by in the micropore of microtiter plate, and it is standby to seal after drying with bovine serum albumin (BSA) with the ordinary method bag.
When detecting, with cryodesiccated adaptive sub-mixture dissolving, concentration 50pmol/L gets the 100ul amount and joins bag by in the micropore of avidin, adds the detected sample of 50 ul again with the PBS damping fluid.Because on the adaptive sub-mixture vitamin H is arranged, the combination that it can be quick and special with the avidin in the micropore is fixed in the micropore adaptive sub-mixture.Static 5 minutes,, remove the adaptive sub-mixture that some do not adsorb by damping fluid washing micropore.Then in micropore, add 100ul by DAB (diaminobenzidine) and hydrogen peroxide urea formulated developer.Developer can demonstrate color under the effect of HRP.Test contains the sample of different concns Cocaine respectively, and as shown in Figure 3, the depth of color is measured with HRP in the micropore and is directly proportional, and can make typical curve in view of the above.The sensitivity that this test kit detects can reach 0.15ng/ml.
If the sample in the adding micropore does not contain Cocaine, enzyme connection DNA will continue to combine with adaptive son is complementary, be fixed in the micropore.Also promptly there is the adaptive son of how many Cocaines to be fixed in the micropore, just has horseradish peroxidase (HRP) molecule of equivalent to be fixed on (as shown in Figure 1) in the micropore.And if the sample that adds in the micropore contains a certain amount of Cocaine, the adaptive son of Cocaine will with the combination of free Cocaine molecule, form the neck ring structure Cocaine molecule is wrapped in the middle of (as shown in Figure 2).Wherein 3 ' of adaptive son end and 5 ' is complementary bonded, thereby has substituted enzyme connection DNA and adaptive sub-bonded part.At this moment enzyme connection DNA be connected DNA and have only 5 base complementrities, its bonding force can not join enzyme dna molecular and be fixed on the adaptive sub-mixture, makes enzyme join dna molecular and comes off from mixture.Like this, by how many Cocaine molecules and adaptive sub-combination, just have how many enzyme connection dna moleculars to come off from adaptive sub-mixture, so the Cocaine molecular conecentration is high more in the sample, the enzyme connection dna molecular that comes off is many more.Through washings flush away free enzyme connection dna molecular, behind the adding colour developing liquid, the HRP on the remaining adaptive sub-mixture can make the substrate variable color.But color is than shallow under the situation that does not have Cocaine in the sample.Like this, cause in the sample Cocaine concentration high more, the color of micropore is shallow more; Cocaine concentration in the sample is low more, and the color in the micropore is dark more.Be that sample concentration is inversely proportional to the absorbancy that finally obtains with the microplate reader detection.Similar with the competitive ELISA method.Absorbancy by the concentration known standard substance obtains typical curve, can calculate the concentration of sample again from typical curve with the absorbancy of sample.
At last, it is also to be noted that what more than enumerate only is a specific embodiment of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be arranged.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention all should be thought protection scope of the present invention.
Claims (10)
- The method of 1, a kind of detection, evaluation and/or quantifying target molecule is characterized in that may further comprise the steps:(a), first nucleic acid is provided and has second single-chain nucleic acid of certification mark thing, described first nucleic acid contains the adaptive subsequence that is specific to target molecule, the sequence of described second single-chain nucleic acid and adaptive subsequence part are complementary, complementary amount accounts for 5%～50% of total amount;(b), mix first nucleic acid, second single-chain nucleic acid and to be detected, evaluation and/or quantified sample;(c), detect and to combine with first nucleic acid or the certification mark thing of unconjugated second single-chain nucleic acid.
- The method of 2, detection according to claim 1, evaluation and/or quantifying target molecule is characterized in that: described first nucleic acid is the single-chain nucleic acid that is connected with the immobilization group; Perhaps first nucleic acid comprises the 3rd single-chain nucleic acid and the 4th single-chain nucleic acid that has the immobilization group, and described the 3rd single-chain nucleic acid contains adaptive subsequence and catenation sequence, the sequence of described the 4th single-chain nucleic acid and above-mentioned catenation sequence complementation.
- The method of 3, detection according to claim 1 and 2, evaluation and/or quantifying target molecule is characterized in that: described certification mark thing is at least a in radio isotope, chemiluminescent groups, chemiluminescence group, fluorescin, enzyme, antigen, antibody, part or the acceptor; Described immobilization group is antigen, antibody, part or acceptor; Described adaptive son is the adaptive son of microorganism, adaptive son or the micromolecular adaptive son of biomacromolecule.
- The test kit of 4, a kind of detection, evaluation and/or quantifying target molecule, it is characterized in that: described test kit comprises first nucleic acid and has second single-chain nucleic acid of certification mark thing, described first nucleic acid contains the adaptive subsequence that is specific to target molecule, the sequence of described second single-chain nucleic acid and adaptive subsequence part are complementary, and complementary amount accounts for 5%～50% of total amount.
- 5, test kit according to claim 4 is characterized in that: described first nucleic acid is the single-chain nucleic acid that is connected with the immobilization group; Perhaps first nucleic acid comprises the 3rd single-chain nucleic acid and the 4th single-chain nucleic acid that has the immobilization group, and described the 3rd single-chain nucleic acid contains adaptive subsequence and catenation sequence, the sequence of described the 4th single-chain nucleic acid and above-mentioned catenation sequence complementation.
- 6, test kit according to claim 5 is characterized in that: described certification mark thing is at least a in radio isotope, chemiluminescent groups, chemiluminescence group, fluorescin, enzyme, antigen, antibody, part or the acceptor; Described immobilization group is antigen, antibody, part or acceptor; Described adaptive son is the adaptive son of microorganism, adaptive son or the micromolecular adaptive son of biomacromolecule.
- 7, a kind of nucleic acid binding substances, it is characterized in that: described nucleic acid binding substances is by first nucleic acid and have second single-chain nucleic acid of certification mark thing in conjunction with forming, described first nucleic acid contains the adaptive subsequence that is specific to target molecule, the sequence of second single-chain nucleic acid and adaptive subsequence part are complementary, and complementary amount accounts for 5%～50% of total amount.
- 8, nucleic acid binding substances according to claim 7 is characterized in that: described first nucleic acid is the single-chain nucleic acid that is connected with the immobilization group; Perhaps first nucleic acid comprises the 3rd single-chain nucleic acid and the 4th single-chain nucleic acid that has the immobilization group, and described the 3rd single-chain nucleic acid contains adaptive subsequence and catenation sequence, the sequence of described the 4th single-chain nucleic acid and above-mentioned catenation sequence complementation.
- 9, nucleic acid binding substances according to claim 8 is characterized in that: described certification mark thing is at least a in radio isotope, chemiluminescent groups, chemiluminescence group, fluorescin, enzyme, antigen, antibody, part or the acceptor; Described immobilization group is antigen, antibody, part or acceptor; Described adaptive son is the adaptive son of microorganism, adaptive son or the micromolecular adaptive son of biomacromolecule.
- 10, as any one test kit in the claim 4～6 or as the purposes of any one nucleic acid binding substances in the claim 7～9: can be applied to drug screening, drug testing, drugs and detect or food safety detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200710067163A CN101012483B (en) | 2007-02-02 | 2007-02-02 | Checking reagent containing nucleic acid gamete and method for making same and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200710067163A CN101012483B (en) | 2007-02-02 | 2007-02-02 | Checking reagent containing nucleic acid gamete and method for making same and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101012483A true CN101012483A (en) | 2007-08-08 |
| CN101012483B CN101012483B (en) | 2010-05-26 |
Family
ID=38700211
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200710067163A Expired - Fee Related CN101012483B (en) | 2007-02-02 | 2007-02-02 | Checking reagent containing nucleic acid gamete and method for making same and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101012483B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101915830A (en) * | 2010-07-19 | 2010-12-15 | 江南大学 | Ochratoxin A fluorescence detection test strip and application thereof |
| CN102128926A (en) * | 2010-12-06 | 2011-07-20 | 武汉大学 | Double-adaptor kit and use thereof of in detection of tubercule bacillus antigen |
| CN104745586A (en) * | 2013-12-27 | 2015-07-01 | 上海市刑事科学技术研究院 | Cocaine aptamer, detection kit and application thereof |
| CN113945720A (en) * | 2021-09-26 | 2022-01-18 | 瑞博奥(广州)生物科技股份有限公司 | PDGF-BB recognition method based on aptamer probe and PDGF-BB detection kit |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060257915A1 (en) * | 2005-05-13 | 2006-11-16 | Pronucleotein Biotechnologies, Llc | Methods of producing competitive aptamer fret reagents and assays |
-
2007
- 2007-02-02 CN CN200710067163A patent/CN101012483B/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101915830A (en) * | 2010-07-19 | 2010-12-15 | 江南大学 | Ochratoxin A fluorescence detection test strip and application thereof |
| CN102128926A (en) * | 2010-12-06 | 2011-07-20 | 武汉大学 | Double-adaptor kit and use thereof of in detection of tubercule bacillus antigen |
| CN104745586A (en) * | 2013-12-27 | 2015-07-01 | 上海市刑事科学技术研究院 | Cocaine aptamer, detection kit and application thereof |
| CN104745586B (en) * | 2013-12-27 | 2020-02-04 | 上海市刑事科学技术研究院 | Cocaine aptamer, detection kit and application thereof |
| CN113945720A (en) * | 2021-09-26 | 2022-01-18 | 瑞博奥(广州)生物科技股份有限公司 | PDGF-BB recognition method based on aptamer probe and PDGF-BB detection kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101012483B (en) | 2010-05-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10732111B2 (en) | Automated immunoanalyzer system for performing diagnostic assays for allergies and autoimmune diseases | |
| US9476874B2 (en) | Analyte detection | |
| JP2913281B2 (en) | Assay analyzer | |
| US8956823B2 (en) | Anti-antibody reagent | |
| AU620872B2 (en) | Visual discrimination qualitative enzyme assay | |
| CN101144814A (en) | Method for detecting, identifying and/ or quantifying compound using adapter type reagent | |
| CN105785043B (en) | For quantitatively detecting AFP L3% kit | |
| CN102893151B (en) | Complex of labeled probe and water-soluble carrier | |
| CN101609090A (en) | A kind of employing acridinium ester labelled antigen or antibody analysis method | |
| CN101438163A (en) | Detection of target molecules in a sample by using a magnetic field | |
| CN109298177A (en) | Time-resolved fluorescence immunoassay method based on Magneto separate | |
| CN101012483B (en) | Checking reagent containing nucleic acid gamete and method for making same and use | |
| US20200209230A1 (en) | Methods and compositions relating to small molecule analyte assays | |
| CN101957369A (en) | The enhancing mark conjugate that is used for immunoassays | |
| CN101782570A (en) | Biomolecule competition analysis method and application thereof | |
| CA2111555A1 (en) | Mixed luminescent conjugate test assays | |
| FI111194B (en) | Dual-position immunoassay for an antibody using chemiluminescent chips and biotin-bound ligand | |
| CN108663513B (en) | A method of reducing Sidestream chromatography test paper detection limit | |
| JP6832160B2 (en) | Control for performing multiplex analysis | |
| CN109298178A (en) | Cardiac myosin binding protein C(cMyBP-C based on immunomagnetic beads) time-resolved fluoroimmunoassay kit | |
| US20160025753A1 (en) | Assay for cannabinoids and methods of use thereof | |
| CN106248943A (en) | Antinuclear antibody chemiluminescence immune detection reagent kit and preparation method thereof | |
| CN1312477C (en) | Different impedance series immunological micro ball and preparing method, method and device for detecting the same | |
| KR101402316B1 (en) | ELAAS (Enzyme-linked Antibody Aptamer Sandwich) Method of Detecting Adipokines Using Necleic Acid Aptamer and Antibody | |
| US20020127741A1 (en) | Free Analyte detection system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100526 Termination date: 20130202 |