CN104745580B - SiRNA, recombinant vector and the purposes of the CDT1 genes of silence people - Google Patents
SiRNA, recombinant vector and the purposes of the CDT1 genes of silence people Download PDFInfo
- Publication number
- CN104745580B CN104745580B CN201310749531.6A CN201310749531A CN104745580B CN 104745580 B CN104745580 B CN 104745580B CN 201310749531 A CN201310749531 A CN 201310749531A CN 104745580 B CN104745580 B CN 104745580B
- Authority
- CN
- China
- Prior art keywords
- cdt1
- sirna
- genes
- recombinant vector
- people
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to the siRNA of the CDT1 genes of silence people, have such as any sequence of SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.The present invention also provides the siRNA recombinant vectors of the CDT1 genes containing above-mentioned silence people and the siRNA of the CDT1 genes containing above-mentioned silence people, the purposes of recombinant vector.SiRNA, the recombinant vector of the CDT1 genes of silence people provided by the invention can provide effective technical tool for the research of the CDT1 gene functions of people.
Description
Technical field
The invention belongs to molecular biology and biopharmaceutical technology, and in particular to the CDT1 genes of silence people
SiRNA, recombinant vector and purposes.
Background technology
RNAi is a kind of posttranscriptional gene silencing mechanism, it causes the mRNA of sequence homology to drop by double-stranded RNA (dsRNA)
Solution, to reduce the expression of target gene, this phenomenon is conservative and extensive during evolution.RNAi technology comes at present
Many fields of bioscience research, become a kind of main biological research tool, for analysis gene function and signal
Conduction path and gene therapy provide a kind of new research means, and the Nobel Prize was obtained in 2006.RNAi has following
Characteristic superiority：1. the specificity of effect, only pair mRNA homologous with it generation inhibiting effect, base mispairing can substantially reduce inhibition
Efficiency；2.RNAi has altitude validity, and the siRNA of relatively small amount can almost inhibit the expression of target gene.In work
A kind of method that " siRNA (siRNA) " is conveyed in body cell is to be cloned into plasmid using siRNA sequence as " bob folder "
Carrier.When being sent into cell body, which is expressed, and forms a double-stranded RNA（shRNA）, and led to by RNAi
Road processing is attached to RNA induction silencing complex later（RNA-induced silencing complex, RISC）, it is this multiple
Close object can combine and cut with the matched mRNA of siRNA sequence, cause mRNA that can not translate into corresponding protein, final silence
The expression of corresponding albumen in cell.ShRNA includes two short inverted repeats, and centre is stem ring（loop）Sequence, reversely
Repetitive sequence forms a hairpin structure with stem ring sequence.
The CDT1 assignments of genes gene mapping have 10 extrons, encode 65kDa protein, include 546 in No. 16 chromosome long arms
Amino acid, it participates in the regulation and control of cell cycle, is a kind of important cell cycle correlation factor.Cell cycle is by four not same orders
Duan Zucheng：The G1 phases（Gap1）, the S phases（DNA is synthesized）, the M phases（Mitosis）And the G2 phases（Gap2）.CDT1 can be tied in the G1 phases
Chromosome is closed, recruitment other signals molecule, which is formed, replicates precursor Pre-RC, starts DNA replication dna, and duplication starts rear again from chromosome
On split away off and inactivate, arrive until next G1 phases, be that DNA replication dna originates essential ingredient.Research shows that CDT1
For Genome stability is maintained to have very important effect, the regulation and control of CDT1 will be not normal to be caused the cell cycle for the adjusting of activity
Disorder.
It was discovered by researchers that the cell of CDT1 quantity exception, such as cancer cell, it may appear that replicate and mitosis is dual asks
Topic, the high expression of CDTl is in fission yeast and human cell's moderate stimulation cell repeat replication, in H1299 lung carcinoma cells, CDTl
Overexpression be enough to cause the multiple copies of the cell in the same cell cycle.CDT1 is also possible to the formation phase with cancer
It closes, the high expression in a variety of cancer cells, the relationship of the gene and cancer needs further to be studied.
Invention content
For the needs of gene studies, it is an object of the present invention to provide a kind of siRNA of the CDT1 genes of silence people.
Second object of the present invention is to provide the purposes of the siRNA of the CDT1 genes of above-mentioned silence people.
Third object of the present invention is to provide a kind of recombinant vector of the siRNA of the CDT1 genes of silence people.
Fourth object of the present invention is to provide the purposes of the recombinant vector of the siRNA of the CDT1 genes of above-mentioned silence people.
To achieve the above objectives, the technical solution adopted by the present invention is：The siRNA of the CDT1 genes of silence people has such as
Any sequence of SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.
The recombinant vector of the siRNA of the CDT1 genes of silence people provided by the invention, the CDT1 containing the silence people
The siRNA of gene.
Further, the recombinant vector is built using two-step method, specific method is：The first step, iii vitro chemical synthesis CDT1
The siRNA expression templates of gene are single-stranded, and annealing in annealing buffer forms double-stranded DNA；Double-stranded DNA is cloned by second step
Expression vector, so as to be built into recombinant vector.
Further, the expression vector is siRNA carrier for expression of eukaryon Psilencer2.1-U6, pGCsi-U6/Neo/
GFP, pGenesil-1.1 or slow virus carrier pGC-LV.
The siRNA of CDT1 gene expressions of energy effective reticence people provided by the present invention and the recombination containing the siRNA carry
Body, the research for people's CDT1 gene functions provide effective technical tool.
Description of the drawings
Fig. 1 shows the expression of CDT1 gene mRNA levels, wherein ordinate represents the phase of CDT1 gene mRNA levels
To expression quantity, abscissa 7702-NC represents control group（Liver cell therein has transfected the recombinant plasmid of the sequence containing random controls
LV-NC-RNAi）, 7702-CDT1/n（n：1、2、3）Represent experimental group（Liver cell therein has transfected recombinant plasmid LV-CDT1-
RNAi/n（n：1、2、3））.
Specific embodiment
Hereinafter reference will be made to the drawings, and the preferred embodiment of the present invention is described in detail.It is not specified in preferred embodiment
The experimental method of actual conditions, usually according to normal condition, such as Molecular Cloning:A Laboratory guide (third edition, J. Pehanorm Brookers
Deng writing, Huang Peitang etc. is translated, Science Press, 2002) described in condition or according to the normal condition proposed by manufacturer.
Embodiment 1
The present embodiment is used for the construction method for illustrating the siRNA of the CDT1 genes of silence people provided by the invention.
According to the nucleotide sequence of CDT1 genes reported in Genbank, three suppressions are designed with reference to siRNA design principles
The siRNA target sequences of CDT1 gene expressions processed, respectively SEQ ID NO：1-3, while design random controls sequence SEQ ID
NO.4, it is as follows：
SEQ ID NO.1：GGACACCATCTCTGAGCTT；
SEQ ID NO.2：GGAGGTCAGATTACCAGCT；
SEQ ID NO.3：CCTACGTCAAGCTGGACAA;
SEQ ID NO.4：TTCTCCGAACGTGTCACGT.
Through Blast Genetic homology of carbapenem-resistant, SEQ ID NO：1-3 sequences are not same with the non-CDT1 gene orders of any mankind
Source, to ensure the specificity of gene inhibition.
For above-mentioned target sequence, with reference to the layout strategy of siRNA, four couples of shRNA (short hairpin are separately designed
RNA, shRNA) expression framework DNA sequences（SEQ ID NO.1’-3’）, it is as follows：
SEQ ID NO.1’：
Positive-sense strand (RNAi-1F)：
5’-ccgg CAGGACACCATCTCTGAGCTT CTCGAG AAGCTCAGAGATGGTGTCCTG TTTTTg-3’
Antisense strand (RNAi-1R)：
5’-aattcaaaaa CAGGACACCATCTCTGAGCTT CTCGAG AAGCTCAGAGATGGT GTCCTG-3’
SEQ ID NO.2’：
Positive-sense strand (RNAi-2F)：
5’-ccgg CAGGAGGTCAGATTACCAGCT CTCGAG AGCTGGTAATCTGACCTCCTG TTTTTg-3’
Antisense strand (RNAi-2R)：
5’-aattcaaaaa CAGGAGGTCAGATTACCAGCT CTCGAG AGCTGGTAATCTG ACCTCCTG-3’
SEQ ID NO.3’：
Positive-sense strand (RNAi-3F)：
5’-ccgg CACCTACGTCAAGCTGGACAA CTCGAG TTGTCCAGCTTGACGTAGGTG TTTTTg-3’
Antisense strand (RNAi-3R)：
5’-aattcaaaaa CACCTACGTCAAGCTGGACAA CTCGAG TTGTCCAGCTTGA CGTAGGTG-3’
SEQ ID NO.4’：
Positive-sense strand (control-F)：5’-ccgg CA TTCTCCGAACGTGTCACGT CTCGAG
ACGTGACACGTTCGG
AGAA TG TTTTTg-3’
Antisense strand (control-R)：5’-aattcaaaaa CA TTCTCCGAACGTGTCACGT CTCGAG
ACGTGACACG
TTCGGAGAA TG-3’
Using the positive-sense strand and antisense strand for being chemically synthesized siRNA sequence expression cassette SEQ ID NO.1 ' -4 ', sequence
Middle CTCGAG is loop ring sequences, and TTTTT is transcription terminator.
SEQ ID NO.1 ' -4 ' are formed after transcribing in vivo and are included SEQ ID NO.1-4 by loop stem rings of CTCGAG
SiRNA hairpin structures, cut in vivo respectively generate sequence be SEQ ID NO.1-3 CDT1 siRNAs and sequence be
The control siRNA of SEQ ID NO.4.
Embodiment 2
The present embodiment is used for the structure side for illustrating the recombinant vector of the siRNA of the CDT1 genes of silence people provided by the invention
Method.
Carrier uses slow virus carrier pGC-LV（Purchased from Shanghai JiKai Gene Chemical Technology Co., Ltd）.Its frame structure
For：
hU6-MCS-Ubiquitin-EGFP-IRES-puromycin。
The construction method of recombinant vector is as follows：
Respectively by the positive-sense strand of 4 couples of shRNA expression framework DNA sequences SEQ ID NO.1 ' -4 ' of siRNA in embodiment 1
And antisense strand is in annealing buffer（10mM Tris-HCl, 1mM EDTA, 0.1mM NaCl）90 DEG C of water-bath 15min are then natural
It is cooled to room temperature, reacts synthetic dsdna（dsDNA）Sequence by double chain DNA sequence I digestion of EcoR I and Age, utilizes simultaneously
I digestion slow virus carrier pGC-LV of EcoR I and Age makes it generate the cohesive end identical with double chain DNA sequence, utilizes T4DNA
The slow virus carrier and DNA fragmentation that ligase linearizes double digestion are stayed overnight in 16 DEG C of connections.Connection product transformed competence colibacillus is thin
Born of the same parents DH5 α, picking transformant are resuspended in LB culture mediums, and 1 μ L is taken to identify positive colony by PCR as template.PCR is screened
Positive colony student on commission's work bioengineering of identification（Shanghai）Limited company's sequencing identification, sequencing result further screen weight
Group carrier.The recombinant vector of structure can direct transfection eukaryocyte, can be used for the packaging of slow virus.Build the recombination obtained
Carrier is expressed as LV-CDT1-RNAi/n（n：1、2、3）.
The recombinant plasmid LV-NC-RNAi containing random controls sequence is obtained in the same way, as control.
Embodiment 3
The present embodiment is used for liver of the recombinant vector to people for illustrating the siRNA of the CDT1 genes of silence people provided by the invention
The inhibiting effect of the CDT1 gene expressions of cell HL-7702.
1st, cell culture
Human normal hepatocyte HL-7702 in good condition is inoculated in 6 porocyte culture plates, containing 20% (v/v) calf
In the RPMI1640 culture mediums of serum, 100U/ml penicillin and 100mg/L streptomysins (U.S., Invitrogen companies), in 37
℃、5%(v/v)CO2Under the conditions of cultivate, treat that cell fusion degree reaches about 80%.
Meanwhile the cell cultivated is divided into 4 groups, respectively 3 groups of experimental groups and 1 group of control group.
2nd, gene transfects
Transfection procedure is carried out according to Invitrogen Lipofectamine2000 transfection reagents specification：By culture solution more
It changes 1640 culture mediums that 2ml is free of serum into, 4.0 μ g plasmids and 10 μ l Lipofectamine2000 is taken to be dissolved separately in 250 μ
In 1640 culture mediums of l serum-frees, mixing is stored at room temperature 5min, then by plasmid-culture medium, Lipofectamine2000-
Culture medium mixed liquor is uniformly mixed, and is placed at room temperature for 20min, is then added in mixed liquor in HL-7702 cells, 37 DEG C, 5% (v/v)
CO2Under the conditions of after culture 12h, change the complete medium containing fresh 20% (v/v) serum into, fluorescent marker is observed in transfection afterwards for 24 hours
The expression of gene judges transfection efficiency, transfects and collects cell after 48h and carry out fluorescence quantitative PCR detection.
3rd, total RAN extractions
The liver cell of corresponding experimental group and control group, after pancreatin digestion, 1000rpm centrifugation 5min go supernatant, cell precipitation
Middle addition 1mlTriol（Invitrogen companies）, 5min is stored at room temperature after rapid piping and druming, is then transferred to new 1.5ml
In eppendorf pipes, often pipe adds in 200 μ l chloroforms, is turned upside down 15sec with hand, is stored at room temperature 10min, 4 DEG C, 12000rpm,
15min is centrifuged, is drawn in supernatant to new eppendorf pipes, adds in the isopropanol being pre-chilled in equal volume, is precipitated for 4 DEG C after mixing
10min then 4 DEG C, after 12000rpm centrifuges 10min, removes supernatant, adds at least 1ml75% (v/v) ethyl alcohol, and washing precipitates, and 4
DEG C, 10000rpm centrifugation 10min discard supernatant, drying at room temperature, then add in 20 μ l RNase-free water dissolutions.
4th, the preparation of cDNA and quantitative fluorescent PCR
The method that reverse transcription obtains cDNA：Using TaKaRa companies PrimeScript RT Master Mix kits into
The preparation of row cDNA, reaction system are 10 μ l：5 × PrimeScript RT Master Mix2 μ l, RNA500ng, use RNase
Free water supplies system.Reaction condition is：37℃15min（Reverse transcription reaction）, 85 DEG C of 15sec (（The inactivation of reverse transcriptase is anti-
It should）, 4 DEG C of preservations.
Quantitative fluorescent PCR：Using the II real-time kits of SYBR Premix Ex Taq of TaKaRa companies, in real time
The expression of fluorescence quantitative PCR detection CDT1 gene mRNA levels.CDT1 gene PCR primers are：Forward Primer（5'-
GCGTAGGCGTTTTGAGGAGT-3'）, Reverse Primer (5'-ACCTCCTGGTGCCATCCTT-3'), selected internal reference base
Because of people's beta-actin genes, beta-actin gene primers are：Forward Primer（5'-
TAGTTGCGTTACACCCTTTCTTG-3'）, Reverse Primer (5'-TCACCTTCACCGTTCCAGTTT-3').Reaction
System is 25 μ l：12.5 μ l, Forward Primer of SYBR Premix Ex Taq II (2 ×)（10μM）1μl,Reverse
Primer（10μM）1 μ l, cDNA template 2 μ l, sterile water 8.5ul.Reaction condition：95℃30sec（1 cycle）；95 DEG C of 5sec,
60℃30sec（40 cycles）.
5th, result：
Real-time fluorescence quantitative PCR uses Comparative Delta-delta Ct methods, with house-keeping gene beta-actin
For internal reference, the expression of relative quantification CDT1 genes.Computational methods are：
F=2-[（Measuring samples target gene Average Ct values-measuring samples house-keeping gene Average Ct values）-（Control sample target gene Average Ct values-control sample house-keeping gene Average Ct values）]
The CDT1 gene mRNA levels relative expression quantities of the experimental group measured and the liver cell of control group are aggregated into Fig. 1
On.
From Fig. 1 as can be seen that through transfected plasmids LV-CDT1-RNAi/n（n：1、2、3）In liver cell, CDT1 genes
MRNA expressions are remarkably decreased compared with control group liver cell, illustrate that the siRNA of the CDT1 of the present invention can be efficiently specific
Ground inhibits the expression of liver cell CDT1 genes.
It can also be seen that the silencing efficiency of the CDT1 genes of the experimental group of transfected plasmids LV-CDT1-RNAi/3 from Fig. 1
Preferably, therefore when preparing the cell model of liver cell CDT1 genes of silence people, it is most effective that SEQ ID NO.3, which may be selected,
People's CDT1 gene siRNA sequences.
Above-described embodiment is for example, the present invention can also be with other ad hoc fashions or others to the present invention
Particular form is implemented, without departing from the gist of the invention or substantive characteristics.Therefore, from the point of view of the embodiment of description is in terms of any
It is regarded as illustrative and non-limiting.The scope of the present invention should illustrate by appended claims, any and claim
Intention and the equivalent variation of range should also be included in the scope of the present invention.
Claims (7)
1. the siRNA of the CDT1 genes of silence people, which is characterized in that its sequence is SEQ ID NO.1, SEQ ID NO.2 or SEQ
Any sequence of ID NO.3.
2. use of the siRNA of the CDT1 genes of silence people described in claim 1 in CDT1 gene silencing cell models are prepared
On the way.
3. the recombinant vector of the siRNA of the CDT1 genes of silence people, which is characterized in that the recombinant vector contains claim 1
The siRNA of the CDT1 genes of the silence people.
4. recombinant vector according to claim 3, which is characterized in that the recombinant vector is built using two-step method, specifically
Method is：The first step, the siRNA expression templates of iii vitro chemical synthesis CDT1 genes are single-stranded, anneal and formed in annealing buffer
Double-stranded DNA；The double-stranded DNA of formation is cloned into expression vector, so as to be built into recombinant vector by second step.
5. recombinant vector according to claim 4, which is characterized in that the expression vector is siRNA carrier for expression of eukaryon
Psilencer2.1-U6, pGCsi-U6/Neo/GFP, pGenesil-1.1 or slow virus carrier pGC-LV.
6. the recombinant vector of the siRNA of the CDT1 genes of any silence people of claim 3-5 sinks in preparation CDT1 genes
Purposes in silent cell model.
7. purposes according to claim 6, which is characterized in that the recombinant vector of the siRNA of the CDT1 genes of silence people exists
Prepare the purposes in the cell model of the liver cell CDT1 genes of silence people.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310749531.6A CN104745580B (en) | 2013-12-31 | 2013-12-31 | SiRNA, recombinant vector and the purposes of the CDT1 genes of silence people |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310749531.6A CN104745580B (en) | 2013-12-31 | 2013-12-31 | SiRNA, recombinant vector and the purposes of the CDT1 genes of silence people |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104745580A CN104745580A (en) | 2015-07-01 |
| CN104745580B true CN104745580B (en) | 2018-07-06 |
Family
ID=53585839
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310749531.6A Active CN104745580B (en) | 2013-12-31 | 2013-12-31 | SiRNA, recombinant vector and the purposes of the CDT1 genes of silence people |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104745580B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114452391B (en) * | 2022-01-28 | 2023-08-25 | 深圳市泰尔康生物医药科技有限公司 | Application of CDK16 as target in preparation of medicine for treating triple negative breast cancer |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1798579A (en) * | 2003-04-01 | 2006-07-05 | 因特拉迪格姆公司 | Targets for tumor growth inhibition |
| WO2008073922A2 (en) * | 2006-12-08 | 2008-06-19 | Asuragen, Inc. | Functions and targets of let-7 micro rnas |
-
2013
- 2013-12-31 CN CN201310749531.6A patent/CN104745580B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1798579A (en) * | 2003-04-01 | 2006-07-05 | 因特拉迪格姆公司 | Targets for tumor growth inhibition |
| WO2008073922A2 (en) * | 2006-12-08 | 2008-06-19 | Asuragen, Inc. | Functions and targets of let-7 micro rnas |
Non-Patent Citations (2)
| Title |
|---|
| Inhibitory action of polyunsaturated fatty acids on Cdt1-geminin interaction;Mizushina Yoshiyuki等;《INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE》;20080531;第21卷(第3期);第281-290页 * |
| 细胞周期相关因子cdt1和genimin的平衡;文川等;《医学与哲学（临床决策论坛版）》;20070331;第28卷(第3期);第43-44页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104745580A (en) | 2015-07-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104745580B (en) | SiRNA, recombinant vector and the purposes of the CDT1 genes of silence people | |
| CN113416768A (en) | Application of PRKRA gene as target in inhibiting replication of peste des petits ruminants virus | |
| CN106167822A (en) | A kind of long-chain non-coding RNA and application thereof | |
| CN102747038B (en) | NOX4 knock-down A375 stably-transfected cell line and construction method thereof | |
| CN111808858B (en) | siRNA sequence and application of target thereof in improving PEDV (porcine reproductive and respiratory syndrome Virus) toxicity | |
| CN105002181B (en) | A kind of rat Kif11 genes interference shRNA and its recombinant adeno-associated virus and antitumor application thereof | |
| CN104745579B (en) | SiRNA, recombinant vector and the purposes of the RAN genes of silence people | |
| CN104388430B (en) | Target siRNA and its application of people's protein disulfide bond isomerase gene | |
| CN102229928B (en) | Small-interfering RNA (Ribonucleic Acid) of human RBBP6 (Retinoblastoma-binding Proteingene) and application thereof | |
| CN103103189B (en) | Novel method for overexpression of single MicroRNA (Micro Ribonucleic Acid) mature body sequence | |
| CN107760717B (en) | Sheep TNPO1 gene dual-luciferase reporter gene vector and construction method and application thereof | |
| CN105734058B (en) | SiRNA, recombinant vector and the purposes of the HAVCR2 gene of silencing people | |
| Patutina et al. | Search for oligonucleotides selectively binding oncogenic miR-21 | |
| CN103937745B (en) | People A375 stable cell strain and the construction method of long-chain non-coding GAS5 defect | |
| CN111575281A (en) | Nucleic acid molecule for regulating CDIP1 gene expression, regulating method and use | |
| CN107988311A (en) | The detection method that the UCA1 and UCA1a consensus sequences of LncRNA influence transitional cell bladder carcinoma cell line biological function | |
| CN111411155B (en) | Application of lncRNA IGFL2-AS1 AS colon cancer diagnosis marker | |
| CN101864444B (en) | Construction of 21ShRNA fluorescent expression vector of long-term silencing esophageal cancer cell HIF-1Alpha gene | |
| CN103898137B (en) | One kind containing plasmid and its application of 3 ' UTR sequence of MALAT1 gene and luciferase reporter gene | |
| CN102041270B (en) | Construction and screening of siRNAs (small interfering RANs) expression vectors of gastric cancer targeted DEC1 (differentiated embryo-chondrocyte expressed gene 1) and application thereof | |
| CN116832162A (en) | Application of CD244 in serving as gene editing target for resisting African swine fever | |
| CN101864443A (en) | Construction of gene 29 shRNA (Short Hairpin RNA) expression vector of silent esophageal carcinoma cell HIF-1 alpha (Hypoxia-Inducible Factor 1 alpha) | |
| WO2021037264A1 (en) | Sirna for inhibiting mcm7 gene expression, composition and application thereof | |
| CN103952413A (en) | Construction and application of IFNAR2 gene-targeting RNA interference expression vector | |
| CN103898118A (en) | siRNA for inhibiting expression of human myofilament binding protein 1L2 gene and expression vector and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |