CN101864443A - Construction of gene 29 shRNA (Short Hairpin RNA) expression vector of silent esophageal carcinoma cell HIF-1 alpha (Hypoxia-Inducible Factor 1 alpha) - Google Patents

Abstract

The invention discloses construction of a gene 29 shRNA (Short Hairpin RNA) expression vector of a silent esophageal carcinoma cell HIF-1 alpha (Hypoxia-Inducible Factor 1 alpha), comprising the following steps of: predictably designing an siRNA (Small Interfer RNA) interference sequence by utilizing WHITEHOUSE, SiDirect and RationalsiRNA Design software according to an HIF-1 alpha gene ID obtained from an NCBI (National Center of Biotechnology Information) database, and analyzing the homology of the siRNA interference sequence and a human genome by utilizing BLAST; converting the siRNA interference sequence into a DNA sequence encoding shRNA, and then cloning into a pENTRTM/HI/TO vector. The invention successfully constructs the gene shRNA expression vector of the HIF-1 alpha and effectively inhibits the expression of the esophageal carcinoma cell HIF-1 alpha, thereby providing a new material for the development and the gene therapy of a new esophageal carcinoma drug taking the HIF-1 alpha as a target.

Description

The structure of silencing esophageal cancer cell HIF-1 Alpha gene 29ShRNA expression vector

Technical field

The present invention relates to the biological medicine technology field, a kind of structure of silencing esophageal cancer cell HIF-1 Alpha gene 29shRNA expression vector especially is provided.

Background technology

The human middle and advanced stage carcinoma in situ that surpasses half has the oxygen-starved area, and oxygen concn reduces greatly than normal surrounding tissue.For example, human breast cancer averaged oxygen dividing potential drop is 10mmHg, and normal galactophore tissue is 65mmHg.The interior anoxic of solid tumor is not only because of the tumour fast breeding, and because blood vessel structure and dysfunction make tumour can not get enough nutrition and oxygen.Anoxic can be brought serious survival pressure to cell, and oxygen balance needs the collaborative adjusting of series of genes.In the broad variety cell, the expression of adjustable transcription complex oxygen deficient induction factor 1 (HIF-1) when oxygen level reduces, the HIF-1 activity is regulated and control by cell levels HIF-1 α subunit, and it and HIF-1 β (HIF-1 β) dimerization form interactive transcriptional factor.HIF-1 is difficult to detect in normal oxygen cell; be activated very soon under the anoxybiotic condition; its expression of target gene of HIF-1 activation back raises; induce most apoptosis cell protective reactions; as anti-hypoxia, ischemia resisting or anti-damage; promptly induce the genetic expression of erythropoietin, vascular endothelial growth factor and other vasculogenesis correlation factor; induce carbohydrate metabolism and glucose transport Expression of Related Genes; thereby help to improve the cytotrophy poor environment, it is reported that HIF-1 can activate nearly more or less a hundred target gene.

The activation phenomenon that not only has HIF-1 α in the esophageal carcinoma, and HIF-1 α protein expression level and patient are negative correlation at the survival time.(Photodynamic therapy, PDT) Zhi Liao oesophagus early cancer clinical samples discovers that HIF-1 α influences the PDT curative effect to utilizing photodynamics.

RANi is the ubiquitous biological phenomenon that causes gene silencing of nature.1998, Fire A etc. proposed the RNA interference theory first.Its ultimate principle is that siRNA combines the formation silencing complex with complementary mRNA, causes the mRNA degraded and makes the destination gene expression silence.It is to be started by long double stranded rna molecule that RNA disturbs, this molecule can be processed into the RNA that length is 21-23 Nucleotide by Dicer enzyme, this then little disturbance RNA molecule mixes RNA inductive silencing complex (RNA-induced silencing complex, RISC), guiding nuclease degradation target RNA disturbs thereby produce RNA.This makes the interference carrier of construction expression shRNA, and the long-term silence of genetic expression becomes possibility in the mammalian cell thereby make.

Summary of the invention

The object of the present invention is to provide a kind of structure of silencing esophageal cancer cell HIF-1 Alpha gene 29shRNA expression vector, for being that the esophageal carcinoma new drug development and the gene therapy of target provides novel material with HIF-1 α.

For achieving the above object, the present invention can take following technical proposals:

The structure of silencing esophageal cancer cell HIF-1 Alpha gene 29shRNA expression vector of the present invention comprises the steps:

(1) obtains NM_001530.3 according to NCBI, the 29 oligonucleotide interference sequences of design positive-sense strand 5 ' CTACTCAGGACACAGATTTAGACTTGGAG3 ';

(2) with pENTR/H1/TO be carrier, according to the insertion site of plasmid and the single stranded DNA oligos of joint design design coding shRNA, add link sequence C ACCA in positive-sense strand sequence 5 ', the middle part adds loop ring (GAGA) structure, antisense strand 5 ' end adds the AAAA catenation sequence, and 3 ' end adds T; The dna sequence dna of the final coding shRNA that connects of design is a forward: CACCA CTACT CAGGA CACAG ATTTA GACTT GGAGG AGACT CCAAGTCTAA ATCTG TGTCC TGAGT AG, oppositely: AAAAC TACTC AGGAC ACAGA TTTAG ACTTG GAGTCTCCTC CAAGT CTAAA TCTGT GTCCT GAGTA GT;

(3) single stranded DNA oligos annealing generates double-stranded oligos, double-stranded oligo connects the pENTRTM/H1/TO carrier, carries out ligation, incubated at room 5min according to 20 μ l reaction systems, ice bath and transformed competence colibacillus E.coli are with containing 50mg/l kantlex agar plate screening positive clone; The enlarged culturing positive bacteria also extracts the recombinant plasmid that obtains pENTRTM/H1/TOhif-1 α.

The invention has the advantages that and utilize WHITEHOUSE, siDirect and Rational siRNA Design software to obtain the HIF-1 α target siRNA sequence to be selected of 6 19-23 length of nucleotides; Analyze interference sequence by BLAST and find that with human complete genomic homology and software synthesis scoring the 19 Nucleotide HIF-1 α target siRNA C end that will be positioned at 2056-2074 extends to 2085, it is more excellent to become the scoring of 29 Nucleotide HIF-1 α targeted rna interference sequences; Dong-Ho Kim in 2005 etc. find that also 29 oligonucleotide can more effective inhibition goal gene than 23 oligonucleotide of original recommendation.So add joint and be cloned into linear pENTRTM/H1/TO carrier after 29 oligonucleotide RNA interference sequences being converted to the dna sequence dna of coding shRNA, the false positive of having avoided digestion with restriction enzyme not exclusively to bring identifies that through order-checking sequence is correct.PENTRTM/H1/TOhif-1 α recombinant plasmid transient transfection esophageal epithelial cell Het-1A and after chemical induction western blot method identify target protein, the result can effectively suppress the abduction delivering of HIF-1 α.

Description of drawings

Fig. 1 is the recombinant plasmid sequencer map that the present invention makes up.

Fig. 2 is that HIF-1 α induction expression of protein suppresses design sketch.

Embodiment

The structure of silencing esophageal cancer cell HIF-1 Alpha gene 29ShRNA expression vector of the present invention comprises the steps:

(1a) chemical induction of cell cultures and HIF-1 α

The HET-1A cell culture medium is that the RPMI-1640 nutrient solution that contains 10% foetal calf serum (contains 100000UL ^-1Penicillin and 80000UL ^-1Streptomycin sulphate), in 37 ℃, CO ₂Volume fraction is to cultivate in 5% the incubator.CoCl is used in inducing of HIF-1 α ₂, the final concentration in the nutrient solution is 150 μ mol/L, cell detects HIF-1 α albumen after hatching 4h;

(1b) design of HIF-1 α interference sequence

HIF-1 α gene I and mRNA full length sequence number obtain (NM_001530.3) from NCBI, utilize WHITEHOUSE software to carry out the interference sequence that forecast analysis is made up of 23 Nucleotide, and GC content is controlled at 30%-50%; Utilize the online design software of siDirect simultaneously, acquired mRNA sequence total length is imported sequence frame to be predicted, the selection design guideline is a Reynolds equation, and GC content is controlled at 30%-50%, and operation remotely predicting program obtains to predict the outcome.Utilize the sequence of Rational siRNA Design software verification design at last; Nucleotide Blast with NCBI compares to the nucleotide sequence of each prediction, design obtains the interference sequence of HIF-1 α of 6 19-23 Nucleotide, and final optimization pass obtains a positive-sense strand and is: the 29 oligonucleotide interference sequences of 5 ' CTACTCAGGACACAGATTTAGACTTGGAG3 '; Synthetic simultaneously one is not had the negative control sequence (neg) of homology with Human genome;

(2) with pENTR/H1/TO be carrier, according to the insertion site of plasmid and the single stranded DNA oligos of joint design design coding shRNA, add link sequence C ACCA in positive-sense strand sequence 5 ', the middle part adds loop ring (GAGA) structure, antisense strand 5 ' end adds the AAAA catenation sequence, and 3 ' end adds T; The dna sequence dna of the final coding shRNA that connects of design is a forward: CACCA CTACT CAGGA CACAG ATTTA GACTT GGAGG AGACT CCAAGTCTAA ATCTG TGTCC TGAGT AG, oppositely: AAAAC TACTC AGGAC ACAGA TTTAG ACTTG GAGTCTCCTC CAAGT CTAAA TCTGT GTCCT GAGTA GT;

(3) single stranded DNA oligos annealing generates double-stranded oligos, double-stranded oligo connects the pENTRTM/H1/TO carrier, carries out ligation, incubated at room 5min according to 20 μ l reaction systems, ice bath and transformed competence colibacillus E.coli are with containing 50mg/l kantlex agar plate screening positive clone; The enlarged culturing positive bacteria also extracts the recombinant plasmid that obtains pENTRTM/H1/TOhif-1 α.

(4) recombinant plasmid order-checking

5 resistance clones of picking are incubated overnight in containing 50mg/l kantlex LB liquid nutrient medium, plasmid purification extracts test kit and extracts plasmid, insertion sequence is decided in order-checking, sequencing primer upstream H1:15 '-TGTTCTGGGAAATCACCATA-3 ', downstream M13:5 '-CAGGAAACAGCTATGAC-3 ', order-checking is given birth to the worker by Shanghai and is finished.

(5) Het-1A cell transient transfection

Before the transfection 24h with the Het-1A cell inoculation of logarithmic phase in 6 orifice plates, treat that cell carries out cell transfecting when growing into 90% fusion, the blank group only adds transfection reagent, negative control group transfection pENTRTM/H1/TOhif-neg, experimental group transfection pENTRTM/H1/TOhif-1 α, establish 3 multiple holes for every group, replacing contains two 10% anti-foetal calf serum substratum behind the transfection 6h.

(6) HIF-1 α protein expression is measured

Add chemical inducer CoCl behind the cell transfecting 48h ₂Final concentration is 150 μ mol/L, collect after cultivating 4h, with the RIPA lysate that contains proteinase inhibitor in lysing cell on ice, centrifugal in 4 ℃ of 12000g, supernatant liquor is measured protein concentration with the BCA method, every group of sample got total protein 40 μ g, 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) protein isolate, wet commentaries on classics method goes to the NC film with albumen, behind 5% skimmed milk sealing 1h, adds an anti-rabbit anti-people HIF-1 α (1: 1000) and 4 ℃ of overnight incubation of the anti-people GADPH of rabbit monoclonal antibody (1: 5000) respectively, chemoluminescence method developed the color after 1h was hatched in two anti-(goat anti-rabbit igg of HRP mark, 1: 5000).

Qualification result:

1, the order-checking of pENTRTM/H1/TOhif-1 α recombinant plasmid is identified

The T4 ligase enzyme was connected with the pENTRTM/H1/TO carrier after strand oligos annealing generated double-stranded oligos, transformed competence colibacillus cell TOP10 is after the screening of kantlex agar plate, positive bacterium colony extracts DNA, sequencing is identified the insertion sequence and implementation sequence 100% identical (as shown in Figure 1) that shows constructed recombinant plasmid, and the BLAST analysis revealed makes up plasmid shRNA special target human genome HIF-1 α gene.

2, the abduction delivering of HIF-1 α gene suppresses effect

48h behind Het-1A cell difference transfection pENTRTM/H1/TOhif-1 α recombinant plasmid and the negative control plasmid, after CoCl2 induces simulation anoxic 4h, measure Het-1A cell HIF-1 Alpha expressing quantity with Western blot method, protein level is starkly lower than the cellular control unit of untransfected Het-1A cell and transfection negative control plasmid behind the transfection pENTRTM/H1/TOhif-1 α carrier as a result, and (the 1st group is CoCl as shown in Figure 2 ₂Induce, the untransfected plasmid, the 2nd group is CoCl ₂Induce, the transfection control plasmid, the 3rd group is CoCl ₂Induce, transfection pENTRTM/H1/TOhif-1 α recombinant plasmid, the 4th group is no CoCl ₂Induce any plasmid of untransfected); The shRNA carrier that The above results shows structure has the obvious suppression effect to the abduction delivering of HIF-1 α.

Claims (1)

1. the structure of a silencing esophageal cancer cell HIF-1 Alpha gene 29ShRNA expression vector is characterized in that: comprise the steps:

(1) obtains NM_001530.3 according to NCBI, the 29 oligonucleotide interference sequences of design positive-sense strand 5 ' CTACTCAGGACACAGATTTAGACTTGGAG3 ';

(2) with pENTR/H1/TO be carrier, according to the insertion site of plasmid and the single stranded DNA oligos of joint design design coding shRNA, add catenation sequence CACCA in positive-sense strand sequence 5 ', the middle part adds loop ring (GAGA) structure, antisense strand 5 ' end adds the AAAA catenation sequence, and 3 ' end adds T; The dna sequence dna of the final coding shRNA that connects of design is a forward: CACCA CTACT CAGGA CACAG ATTTA GACTT GGAGG AGACT CCAAGTCTAA ATCTG TGTCC TGAGT AG, oppositely: AAAAC TACTC AGGAC ACAGA TTTAG ACTTG GAGTCTCCTC CAAGT CTAAA TCTGT GTCCT GAGTA GT;

(3) single stranded DNA oligos annealing generates double-stranded oligos, double-stranded oligo connects the pENTRTM/H1/TO carrier, carries out ligation, incubated at room 5min according to 20 μ l reaction systems, ice bath and transformed competence colibacillus E.coli are with containing 50mg/l kantlex agar plate screening positive clone; The enlarged culturing positive bacteria also extracts the recombinant plasmid that obtains pENTRTM/H1/TOhif-1 α.

Images