CN103898137B - One kind containing plasmid and its application of 3 ' UTR sequence of MALAT1 gene and luciferase reporter gene - Google Patents

Abstract

The present invention relates to a kind of plasmid and its applications for containing 3 ' UTR sequence of MALAT1 gene and luciferase reporter gene.Specifically, site of the has-mir-619-5p in conjunction with the 3 ' area UTR of MALAT1 gene is predicted according to bioinformatic database, sequence amplification wherein comprising the binding site is come out, it is inserted into luciferase reporter gene plasmid pmirGLO vector, successfully constructs the 3 ' area UTR luciferase reporter gene plasmid of MALAT1 gene.The plasmid can be used as simple and easy tool, for detecting the expression quantity of the microRNA of regulation MALAT1 expression, the microRNA of screening regulation MALAT1 expression, and the regulating and controlling effect that assessment microRNA expresses MALAT1, the occurrence and development to understand tumour by detection microRNA expression provide important means.

Description

One kind containing the matter of MALAT1 gene 3 ' UTR sequence and luciferase reporter gene Grain and its application

[technical field]

The present invention relates to technical field of molecular biology, specifically, be it is a kind of containing 3 ' UTR sequence of MALAT1 gene and The plasmid of luciferase reporter gene and its application.

[background technique]

It is more than 200nt that long-chain non-coding RNA (long noncoding RNA, lncRNA), which is a kind of transcript length, RNA themselves does not encode albumen, but in the form of RNA in a variety of levels controlling gene expression. LncRNA-MALAT1(Metastasis Associated in Lung Adenocarcinoma Transcript 1) in Found for the first time within 2003, the significantly high expression in non-small cell carcinoma patient tissue, then other many tumours such as liver cancer, It has also been found that MALAT1 is overexpressed in the cancerous tissues such as cancer of pancreas, prostate cancer, intestinal cancer, breast cancer.Many researchs all prompt MALAT1 base Because the invasion transfer with kinds of tumors is closely related, and it is also fewer for the expression regulation research of gene progress at present.

Microrna (microRNA, miRNA) is as small point of non-coding that a kind of endogenic length is about 22 nucleotide Sub- RNA can be expressed in post-transcriptional level regulating mRNA.Quite a few microRNA played in the occurrence and development of tumour to Close important role or oncogene, and or tumor suppressor gene.Most microRNA be by with the 3 ' of target gene UTR Area has an effect, or inhibits the translation of target gene, and also or degradation target gene, the final expression for reducing target gene influence Gene plays due function.Therefore microRNA is the field highly paid close attention to the study on regulation of target gene.

At present for the research report of long-chain genetic regulation by non-coding RNAs and few, since microRNA can be to there is translation energy The target gene of power plays regulating and controlling effect, should also have certain adjustment effect to the post-transcriptional level of long-chain non-coding RNA. In order to study microRNA to the regulating and controlling effect of MALAT1 gene, the corresponding screening of 3 ' UTR design for MALAT1 gene and Detection method is highly studied, this will have the invasion transfer ability of further research MALAT1 gene regulation tumour Important meaning.

[summary of the invention]

The purpose of the present invention is aiming at the shortcomings in the prior art, provide it is a kind of containing 3 ' UTR sequence of MALAT1 gene and The plasmid of luciferase reporter gene.

Another purpose of the invention is to provide the preparation method of above-mentioned plasmid.

Another purpose of the invention is to provide the purposes of above-mentioned plasmid.

To realize above-mentioned first purpose, the technical solution adopted by the present invention is that:

One kind contain MALAT1 gene 3 ' UTR sequence and luciferase reporter gene plasmid, the plasmid be Nucleotide sequence shown in insertion SEQ ID NO.1 in the multiple cloning sites of pmirGLO vector.

Preferably, nucleotide sequence shown in the SEQ ID NO.1 be inserted in pmirGLO vector Pme I and Between Xba I restriction enzyme site.

The plasmid constructs by the following method:

A) the sequence target spot of has-mir-619-5p in conjunction with MALAT1 gene as shown in SEQ ID NO.2 is obtained；

B) implementation sequence primer as shown in SEQ ID NO.3 and SEQ ID NO.4 is obtained by template clone of human genome Obtain nucleotide sequence shown in NO.1 and sequence verification；

C) nucleotide sequence shown in NO.1 that step b) obtains is connected to the Pme I and Xba of pmirGLO vector Between I restriction enzyme site.

To realize above-mentioned second purpose, the technical solution adopted by the present invention is that:

The preparation side of plasmid as described above containing 3 ' UTR sequence of MALAT1 gene and luciferase reporter gene Method, comprising the following steps:

A) the sequence target spot of has-mir-619-5p in conjunction with MALAT1 gene as shown in SEQ ID NO.2 is obtained, really The fixed target fragment to be cloned；

B) implementation sequence primer as shown in SEQ ID NO.3 and SEQ ID NO.4 is obtained by template clone of human genome Obtain nucleotide sequence shown in NO.1 and sequence verification；

C) nucleotide sequence shown in NO.1 that step b) obtains is connected to the Pme I and Xba of pmirGLO vector Between I restriction enzyme site.

To realize above-mentioned third purpose, the technical solution adopted by the present invention is that:

The purposes of plasmid as described above containing 3 ' UTR sequence of MALAT1 gene and luciferase reporter gene, is used In the expression quantity of the microRNA of detection regulation MALAT1 expression, or the microRNA of screening regulation MALAT1 expression, or assessment The regulating and controlling effect that microRNA expresses MALAT1.

The microRNA of the regulation MALAT1 expression is has-mir-619-5p.

The invention has the advantages that:

The present invention is according to bioinformatic database success prediction has-mir-619-5p and the 3 ' area UTR of MALAT1 gene In conjunction with site, will wherein comprising the binding site sequence amplification come out and extend as far as possible target spot appropriate two sides sequence (the short binding site (including has-mir-619-5p) that may can lose many microRNA of segment, thus cannot be right MALAT1 plays regulating and controlling effect；Too long of segment is then less susceptible to PCR amplification, thereby increases and it is possible to will affect the work of luciferase in carrier Property), it is inserted into luciferase reporter gene plasmid pmirGLO vector, it is double glimmering successfully to construct the 3 ' area UTR of MALAT1 gene Light element enzyme reporter plasmid.The plasmid can be used as the expression quantity of the microRNA of detection regulation MALAT1 expression, screening regulation The microRNA of MALAT1 expression, and assessment microRNA is to the simple and easy tool of the MALAT1 regulating and controlling effect expressed, Occurrence and development to understand tumour by detection microRNA expression provide critically important means.

[Detailed description of the invention]

Fig. 1 is the sequence of has-mir-619-5p target spot in conjunction with MALAT1-3-UTR.

Fig. 2 is the MALAT1-3-UTR genetic fragment for the target spot of combination containing has-mir-619-5p that PCR amplification obtains.Its In, 1 is the amplified fragments that Marker, 2 and 3 is 400bp size.

Fig. 3 is the result compared after PCR amplification MALAT1-3-UTR fragment gene is sequenced with ncbi database.

Fig. 4, which is MALAT1-3-UTR gene fragment clone, identifies recombinant clone into PCR after pmirGLO vector carrier Electrophoretogram.Wherein 1 is to identify the clone correctly recombinated through PCR for Marker, 2 and 4.

Fig. 5 is the building flow chart of pmirGLO-MALAT1-3-UTR Dual-Luciferase reporter plasmid.

Fig. 6 is pmirGLO-MALAT1-3-UTR Dual-Luciferase reporter plasmid for detecting has-mir-619-5p pairs The Activity determination result of MALAT1 regulating and controlling effect.Wherein, No insert is empty carrier pmirGLO-vector group, MALAT1-3- UTR is pmirGLO-MALAT1-3-UTR group, and MALAT1-3-UTR-mut is that has-mir-619-5p binding site carries out base The reporter plasmid group of mutation, MALAT1-3-UTR+has-mir-619-5p are pmirGLO-MALAT1-3-UTR+has-mir- 619-5p analogies group, MALAT1-3-UTR-mut+has-mir-619-5p be pmirGLO-MALAT1-3-UTR-mut+ Has-mir-619-5p analogies group.

Fig. 7 is that has-mir-619-5p analogies act on pmirGLO-MALAT1-3-UTR Dual-Luciferase reporter plasmid Working principle diagram.

Fig. 8 is pmirGLO-MALAT1-3-UTR Dual-Luciferase reporter plasmid for further identifying gene early period core The microRNA for having regulating and controlling effect to MALAT1-3-UTR that piece or software prediction obtain.Wherein, Control group is PmirGLO-MALAT1-3-UTR Dual-Luciferase reporter plasmid group is not added with analogies, and 1 simulates for has-mir-619-5p Object, 2 be hsa-miR-5585-3p analogies, and 3 be hsa-miR-5096 analogies, and 4 be hsa-miR-574-5p analogies, and 5 are Hsa-miR-1273g-3p analogies, 6 be hsa-miR-1972 analogies.

[specific embodiment]

It elaborates with reference to the accompanying drawing to specific embodiment provided by the invention.

The building of 1 pmirGLO-MALAT1-3-UTR Dual-Luciferase reporter plasmid of embodiment

(1) bioinformatic database miRDB(http: //mirdb.org/miRDB/ is combined) and ncbi database (http://www.ncbi.nlm.nih.gov) obtains has-mir-619-5p(SEQ ID NO.2) target in conjunction with MALAT1 Point is located at the 3 ' areas UTR of MALAT1 gene, binding site sequence such as Fig. 1.

(2) use 5 software design MALAT1 of primer 3-UTR zone amplication primer, and be added restriction enzyme site Pme I and Xba I.Using human gene group DNA as template, the segment (SEQ ID NO.1, Fig. 2) that size is 400bp is expanded.Primer sequence is such as Under: Sense(SEQ ID NO.3): GGGTTTAAACGATTGGAAAGCTCTC, Antisense(SEQ ID NO.4): TGCTCTAGAGATTAAAGGAAAATG。

PCR amplification condition: 95 DEG C, 5min；95 DEG C, 30s, 60 DEG C, 30s, 72 DEG C, 30s, 35 circulations；72 DEG C, 10min.

PCR reaction system:

,

Gained amplified fragments are correct by sequencing and sequence alignment confirmation, and comparison result is shown in Fig. 3.

(3) correct pcr amplification product and pmirGLO vector carrier will be sequenced, and (Vector map is shown in Fig. 5, is purchased from the U.S. Promega company) it is digested respectively by restriction enzyme Pme I and Xba I, connection is transformed into competent E.coli DH5 α In, screened by ampicillin, PCR identification obtains recombinant vector pmirGLO-MALAT1-3-UTR(Fig. 4).Fig. 5 is recombination The flow chart of plasmid construction.As a result it prompts, the success of MALAT1 promoter luciferase reporting vector construction.

Embodiment 2 is using recombinant plasmid pmirGLO-MALAT1-3-UTR detection has-mir-619-5p to MALAT1 base Because of the regulating and controlling effect in the area 3-UTR

(1) cotransfection pmirGLO-MALAT1-3-UTR plasmid and has-mir-619-5p analogies are in human tumor cell line

According to 5 × 10⁵The amount of a cells/well is inoculated with the LoVo cell of exponential phase of growth in 6 orifice plates, 37 DEG C, It is incubated overnight in 5%CO2 incubator, after cell 80% converges, pmirGLO-MALAT1-3-UTR is carried out in super-clean bench The cell cotransfection of plasmid and has-mir-619-5p analogies.Specifically: the bluk recombination of DNA/ lipid is 1. configured in EP pipe Object, as follows: dilution Plasmid DNA vibrates 1 into 1 mL F12K serum-free antibiotic-free culture solution on turbine mixer Then Liposomal suspensions are added in min, spin up mix again, in 20 min of incubation at room temperature, tie DNA sufficiently with liposome It closes；2. removing the culture solution in tissue culture plate, washed once with PBS, DNA/ liposomal mixtures 1 are added in each hole ML, in 37 DEG C of 5% CO₂5 h are cultivated in incubator, F12K complete culture solution are then added into hole, at 37 DEG C 5% CO₂48 h are cultivated in incubator.

(2) suitable double luciferin detection systems are established

It is measured using Luciferase kit (Promega) and firefly luciferase analyzer (Beahold) every Group firefly luciferase activity, each group set 3 multiple holes.Firefly luciferase Activity determination working solution 1(working solution 1: A liquid (2 mL)+B liquid (40 μ L)+C liquid (10 μ L)；Renilla luciferase Activity determination is with working solution 2:D liquid (2 mL) + E liquid (10 μ L) carries out.The cracking of cell: taking out culture medium, washed once with PBS, and 500 μ L of lysate is added in every hole, Room temperature shakes 15 min.Take 20 μ L cell pyrolysis liquids in the centrifuge tube of 1.5 mL.Working solution 1 is added, setting is prolonged Slow 2 sec, light-emitting appearance, which is surveyed, reads 10 sec.Working solution 2 is added, setting 2 sec of delay, light-emitting appearance, which is surveyed, reads 10 sec, carries out Detection.It is as follows to be grouped situation:

1. LoVo+ PmiRGLO-vector,

2. LoVo+ pmirGLO-MALAT1-3-UTR,

3. LoVo+ pmirGLO-MALAT1-3-UTR-mut,

4. LoVo+ pmirGLO-MALAT1-3-UTR+has-mir-619-5p,

5. LoVo+ pmirGLO-MALAT1-3-UTR-mut+has-mir-619-5p,

Wherein pmirGLO-MALAT1-3-UTR-mut plasmid construction process and pmirGLO-MALAT1-3-UTR plasmid structure Build that process is similar, only the site has-mir-619-5p done number of base mutation (mutant nucleotide sequence are as follows: Gcuaaaguuacaggcaugagcc).Fluorescence detection result after difference group plasmid transfection is shown in Fig. 6, the results showed that building The success of pmirGLO-MALAT1-3-UTR plasmid, and has-mir-619-5p is able to suppress pmirGLO-MALAT1-3-UTR Fluorescence activity, illustrate that has-mir-619-5p is directly targeted regulating and controlling effect to MALAT1.Fig. 7 is has-mir-619-5p Analogies act on the working principle diagram of pmirGLO-MALAT1-3-UTR Dual-Luciferase reporter plasmid.

Embodiment 3 screens potential regulation MALAT1's using recombinant plasmid pmirGLO-MALAT1-3-UTR microRNA

According to microRNA genetic chip or software prediction as a result, design and synthesis are multiple potentially to MALAT1 gene There are the analogies of the microRNA of regulating and controlling effect.Cotransfection reporter plasmid pmirGLO-MALAT1-3-UTR and microRNA simulation Object continues to collect cell after cultivating 48h, judges each microRNA with Dual-Luciferase Activity determination in human colon carcinoma LoVo cells To the regulating and controlling effect of MALAT1 gene.For example: by candidate 6 kinds of microRNA analogies (1, SEQ ID NO.5, hsa- MiR-574-5p:acacacucacacacacacacuca；2, SEQ ID NO.6, hsa-miR-5096: gccugaccaacauggugaaac；3, SEQ ID NO.7, hsa-miR-1972:ucaggccaggcacaguggcuca；4, SEQ ID NO.8, hsa-miR-1273g-3p:accacugcacuccagccugag；5, SEQ ID NO.9, hsa-miR-9: ucuuugguuaucuagcuguauga；6, SEQ ID NO.10, hsa-miR-5585-3p: Cugaauagcugggacuacaggu it) is then detected with pmirGLO-MALAT1-3-UTR plasmid co-transfection LoVo cell respectively Uciferase activity, the results showed that No. 1 analogies have MALAT1-3-UTR Luciferase activity non-relative to other analogies Normal apparent inhibiting effect can be used as the microRNA of potential regulation MALAT1 gene expression for further tumour It studies (Fig. 8).

The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art Member, under the premise of not departing from the method for the present invention, can also make several improvement and supplement, these are improved and supplement also should be regarded as Protection scope of the present invention.

SEQUENCE LISTING

<110>the attached hospital of traditional Chinese hospital, city, Shanghai Univ. of Traditional Chinese Medicine

Shuguang Hospital

<120>a kind of plasmid and its application containing MALAT1 gene 3'UTR sequence and luciferase reporter gene

<130> /

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 400

<212> DNA

<213> human

<400> 1

ttggaaagct ctcttttttg tttttttgag acagtctcac tttgtccccc aggctggagt 60

gtagtggcat gatctctgca aactgcaacc tccacttctg gggtccaagt ggttgtcctg 120

cttcaccctc cctgtagctg ggactacagg tgcacaccac cacgcctggc taatttttgt 180

attttcagtt agagacgtgg ttttaccata ttggccaggc tggtctcaaa ctcctgacct 240

cgtgtgatcc acccgcctgg gcctctgaaa gtgctgggat tacaggtgtg agccaccaag 300

cctggccgat ccttttaagt ttttaaacca gttaagctct ttggttcccc ctcagagtcc 360

caaggtcctg ggtcactcag gatcacattt tcctttaatc 400

<210> 2

<211> 22

<212> RNA

<213>artificial sequence

<400> 2

gcugggauua caggcaugag cc 22

<210> 3

<211> 25

<212> DNA

<213>artificial sequence

<400> 3

gggtttaaac gattggaaag ctctc 25

<210> 4

<211> 24

<212> DNA

<213>artificial sequence

<400> 4

tgctctagag attaaaggaa aatg 24

<210> 5

<211> 23

<212> RNA

<213>artificial sequence

<400> 5

acacacucac acacacacac uca 23

<210> 6

<211> 21

<212> RNA

<213>artificial sequence

<400> 6

gccugaccaa cauggugaaa c 21

<210> 7

<211> 22

<212> RNA

<213>artificial sequence

<400> 7

ucaggccagg cacaguggcu ca 22

<210> 8

<211> 21

<212> RNA

<213>artificial sequence

<400> 8

accacugcac uccagccuga g 21

<210> 9

<211> 23

<212> RNA

<213>artificial sequence

<400> 9

ucuuugguua ucuagcugua uga 23

<210> 10

<211> 22

<212> RNA

<213>artificial sequence

<400> 10

cugaauagcu gggacuacag gu 22

Claims (4)

1. the preparation method of plasmid of the one kind containing 3 ' UTR sequence of MALAT1 gene and luciferase reporter gene, feature It is, comprising the following steps:

A) the sequence target spot of has-mir-619-5p in conjunction with MALAT1 gene as shown in SEQ ID NO.2 is obtained, determines institute The target fragment to be cloned；

B) implementation sequence primer as shown in SEQ ID NO.3 and SEQ ID NO.4 is cloned as template using human genome and is obtained Nucleotide sequence shown in SEQ ID NO.1 and sequence verification；

C) by nucleotide sequence shown in SEQ ID NO.1 that step b) is obtained be connected to pmirGLO vector Pme I and Between XbaI enzyme cutting site.

2. the purposes of plasmid of the one kind containing 3 ' UTR sequence of MALAT1 gene and luciferase reporter gene, which is characterized in that For detecting the expression quantity of the microRNA of regulation MALAT1 expression, or the microRNA of screening regulation MALAT1 expression；It is described Plasmid is that nucleotide sequence shown in SEQ ID NO.1 is inserted into the multiple cloning sites of pmirGLO vector；The tune The microRNA for controlling MALAT1 expression is has-mir-619-5p.

3. purposes according to claim 2, which is characterized in that the insertion of nucleotide sequence shown in the SEQ ID NO.1 Between the Pme I and XbaI enzyme cutting site of pmirGLO vector.

4. purposes according to claim 3, which is characterized in that the plasmid constructs by the following method:

A) the sequence target spot of has-mir-619-5p in conjunction with MALAT1 gene as shown in SEQ ID NO.2 is obtained, determines institute The target fragment to be cloned；

B) implementation sequence primer as shown in SEQ ID NO.3 and SEQ ID NO.4 is cloned as template using human genome and is obtained Nucleotide sequence shown in SEQ ID NO.1 and sequence verification；

C) by nucleotide sequence shown in SEQ ID NO.1 that step b) is obtained be connected to pmirGLO vector Pme I and Between XbaI enzyme cutting site.