CN104745579B - SiRNA, recombinant vector and the purposes of the RAN genes of silence people - Google Patents
SiRNA, recombinant vector and the purposes of the RAN genes of silence people Download PDFInfo
- Publication number
- CN104745579B CN104745579B CN201310749458.2A CN201310749458A CN104745579B CN 104745579 B CN104745579 B CN 104745579B CN 201310749458 A CN201310749458 A CN 201310749458A CN 104745579 B CN104745579 B CN 104745579B
- Authority
- CN
- China
- Prior art keywords
- ran
- sirna
- genes
- recombinant vector
- people
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present invention relates to the siRNA of the RAN genes of silence people, have any sequence such as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.The present invention also provides the siRNA recombinant vectors of the RAN genes containing above-mentioned silence people and the purposes of the siRNA of the RAN genes containing above-mentioned silence people, recombinant vector.SiRNA, the recombinant vector of the RAN genes of silence people provided by the invention can provide effective technical tool for the research of the RAN gene functions of people.
Description
Technical field
The invention belongs to molecular biology and biopharmaceutical technology, and in particular to the RAN genes of silence people
SiRNA, recombinant vector and purposes.
Background technology
RNAi is a kind of posttranscriptional gene silencing mechanism, it causes the mRNA of sequence homology to drop by double-stranded RNA (dsRNA)
Solution, to reduce the expression of target gene, this phenomenon is conservative and extensive during evolution.RNAi technology comes at present
Many fields of bioscience research, become a kind of main biological research tool, for analysis gene function and signal
Conduction path and gene therapy provide a kind of new research means, and the Nobel Prize was obtained in 2006.RNAi has following
Characteristic superiority:1. the specificity of effect, only pair mRNA homologous with it generation inhibiting effect, base mispairing can substantially reduce inhibition
Efficiency;There is 2.RNAi altitude validity, the siRNA of relatively small amount can almost inhibit the expression of target gene.In work
" a kind of method of siRNA (siRNA) is that siRNA sequence is cloned into plasmid as " bob folder " to be carried for conveying in body cell
Body.When being sent into cell body, which is expressed, and forms a double-stranded RNA(shRNA), and by the channels RNAi
Processing is attached to RNA induction silencing complex later(RNA-induced silencing complex, RISC), this compound
Object can combine and cut with the matched mRNA of siRNA sequence, cause mRNA that can not translate into corresponding protein, final silence is thin
The expression of corresponding albumen in born of the same parents.ShRNA includes two short inverted repeats, and centre is stem ring(loop)Sequence, reversed weight
Complex sequences forms a hairpin structure with stem ring sequence.
RAN is Ras families a member to be had the function of GTP enzyme hydrolysis, exercises in the cell as one kind of G-protein family
The effect of " molecular switch " participates in the nucleocytoplasmic transport of cell cycle, the mitotic spindle assembly of prophase of cell division and cell division
The processes such as the nuclear membrane reconstruction in latter stage.
Further research protein-bonded to RAN protein functions and RAN will deeper into understand cell transport, the cell cycle and
The important vital movements such as division.
Invention content
For the needs of gene studies, it is an object of the present invention to provide a kind of siRNA of the RAN genes of silence people.
Second object of the present invention is to provide the purposes of the siRNA of the RAN genes of above-mentioned silence people.
Third object of the present invention is to provide a kind of recombinant vectors of the siRNA of the RAN genes of silence people.
Fourth object of the present invention is to provide the purposes of the recombinant vector of the siRNA of the RAN genes of above-mentioned silence people.
To achieve the above objectives, the technical solution adopted by the present invention is:The siRNA of the RAN genes of silence people has such as
Any sequence of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.
The recombinant vector of the siRNA of the RAN genes of silence people provided by the invention, the RAN bases containing the silence people
The siRNA of cause.
Further, the recombinant vector is built using two-step method, specific method is:The first step, iii vitro chemical synthesize RAN bases
The siRNA expression templates of cause are single-stranded, and annealing in annealing buffer forms double-stranded DNA;Double-stranded DNA is cloned into table by second step
Up to carrier, to be built into recombinant vector.
Further, the expression vector is siRNA carrier for expression of eukaryon Psilencer2.1-U6, pGCsi-U6/Neo/
GFP, pGenesil-1.1 etc. or slow virus carrier pGC-LV.
The siRNA of RAN gene expressions of energy effective reticence people provided by the present invention and the recombination containing the siRNA carry
Body, the research for the RAN gene functions of people provide effective technical tool.
Description of the drawings
Fig. 1 shows the expression of RAN gene mRNA levels, wherein ordinate indicates the opposite of RAN gene mRNA levels
Expression quantity, abscissa 7702-NC indicate control group(Liver cell HL-7702 therein has transfected the recombination of the sequence containing random controls
Plasmid LV-NC-RNAi), 7702-RNA/n(n:1、2、3、4、5)Indicate experimental group(Liver cell therein has transfected recombinant plasmid
LV-RAN-RNAi/n(n:1、2、3、4、5)).
Specific implementation mode
Hereinafter reference will be made to the drawings, and the preferred embodiment of the present invention is described in detail.
Test method without specific conditions in preferred embodiment, usually according to normal condition, such as molecular cloning is real
The condition described in guide (third edition, the works such as J. Pehanorm Brookers, Huang Peitang etc. are translated, Science Press, 2002) is tested, or is pressed
According to the condition proposed by manufacturer.
Embodiment 1
The present embodiment is used to illustrate the construction method of the siRNA of the RAN genes of silence people provided by the invention.
According to the nucleotide sequence for the RAN genes reported in Genbank, 5 inhibition are designed with reference to siRNA design principles
The siRNA target sequences of RAN gene expressions, respectively SEQ ID NO:1-5, while designing random controls sequence SEQ ID
NO.6, as follows:
SEQ ID NO.1:TAAGTCGTGCTCATACTGT;
SEQ ID NO.2:GTCATTTGACTGGTGAATT;
SEQ ID NO.3:GTTCAAACTTGTATTGGTT;
SEQ ID NO.4:CCCTAACTTGGAATTTGTT;
SEQ ID NO.5:GGATATTAAGGACAGGAAA;
SEQ ID NO.6:TTCTCCGAACGTGTCACGT.
Through Blast Genetic homology of carbapenem-resistant, sequence SEQ ID NO.1-5 are not homologous with the non-RAN gene orders of any mankind,
To ensure the specificity of gene inhibition.
For above-mentioned target sequence 5 couples of shRNA (short hairpin are separately designed with reference to the layout strategy of siRNA
RNA, shRNA) sequence expression frame DNA(SEQ ID NO.1’-5’)With a pair of of random controls sequence(SEQ ID NO.6’), such as
Shown in lower:
SEQ ID NO.1’:
Positive-sense strand (RNAi-1F):
5’-ccgg GCACAGTATGAGCACGACTTA CTCGAG TAAGTCGTGCTCATACTGTGC TTTTTg-3’
Antisense strand (RNAi-1R):
5’-aattcaaaaaGCACAGTATGAGCACGACTTACTCGAGTAAGTCGTGCTCATACTGT GC-3’
SEQ ID NO.2’:
Positive-sense strand (RNAi-2F):
5’-ccggACGTCATTTGACTGGTGAATTCTCGAGAATTCACCAGTCAAATGACGTTTTT Tg-3’
Antisense strand (RNAi-2R):
5’-aattcaaaaaACGTCATTTGACTGGTGAATTCTCGAGAATTCACCAGTCAAATGAC GT-3’
SEQ ID NO.3’:
Positive-sense strand (RNAi-3F):
5’-ccggCAGTTCAAACTTGTATTGGTTCTCGAGAACCAATACAAGTTTGAACTGTTTT Tg-3’
Antisense strand (RNAi-3R):
5’-aattcaaaaaCAGTTCAAACTTGTATTGGTTCTCGAGAACCAATACAAGTTTGAAC TG-3’
SEQ ID NO.4’:
Positive-sense strand (RAN RNAi-4F):
5’-ccggGACCCTAACTTGGAATTTGTTCTCGAGAACAAATTCCAAGTTAGGGTCTTTT Tg-3’
Antisense strand (RNAi-4R):
5’-aattcaaaaaGACCCTAACTTGGAATTTGTTCTCGAGAACAAATTCCAAGTTAGGG TC-3’
SEQ ID NO.5’:
Positive-sense strand (RNAi-5F):
5’-ccggGTGGATATTAAGGACAGGAAACTCGAGTTTCCTGTCCTTAATATCCACTTTT Tg-3’
Antisense strand (RNAi-5R):
5’-aattcaaaaaGTGGATATTAAGGACAGGAAACTCGAGTTTCCTGTCCTTAATATCCAC-3’
SEQ ID NO.6’:
Positive-sense strand (control-F):5’-
ccggCATTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATGTTTTTg-3’
Antisense strand (control-R):5’-
aattcaaaaaCATTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATG-3’
Using the positive-sense strand and antisense strand for being chemically synthesized siRNA sequence expression cassette SEQ ID NO.1 ' -6 ', sequence
Middle CTCGAG is loop ring sequences, and TTTTT is transcription terminator.
SEQ ID NO.1 ' -6 ' are formed after transcribing in vivo includes SEQ ID NO.1-6 with CTCGAG for loop stem rings
SiRNA hairpin structures, cut in vivo respectively generate sequence be SEQ ID NO.1-5 RAN siRNAs and NO.6 pair
According to siRNA.
Embodiment 2
The present embodiment is used to illustrate the structure side of the recombinant vector of the siRNA of the RAN genes of silence people provided by the invention
Method.
Carrier uses slow virus carrier pGC-LV(Purchased from Shanghai JiKai Gene Chemical Technology Co., Ltd).Its frame structure
For:
hU6-MCS-Ubiquitin-EGFP-IRES-puromycin。
The construction method of recombinant vector is as follows:
Respectively by the positive-sense strand of 5 couples of shRNA expression framework DNA sequences SEQ ID NO.1 ' -5 ' of siRNA in embodiment 1
And antisense strand is in annealing buffer(10mM Tris-HCl, 1mM EDTA, 0.1mMNaCl)90 DEG C of water-bath 15min are then natural
It is cooled to room temperature, reacts synthetic dsdna(dsDNA)Sequence utilizes double chain DNA sequence I digestion of EcoR I and Age simultaneously
I digestion slow virus carrier pGC-LV of EcoR I and Age makes it generate cohesive end identical with double chain DNA sequence, utilizes T4DNA
The slow virus carrier and DNA fragmentation that ligase linearizes double digestion are stayed overnight in 16 DEG C of connections.Connection product transformed competence colibacillus is thin
Born of the same parents DH5 α, picking transformant are resuspended in LB culture mediums, take 1 μ L as template, positive colony is identified by PCR.PCR is screened
Positive colony student on commission's work bioengineering of identification(Shanghai)Limited liability company's sequencing identification, sequencing result further screen weight
Group carrier.The recombinant vector of structure can direct transfection eukaryocyte, can be used for the packaging of slow virus.Build the recombination obtained
Carrier is expressed as LV-RAN-RNAi/n(n:1、2、3、4、5).
The slow virus LV-NC-RNAi containing random controls sequence is obtained in the same way, as a contrast.
Embodiment 3
The present embodiment is used to illustrate liver of the recombinant vector to people of the siRNA of the RAN genes of silence people provided by the invention
The inhibiting effect of the RAN gene expressions of cell HL-7702.
1, cell culture
Human normal hepatocyte HL-7702 in good condition is inoculated in 6 porocyte culture plates, containing 20% (v/v) calf
In the RPMI1640 culture mediums of serum, 100U/ml penicillin and 100mg/L streptomysins (U.S., Invitrogen companies), in 37
℃、5%(v/v)CO2Under the conditions of cultivate, wait for that cell fusion degree reaches about 80%.Meanwhile the cell cultivated is divided into 6 groups, respectively
For 5 groups of experimental groups and 1 group of control group.
2, gene transfects
Transfection procedure is carried out according to Invitrogen Lipofectamine2000 transfection reagent specifications:More by culture solution
It changes 1640 culture mediums that 2ml is free of serum into, 4.0 μ g plasmids and 10 μ lLipofectamine2000 is taken to be dissolved separately in 250 μ l
In 1640 culture mediums of serum-free, mixing is stored at room temperature 5min, then trains plasmid-culture medium, Lipofectamine2000-
It supports base mixed liquor to be uniformly mixed, is placed at room temperature for 20min, then mixed liquor is added in HL-7702 cells, 37 DEG C, 5% (v/v)
CO2Under the conditions of after culture 12h, change the complete medium containing fresh 20% (v/v) serum into, fluorescent marker is observed in transfection afterwards for 24 hours
The expression of gene judges transfection efficiency, transfects and collects cell after 48h and carry out fluorescence quantitative PCR detection.
3, total RAN extractions
The liver cell of corresponding experimental group and control group, after pancreatin digestion, 1000rpm centrifuges 5min, goes supernatant, cell precipitation
Middle addition 1mlTriol(Invitrogen companies), it is stored at room temperature 5min after rapid piping and druming, is then transferred to new 1.5ml
In eppendorf pipes, often 200 μ l chloroforms are added in pipe, are turned upside down 15sec with hand, are stored at room temperature 10min, 4 DEG C, 12000rpm,
15min is centrifuged, is drawn in supernatant to new eppendorf pipes, the isopropanol being pre-chilled in equal volume is added, is precipitated for 4 DEG C after mixing
10min then 4 DEG C, after 12000rpm centrifuges 10min, removes supernatant, at least 1ml75% (v/v) ethyl alcohol is added, and washing precipitates, and 4
DEG C, 10000rpm centrifuges 10min, discards supernatant, drying at room temperature, 20 μ l RNase-free water dissolutions are then added.
4, reverse transcription and PCR
The method that reverse transcription obtains cDNA:Using TaKaRa companies PrimeScript RT Master Mix kits into
The preparation of row cDNA, reaction system are 10 μ l:5 × PrimeScript RT Master Mix2 μ l, RNA500ng, use RNase
Free water supplies system.Reaction condition is:37℃15min(Reverse transcription reaction), 85 DEG C of 15sec ((The inactivation of reverse transcriptase is anti-
It answers), 4 DEG C of preservations.
Quantitative fluorescent PCR:Using the II real-time kits of SYBR Premix Ex Taq of TaKaRa companies, in real time
The expression of fluorescence quantitative PCR detection RAN gene mRNA levels.RAN gene PCR primers are:Forward Primer(5'-
GAAAGTGAAGGCGAAATCCAT-3'), Reverse Primer (5'-AAGTCGTGCTCATACTGTGCTG-3'), it is selected in
Join gene behaviour beta-actin genes, beta-actin gene primers are:Forward Primer(5'-
TAGTTGCGTTACACCCTTTCTTG-3'), Reverse Primer (5'-TCACCTTCACCGTTCCAGTTT-3').Reaction
System is 25 μ l:12.5 μ l, Forward Primer of SYBR Premix Ex Taq II (2 ×)(10μM)1μl,Reverse
Primer(10μM)1 μ l, cDNA template 2 μ l, sterile water 8.5ul.Reaction condition:95℃30sec(1 cycle);95 DEG C of 5sec,
60℃30sec(40 cycles)
5, result:
Real-time fluorescence quantitative PCR uses Comparative Delta-delta Ct methods, with house-keeping gene beta-actin
For internal reference, the expression of relative quantification RAN genes.Computational methods are:
F=2-[(Measuring samples target gene Average Ct values-measuring samples house-keeping gene Average Ct values)-(Control sample target gene Average Ct values-control sample house-keeping gene Average Ct values)]
The RAN gene mRNA levels relative expression quantities of the experimental group measured and the liver cell of control group are aggregated on Fig. 1.
From Fig. 1 as can be seen that through transfected plasmids LV-RAN-RNAi/n(n:1、2、3、4、5)Liver cell in, RAN bases
The mRNA expressions of cause are remarkably decreased compared with compareing liver cell, illustrate that the siRNA of the RAN of the present invention can be efficiently specific
Ground inhibits the expression of liver cell RAN genes.
It can also be seen that the silence effect of the RAN genes of the experimental group of transfection recombinant plasmid LV-RAN-RNAi/1 from Fig. 1
Fruit is best, therefore when preparing the cell model of RAN genes of silence people, and it is most effective people RAN that SEQ ID NO.1, which may be selected,
Gene siRNA sequence.
Above-described embodiment is to the present invention for example, the present invention can also be with other ad hoc fashions or others
Particular form is implemented, without departing from the gist of the invention or substantive characteristics.Therefore, from the point of view of the embodiment of description is in terms of any
It is regarded as illustrative and non-limiting.The scope of the present invention should illustrate by appended claims, any and claim
Intention and the equivalent variation of range should also be included in the scope of the present invention.
Claims (7)
1. the siRNA of the RAN genes of silence people, which is characterized in that its sequence is the sequence of SEQ ID NO.1.
2. purposes of the siRNA of the RAN genes of silence people described in claim 1 in preparing RAN gene silencing cell models.
3. the recombinant vector of the siRNA of the RAN genes of silence people, which is characterized in that the recombinant vector contains claim 1 institute
The siRNA of the RAN genes of the silence people stated.
4. recombinant vector according to claim 3, which is characterized in that build the recombinant vector using two-step method, specifically
Method is:The first step, the siRNA expression templates that iii vitro chemical synthesizes RAN genes are single-stranded, and annealing formation is double in annealing buffer
Chain DNA;Double-stranded DNA is cloned into expression vector by second step, to be built into recombinant vector.
5. recombinant vector according to claim 4, which is characterized in that the expression vector is siRNA carrier for expression of eukaryon
Psilencer2.1-U6, pGCsi-U6/Neo/GFP, pGenesil-1.1 or slow virus carrier pGC-LV.
6. the recombinant vector of the siRNA of the RAN genes of any silence people of claim 3-5 is preparing RAN gene silencings
Purposes in cell model.
7. purposes according to claim 6, which is characterized in that the recombinant vector of the siRNA of the RAN genes of silence people is being made
Purposes in the liver cell RAN gene cell models of standby silence people.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310749458.2A CN104745579B (en) | 2013-12-31 | 2013-12-31 | SiRNA, recombinant vector and the purposes of the RAN genes of silence people |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310749458.2A CN104745579B (en) | 2013-12-31 | 2013-12-31 | SiRNA, recombinant vector and the purposes of the RAN genes of silence people |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104745579A CN104745579A (en) | 2015-07-01 |
CN104745579B true CN104745579B (en) | 2018-09-25 |
Family
ID=53585838
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310749458.2A Active CN104745579B (en) | 2013-12-31 | 2013-12-31 | SiRNA, recombinant vector and the purposes of the RAN genes of silence people |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104745579B (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103074374A (en) * | 2013-01-16 | 2013-05-01 | 薛博夫 | Recombinant expression vector for human beta-NGF and recombinant cell strain containing same |
-
2013
- 2013-12-31 CN CN201310749458.2A patent/CN104745579B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103074374A (en) * | 2013-01-16 | 2013-05-01 | 薛博夫 | Recombinant expression vector for human beta-NGF and recombinant cell strain containing same |
Non-Patent Citations (2)
Title |
---|
RAN siRNA对辐射又发基因组不稳定肝细胞凋亡及细胞周期的影响;党旭红等;《中国药理学与毒理学杂志》;20131130;第27卷;摘要 * |
小G蛋白Ran对胰腺癌细胞增殖和凋亡的调控;邓林等;《现代生物医学进展》;20130210;第13卷(第4期);第658-661页 * |
Also Published As
Publication number | Publication date |
---|---|
CN104745579A (en) | 2015-07-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104745579B (en) | SiRNA, recombinant vector and the purposes of the RAN genes of silence people | |
CN104745580B (en) | SiRNA, recombinant vector and the purposes of the CDT1 genes of silence people | |
CN103103189B (en) | Novel method for overexpression of single MicroRNA (Micro Ribonucleic Acid) mature body sequence | |
CN105734058B (en) | SiRNA, recombinant vector and the purposes of the HAVCR2 gene of silencing people | |
CN105002181B (en) | A kind of rat Kif11 genes interference shRNA and its recombinant adeno-associated virus and antitumor application thereof | |
CN103937745B (en) | People A375 stable cell strain and the construction method of long-chain non-coding GAS5 defect | |
CN103952413B (en) | The rnai expression vector construction of targeting IFNAR 2 gene and application | |
Gong et al. | MiRNA-let-7b decreases proliferation activities and development of follicular cells via targeting MAP3K1 gene | |
CN103898118A (en) | siRNA for inhibiting expression of human myofilament binding protein 1L2 gene and expression vector and application thereof | |
Jiang et al. | shRNA inhibits the expression of chicken telomerase reverse transcriptase in MDCC-MSB1 cells | |
Sheet | miRNASelect™ pEP-hsa-mir-27a Expression Vector | |
CN104293787A (en) | siRNA for inhibiting dairy cow EEF1D gene expression and application of siRNA | |
Sheet | CATALOG NUMBER: MIR-1-1 STORAGE:-80ºC | |
Sheet | miRNASelect™ pEP-hsa-mir-34c Expression Vector | |
Sheet | miRNASelect™ pEP-mir-92a-1 Expression Vector | |
Sheet | CATALOG NUMBER: MIR-7-2 STORAGE:-80ºC | |
Sheet | miRNASelect™ pEP-mir-34c Expression Vector | |
Cao et al. | Computer-based siRNA design to hepatitis B virus and its expression vector construction | |
Sheet | CATALOG NUMBER: MIR-924 STORAGE:-80ºC | |
Sheet | miRNASelect™ pEP-mir-548d-1 Expression Vector | |
Sheet | miRNASelect™ pEGP-mir Null Control Vector | |
Sheet | miRNASelect™ pEP-hsa-let-7a-3 Expression Vector | |
Sheet | miRNASelect™ pEP-hsa-mir-526a-2 Expression Vector | |
Sheet | CATALOG NUMBER: MIR-543 STORAGE:-80ºC | |
Sheet | miRNASelect™ pEP-hsa-mir-520f Expression Vector |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |