CN104745579A - SiRNA silencing human RAN gene, recombinant vector and application - Google Patents
SiRNA silencing human RAN gene, recombinant vector and application Download PDFInfo
- Publication number
- CN104745579A CN104745579A CN201310749458.2A CN201310749458A CN104745579A CN 104745579 A CN104745579 A CN 104745579A CN 201310749458 A CN201310749458 A CN 201310749458A CN 104745579 A CN104745579 A CN 104745579A
- Authority
- CN
- China
- Prior art keywords
- sirna
- ran gene
- seq
- gene
- ran
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to siRNA silencing a human RAN gene. The siRNA has any sequence of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5. The invention further provides a recombinant vector with the siRNA silencing the human RAN gene, and application of the siRNA silencing the human RAN gene and the recombinant vector. By adopting the siRNA silencing the human RAN gene and the recombinant vector, an effective technique tool can be provided for study on functions of the RAN gene.
Description
Technical field
The invention belongs to molecular biology and biological pharmacy technical field, be specifically related to the siRNA of the RAN gene of reticent people, recombinant vectors and purposes.
Background technology
RNAi is a kind of PTGS mechanism, and it causes the mRNA of sequence homology to degrade by double-stranded RNA (dsRNA), reduces the expression of target gene, and this phenomenon is conservative and extensive during evolution.Current RNAi technology has entered many fields of bio-science research, become a kind of main biological research tool, for analyzing gene function and signal transduction pathway and gene therapy provide a kind of new research means, obtained the Nobel prize in 2006.RNAi has following characteristics advantage: 1. the specificity of effect, and only produce restraining effect to the mRNA with its homology, base mispairing can reduce suppression efficiency greatly; 2.RNAi has altitude validity, and the siRNA of relatively small amount just almost can suppress the expression of target gene completely.In active somatic cell, " a kind of way of siRNA (siRNA) is, siRNA sequence is cloned into plasmid vector as " bob folder " in conveying.When sending in cell paste, this hairpin is expressed out, form a double-stranded RNA (shRNA), and by the process of RNAi passage, be attached to RNA afterwards and induce silencing complex (RNA-induced silencing complex, RISC), this mixture can in conjunction with and cut the mRNA that mates with siRNA sequence, cause mRNA cannot translate into respective egg white matter, the expression of corresponding protein in final silenced cell.ShRNA comprises two short inverted repeats, and centre is stem ring (loop) sequence, and inverted repeats and stem ring sequence form a hairpin structure.
RAN is Ras family a member, as a class of G-protein family, have GTP enzymic hydrolysis function, exercise the effect of " molecular switch " in cell, it participates in the processes such as the nuclear membrane reconstruction of the nucleocytoplasmic transport of cell cycle, the mitotic spindle assembly of prophase of cell division and telophase.
The important vital movements such as cell transport, cell cycle and division more will be understood in depth to RAN protein function and the protein-bonded further research of RAN.
Summary of the invention
For the needs of gene studies, an object of the present invention is to provide the siRNA of the RAN gene of a kind of reticent people.
Second object of the present invention is to provide the purposes of the siRNA of the RAN gene of above-mentioned reticent people.
3rd object of the present invention is to provide the recombinant vectors of the siRNA of the RAN gene of a kind of reticent people.
4th object of the present invention is to provide the purposes of the recombinant vectors of the siRNA of the RAN gene of above-mentioned reticent people.
For reaching above object, the technical solution used in the present invention is: the siRNA of the RAN gene of reticent people, has the arbitrary sequence as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.
The recombinant vectors of the siRNA of the RAN gene of reticent people provided by the invention, the siRNA of the RAN gene containing described reticent people.
Further, adopt two-step approach to build described recombinant vectors, concrete grammar is: the first step, the siRNA expression template strand of iii vitro chemical synthesis RAN gene, and in annealing buffer, annealing forms double-stranded DNA; Second step, is cloned into expression vector by double-stranded DNA, thus is built into recombinant vectors.
Further, described expression vector is siRNA carrier for expression of eukaryon Psilencer2.1-U6, pGCsi-U6/Neo/GFP, pGenesil-1.1 etc., or lentiviral vectors pGC-LV.
Provided by the present invention can effective reticent people RAN genetic expression siRNA and containing the recombinant vectors of this siRNA, for the research of the RAN gene function of people provides effect technique instrument.
Accompanying drawing explanation
Fig. 1 represents the expression of RAN gene mRNA levels, wherein ordinate zou represents the relative expression quantity of RAN gene mRNA levels, X-coordinate 7702-NC represents control group (liver cell HL-7702 transfection is wherein containing the recombinant plasmid LV-NC-RNAi of random controls sequence), 7702-RNA/n(n:1,2,3,4,5) represent experimental group (liver cell transfection wherein recombinant plasmid LV-RAN-RNAi/n(n:1,2,3,4,5)).
Embodiment
Hereinafter with reference to accompanying drawing, the preferred embodiments of the present invention are described in detail.
The experimental technique of unreceipted actual conditions in preferred embodiment, usually conveniently condition, such as the Molecular Cloning: A Laboratory guide (third edition, J. the work such as Pehanorm Brooker, Huang Peitang etc. translate, Science Press, 2002) described in condition, or according to the condition that manufacturer advises.
Embodiment 1
The present embodiment is for illustration of the construction process of the siRNA of the RAN gene of reticent people provided by the invention.
According to the nucleotide sequence of the RAN gene reported in Genbank, design with reference to siRNA principle of design the siRNA target sequence that 5 are suppressed RAN genetic expression, be respectively SEQ ID NO:1-5, design random controls sequence SEQ ID NO.6 simultaneously, as follows:
SEQ ID NO.1：TAAGTCGTGCTCATACTGT；
SEQ ID NO.2：GTCATTTGACTGGTGAATT；
SEQ ID NO.3：GTTCAAACTTGTATTGGTT；
SEQ ID NO.4：CCCTAACTTGGAATTTGTT；
SEQ ID NO.5：GGATATTAAGGACAGGAAA；
SEQ ID NO.6：TTCTCCGAACGTGTCACGT。
Through Blast Genetic homology of carbapenem-resistant, sequence SEQ ID NO.1-5 not with any mankind non-RAN gene order homology, to guarantee the specificity of gene inhibition.
For above-mentioned target sequence, with reference to the layout strategy of siRNA, design 5 pairs of shRNA (shorthairpin RNA, shRNA) sequences respectively and express framework DNA(SEQ ID NO.1 '-5 ') and a pair random controls sequence (SEQ ID NO.6 '), as follows:
SEQ ID NO.1’：
Positive-sense strand (RNAi-1F):
5’-ccgg GCACAGTATGAGCACGACTTA CTCGAG TAAGTCGTGCTCATACTGTGCTTTTTg-3’
Antisense strand (RNAi-1R):
5’-aattcaaaaaGCACAGTATGAGCACGACTTACTCGAGTAAGTCGTGCTCATACTGTGC-3’
SEQ ID NO.2’：
Positive-sense strand (RNAi-2F):
5’-ccggACGTCATTTGACTGGTGAATTCTCGAGAATTCACCAGTCAAATGACGTTTTTTg-3’
Antisense strand (RNAi-2R):
5’-aattcaaaaaACGTCATTTGACTGGTGAATTCTCGAGAATTCACCAGTCAAATGACGT-3’
SEQ ID NO.3’：
Positive-sense strand (RNAi-3F):
5’-ccggCAGTTCAAACTTGTATTGGTTCTCGAGAACCAATACAAGTTTGAACTGTTTTTg-3’
Antisense strand (RNAi-3R):
5’-aattcaaaaaCAGTTCAAACTTGTATTGGTTCTCGAGAACCAATACAAGTTTGAACTG-3’
SEQ ID NO.4’：
Positive-sense strand (RAN RNAi-4F):
5’-ccggGACCCTAACTTGGAATTTGTTCTCGAGAACAAATTCCAAGTTAGGGTCTTTTTg-3’
Antisense strand (RNAi-4R):
5’-aattcaaaaaGACCCTAACTTGGAATTTGTTCTCGAGAACAAATTCCAAGTTAGGGTC-3’
SEQ ID NO.5’：
Positive-sense strand (RNAi-5F):
5’-ccggGTGGATATTAAGGACAGGAAACTCGAGTTTCCTGTCCTTAATATCCACTTTTTg-3’
Antisense strand (RNAi-5R):
5’-aattcaaaaaGTGGATATTAAGGACAGGAAACTCGAGTTTCCTGTCCTTAATATCCAC-3’
SEQ ID NO.6’：
Positive-sense strand (control-F): 5 '-ccggCATTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATGTTTT Tg-3 '
Antisense strand (control-R): 5 '-aattcaaaaaCATTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAA TG-3 '
Adopt positive-sense strand and the antisense strand of chemical process synthesis siRNA sequence expression cassette SEQ ID NO.1 '-6 ', in its sequence, CTCGAG is loop ring sequence, and TTTTT is transcription terminator.
SEQ ID NO.1 '-6 ' transcribes the siRNA hairpin structure comprising SEQ ID NO.1-6 that rear formation take CTCGAG as loop stem ring in vivo, cuts in vivo and produces the contrast siRNA that sequence is siRNAs and NO.6 of the RAN of SEQ IDNO.1-5 respectively.
Embodiment 2
The present embodiment is for illustration of the construction process of the recombinant vectors of the siRNA of the RAN gene of reticent people provided by the invention.
Carrier adopts lentiviral vectors pGC-LV(purchased from Shanghai JiKai Gene Chemical Technology Co., Ltd).Its skeleton construction is:
hU6-MCS-Ubiquitin-EGFP-IRES-puromycin。
The construction process of recombinant vectors is as follows:
Respectively the 5 couples of shRNA of siRNA in embodiment 1 are expressed the positive-sense strand of framework DNA sequences SEQ ID NO.1 '-5 ' and antisense strand at annealing buffer (10mM Tris-HCl, 1mM EDTA, 0.1mMNaCl) 90 DEG C of water-bath 15min, then room temperature is naturally cooled to, Reactive Synthesis double-stranded DNA (dsDNA) sequence, double chain DNA sequence EcoR I and Age I enzyme are cut, utilize EcoR I and Age I enzyme to cut lentiviral vectors pGC-LV simultaneously, it is made to produce the sticky end identical with double chain DNA sequence, T4DNA ligase enzyme is utilized linearizing for double digestion lentiviral vectors and DNA fragmentation to be spent the night in 16 DEG C of connections.Connect product conversion competent cell DH5 α, picking transformant is resuspended in LB substratum, gets 1 μ L as template, identifies positive colony by PCR.By the order-checking qualification of positive colony student on commission work biotechnology (Shanghai) limited-liability company of PCR Screening and Identification, sequencing result screens recombinant vectors further.The recombinant vectors built can direct transfection eukaryotic cell, also may be used for the packaging of slow virus.Build the recombinant vectors obtained and be expressed as LV-RAN-RNAi/n(n:1,2,3,4,5).
The slow virus LV-NC-RNAi containing random controls sequence is obtained, in contrast by same method.
Embodiment 3
The present embodiment for illustration of the recombinant vectors of the siRNA of the RAN gene of reticent people provided by the invention to the restraining effect of the RAN genetic expression of the liver cell HL-7702 of people.
1, cell cultures
Human normal hepatocyte HL-7702 in good condition is inoculated in 6 porocyte culture plates, (the U.S. in the RPMI1640 substratum containing 20% (v/v) calf serum, 100U/ml penicillin and 100mg/L Streptomycin sulphate, Invitrogen company), in 37 DEG C, 5% (v/v) CO
2cultivate under condition, treat that cytogamy degree reaches about 80%.Meanwhile, institute's cultured cells is divided into 6 groups, is respectively 5 groups of experimental group and 1 group of control group.
2, gene transfection
Transfection procedure is carried out: nutrient solution is replaced with 2ml not containing 1640 substratum of serum according to Invitrogen Lipofectamine2000 transfection reagent specification sheets, get 4.0 μ g plasmids and 10 μ lLipofectamine2000 are dissolved in 1640 substratum of 250 μ l serum-frees respectively, mixing, room temperature leaves standstill 5min, then plasmid-substratum, Lipofectamine2000-substratum mixed solution are mixed, room temperature places 20min, then mixed solution is added in HL-7702 cell, 37 DEG C, 5% (v/v) CO
2after cultivating 12h under condition, change the perfect medium containing fresh 20% (v/v) serum into, observe the expression of fluorescent marker gene after transfection 24h to judge transfection efficiency, after transfection 48h, collecting cell carries out fluorescence quantitative PCR detection.
3, total RAN extracts
The liver cell of corresponding experimental group and control group, after trysinization, the centrifugal 5min of 1000rpm, remove supernatant, 1mlTriol(Invitrogen company is added) in cell precipitation, after rapid piping and druming, room temperature leaves standstill 5min, then be transferred in new 1.5ml eppendorf pipe, often pipe adds 200 μ l chloroforms, to turn upside down 15sec with hand, room temperature leaves standstill 10min, 4 DEG C, 12000rpm, centrifugal 15min, draw supernatant in new eppendorf pipe, add the Virahol of equal-volume precooling, mix rear 4 DEG C of precipitation 10min, then 4 DEG C, after the centrifugal 10min of 12000rpm, remove supernatant, add at least 1ml75% (v/v) ethanol, washing precipitation, 4 DEG C, the centrifugal 10min of 10000rpm, supernatant discarded, drying at room temperature, then 20 μ l RNase-free water dissolution are added.
4, reverse transcription and PCR
Reverse transcription obtains the method for cDNA: utilize TaKaRa company PrimeScript RT Master Mix test kit to carry out the preparation of cDNA, reaction system is 10 μ l:5 × PrimeScript RT MasterMix2 μ l, RNA500ng, supplies system with RNase Free water.Reaction conditions is: 37 DEG C of 15min(reverse transcription reactions), 85 DEG C of 15sec ((inactivation reaction of ThermoScript II), 4 DEG C of preservations.
Quantitative fluorescent PCR: the SYBR Premix Ex Taq II real-time test kit utilizing TaKaRa company, real-time fluorescence quantitative PCR detects the expression of RAN gene mRNA levels.RAN gene PCR primer is: Forward Primer(5'-GAAAGTGAAGGCGAAATCCAT-3'), ReversePrimer (5'-AAGTCGTGCTCATACTGTGCTG-3'), selected reference gene behaviour beta-actin gene, beta-actin gene primer is: Forward Primer(5'-TAGTTGCGTTACACCCTTTCTTG-3'), ReversePrimer (5'-TCACCTTCACCGTTCCAGTTT-3').Reaction system is 25 μ l:SYBR PremixEx Taq II (2 ×) 12.5 μ l, Forward Primer(10 μM) 1 μ l, Reverse Primer(10 μM) 1 μ l, cDNA template 2 μ l, sterilized water 8.5ul.Reaction conditions: 95 DEG C 30sec(1 circulation); 95 DEG C of 5sec, 60 DEG C 30sec(40 circulation)
5, result:
Real-time fluorescence quantitative PCR adopts Comparative Delta-delta Ct method, with house-keeping gene beta-actin for internal reference, and the expression level of relative quantification RAN gene.Method of calculation are:
F=2
-[(measuring samples goal gene Average Ct values-measuring samples house-keeping gene Average Ct values)-(control sample goal gene Average Ct values-average Ct of control sample house-keeping gene value)]
The hepatocellular RAN gene mRNA levels relative expression quantity of the experimental group recorded and control group is aggregated on Fig. 1.
As can be seen from Fig. 1, through transfected plasmids LV-RAN-RNAi/n(n:1,2,3,4,5) liver cell in, mrna expression level remarkable decline compared with contrast liver cell of RAN gene, illustrates that the siRNA of RAN of the present invention efficiently can suppress the expression of liver cell RAN gene specifically.
It can also be seen that from Fig. 1, the silencing efficiency of the RAN gene of the experimental group of transfection recombinant plasmid LV-RAN-RNAi/1 is best, therefore, when preparing the cell model of RAN gene of reticent people, SEQ ID NO.1 can be selected for the most effective people RAN gene siRNA sequence.
Above-described embodiment just illustrates of the present invention, and the present invention also can implement with other ad hoc fashion or other particular form, and does not depart from main idea of the present invention or essential characteristic.Therefore, description embodiment from the viewpoint of any all should be considered as illustrative but not determinate.Scope of the present invention should be illustrated by the claim of adding, any also should be within the scope of the present invention with the intention of claim and the change of scope equivalence.
Claims (7)
1. the siRNA of the RAN gene of reticent people, is characterized in that, has the arbitrary sequence as SEQ ID NO.1, SEQID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.
2. the purposes of siRNA in preparation RAN gene silencing cell model of the RAN gene of reticent people according to claim 1.
3. the recombinant vectors of the siRNA of the RAN gene of reticent people, is characterized in that, described recombinant vectors contains the siRNA of the RAN gene of reticent people according to claim 1.
4. recombinant vectors according to claim 3, is characterized in that, adopt two-step approach to build described recombinant vectors, concrete grammar is: the first step, the siRNA expression template strand of iii vitro chemical synthesis RAN gene, and in annealing buffer, annealing forms double-stranded DNA; Second step, is cloned into expression vector by double-stranded DNA, thus is built into recombinant vectors.
5. recombinant vectors according to claim 4, is characterized in that, described expression vector is siRNA carrier for expression of eukaryon Psilencer2.1-U6, pGCsi-U6/Neo/GFP, pGenesil-1.1 or lentiviral vectors pGC-LV.
6. the purposes of recombinant vectors in preparation RAN gene silencing cell model of the siRNA of the RAN gene of the arbitrary described reticent people of claim 3-5.
7. purposes according to claim 6, is characterized in that, the purposes of recombinant vectors in the liver cell RAN gene cell model of the reticent people of preparation of the siRNA of the RAN gene of reticent people.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310749458.2A CN104745579B (en) | 2013-12-31 | 2013-12-31 | SiRNA, recombinant vector and the purposes of the RAN genes of silence people |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310749458.2A CN104745579B (en) | 2013-12-31 | 2013-12-31 | SiRNA, recombinant vector and the purposes of the RAN genes of silence people |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104745579A true CN104745579A (en) | 2015-07-01 |
| CN104745579B CN104745579B (en) | 2018-09-25 |
Family
ID=53585838
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310749458.2A Active CN104745579B (en) | 2013-12-31 | 2013-12-31 | SiRNA, recombinant vector and the purposes of the RAN genes of silence people |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104745579B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103074374A (en) * | 2013-01-16 | 2013-05-01 | 薛博夫 | Recombinant expression vector for human beta-NGF and recombinant cell strain containing same |
-
2013
- 2013-12-31 CN CN201310749458.2A patent/CN104745579B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103074374A (en) * | 2013-01-16 | 2013-05-01 | 薛博夫 | Recombinant expression vector for human beta-NGF and recombinant cell strain containing same |
Non-Patent Citations (2)
| Title |
|---|
| 党旭红等: "RAN siRNA对辐射又发基因组不稳定肝细胞凋亡及细胞周期的影响", 《中国药理学与毒理学杂志》 * |
| 邓林等: "小G蛋白Ran对胰腺癌细胞增殖和凋亡的调控", 《现代生物医学进展》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104745579B (en) | 2018-09-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhao et al. | Sequence-specific inhibition of microRNA via CRISPR/CRISPRi system | |
| CN104726500B (en) | Application of the MicroRNA26b 3p inhibitor in people's umbilical cord derived mesenchymal stem cell is prepared | |
| Xiang et al. | The miR-17-92 cluster regulates FOG-2 expression and inhibits proliferation of mouse embryonic cardiomyocytes | |
| Yang et al. | MicroRNA-27a promotes porcine myoblast proliferation by downregulating myostatin expression | |
| CN106244590A (en) | Modified siRNA molecule, RNAi molecule mixture and application thereof | |
| Gao et al. | Aal-circRNA-407 regulates ovarian development of Aedes albopictus, a major arbovirus vector, via the miR-9a-5p/Foxl axis | |
| CN104745580A (en) | siRNA (small interfering RNA) of CDT1 gene of silent person, recombinant vector and application or siRNA and recombinant vector | |
| CN104745579A (en) | SiRNA silencing human RAN gene, recombinant vector and application | |
| CN103103189B (en) | Novel method for overexpression of single MicroRNA (Micro Ribonucleic Acid) mature body sequence | |
| CN103695427B (en) | Small interfering RNA (Ribonucleic Acid) and recombinant vector for knocking down VPS11 (Vacuolar Protein Sorting-Associated Protein 11), and application of small interfering RNA and recombinant vector | |
| CN102229928B (en) | Small-interfering RNA (Ribonucleic Acid) of human RBBP6 (Retinoblastoma-binding Proteingene) and application thereof | |
| CN105734058B (en) | SiRNA, recombinant vector and the purposes of the HAVCR2 gene of silencing people | |
| CN110218701B (en) | Cell model for screening miRNA (micro ribonucleic acid) regulating agent and application | |
| Wang et al. | MiRNA-378 controls cell proliferation in rabbit umbilical cord mesenymal stem cells | |
| CN103937745B (en) | People A375 stable cell strain and the construction method of long-chain non-coding GAS5 defect | |
| Yang et al. | Downregulation of Circ‐PITHD1 Suppressed Colorectal Cancer via Glycolysis Inhibition through miR‐590‐5p/HK2 Axis | |
| chang Yin et al. | Identification and comparison of the porcine H1, U6, and 7SK RNA polymerase III promoters for short hairpin RNA expression | |
| CN105002181A (en) | Rat Kif11 gene-interfered shRNA, recombinant adeno-associated virus thereof and anti-neoplastic application thereof | |
| CN102174514A (en) | Double-stranded siRNA (Small Interfering Ribonucleic Acid) for suppressing Hmga2 gene expression and application thereof | |
| CN104726456A (en) | siRNA for inhibiting human malignant melanoma RNF11 gene expression | |
| CN115161392A (en) | Application of TMEM144 in preparation of tumor medicine | |
| Sheet | CATALOG NUMBER: MIR-1-1 STORAGE:-80ºC | |
| CN105936917A (en) | GRP78 gene targeted RNA interference recombinant lentivirus vectors and construction method | |
| Sheet | CATALOG NUMBER: MIR-924 STORAGE:-80ºC | |
| Sheet | miRNASelect™ pEP-mir-92a-1 Expression Vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |